Application of circular RNA circPROSC in the treatment of craniosynostosis
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-06
- Publication Date
- 2026-08-14
AI Technical Summary
然而,CRISPR/Cas9的脱靶效应可能导致其他基因的永久性变化,从而限制其临床应用
Smart Images

Figure CN122557746A_ABST
Abstract
Description
[0001] Case Analysis
[0002] This invention is a divisional application of the following Chinese invention patent application:
[0003] Invention Title: Application of Circular RNA circPROSC in the Treatment of Craniosynostosis
[0004] Application Number: 2023108245595
[0005] Application date: 2023-7-6 Technical Field
[0006] This invention belongs to the fields of molecular biology and clinical medicine, specifically relating to the application of circular RNA circPROSC as a therapeutic target for minimally invasive treatment of craniosynostosis. Background Technology
[0007] Craniosynostosis is a condition caused by the premature fusion of cranial sutures at birth or after birth, leading to craniofacial deformities and subsequently affecting brain development. The estimated incidence of craniosynostosis is approximately 1 in 2500. If left untreated, it can significantly restrict the growth of the corresponding skull bones, causing skull deformities and limiting brain development. Currently, the main treatment for craniosynostosis is surgery, which aims to improve the appearance of the skull and prevent sequelae. However, surgery is highly invasive and carries significant risks, causing serious psychological and physical harm to both the child and their parents. Therefore, finding safer and more effective treatment methods to alleviate the suffering of affected children is crucial.
[0008] In the diagnosis and treatment of diseases, identifying reliable diagnostic biomarkers is crucial for accurately determining the presence and severity of the disease. However, not all biomarkers used for diagnosis can serve as therapeutic targets. Tumor biomarkers, such as carcinoembryonic antigen (CEA) and prostate-specific antigen (PSA), are commonly used in the diagnosis of many tumors. While these biomarkers have some value in early tumor screening and diagnosis, they are not suitable as therapeutic targets. This is because the expression levels of these biomarkers do not directly indicate the treatment response or prognosis. Furthermore, biomarkers commonly used in neurodegenerative diseases, such as β-amyloid (Aβ) and tau protein, help determine the presence of the disease during the diagnostic stage but cannot be directly used as therapeutic targets. A deeper understanding of the mechanisms of diagnostic biomarker formation and their role in disease may contribute to the development of more precise therapeutic targets and intervention strategies.
[0009] Circular RNAs (circRNAs) are a novel class of non-coding RNAs characterized by their covalently closed circular structure, lack of polyadenylated tails, and greater stability and longer half-life compared to linear RNAs. Increasing research suggests that circRNAs participate in the regulation of important life processes such as cell differentiation and individual development at multiple levels, revealing their crucial role in the pathogenesis of various human diseases. Under various pathological conditions, circRNAs can be specifically and differentially expressed in tissues and body fluids. Although circulating circRNAs can serve as potential biomarkers for diagnosing disease progression, they are not necessarily therapeutic targets. Therefore, identifying circRNAs that produce therapeutic effects through intervention or regulation is of great value in determining new drug treatments or therapeutic strategies.
[0010] At the genomic level, the recently developed CRISPR / Cas9 gene editing technology has shown great potential in gene therapy for diseases. However, off-target effects of CRISPR / Cas9 can lead to permanent changes in other genes, thus limiting its clinical application. Local or systemic exogenous RNA interference (RNAi) is more practical. RNAi has emerged as a promising approach to alter cancer treatment and is currently in early stages of clinical trials. Studies have shown that RNAi-based transthyretin amyloidosis (ATTR) therapy (Patisiran) has been approved by the FDA for phase 3 clinical trials. Furthermore, the construction of artificial circRNAs containing miRNA or protein binding sites using enzyme-linked methods can be used to specifically target the loss of function of miRNAs or proteins believed to play a role in the pathophysiology of disease progression. Therefore, exploring circRNAs involved in the development of craniosynostosis and finding effective therapeutic targets holds promise for providing new breakthroughs in the treatment and management of craniosynostosis. Summary of the Invention
[0011] The purpose of this invention is to overcome the limitations of existing surgical treatments for craniosynostosis, to identify therapeutic targets for craniosynostosis, and to develop minimally invasive treatment strategies to improve treatment outcomes and patients' quality of life.
[0012] The specific implementation technical solution of the present invention is as follows:
[0013] This study uses circular RNA sequencing to identify candidate circRNA molecules, detects their expression in skull tissue and plasma, identifies the target circRNA molecule circPROSC, and investigates its impact on osteogenic differentiation. The aim is to provide a new target for the treatment of craniosynostosis.
[0014] The application of a substance that inhibits circular RNA circPROSC in the preparation of a drug for treating craniosynostosis, wherein the nucleotide sequence of the circular RNA circPROSC is shown in SEQ ID NO.1. The circular RNA circPROSC is derived from the reverse splicing of exons 2, 3, and 4 of PROSC on chromosome 8, with the CG base at the 3' end of exon 4 of the PROSC pre-mRNA linked to the TC base at the 5' end of exon 2, forming a covalently closed circular RNA.
[0015] The nucleotides of circPROSC described in this invention:
[0016] GATCTCCCAGCCATCCAGCCCCGGCTAGTGGCGGTCAGCAAAACCAAACCTGCAGACATGGTGATCGAGGCCTATGGACATGGGCAGCGCACTTTTGGCGAGAACTACGTTCAGGAACTGCTAGAAAAAGCATCAAATCCCAAAATTCTGTCTTTGTGTCCTGAGATCAAATGGCACTTCATTGGCCACCTACAGAAACAAAATGTCAACAAATTGATGG (SEQ ID No. 1).
[0017] As a preferred embodiment of the present invention, the substance that inhibits the circular RNA circPROSC is an shRNA or siRNA that silences circPROSC expression.
[0018] As a preferred embodiment of the present invention, the nucleotide sequence of the siRNA expressing the silenced circPROSC is shown in SEQ ID NO.2.
[0019] A pharmaceutical composition for treating craniosynostosis, comprising the substance for inhibiting circular RNA circPROSC as described in this invention and pharmaceutical excipients.
[0020] As a preferred embodiment of the present invention, the substance that inhibits the circular RNA circPROSC is an shRNA or siRNA that silences circPROSC expression.
[0021] As a preferred embodiment of the present invention, the nucleotide sequence of the siRNA expressing the silenced circPROSC is shown in SEQ ID NO.2.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] This invention utilizes circRNA microarray analysis of plasma samples from children with craniosynostosis and normal controls to obtain differentially expressed circRNA profiles. It was found that circPROSC was significantly upregulated in the skull tissue and plasma of children with craniosynostosis compared to normal controls. Further experimental verification revealed that high expression of circPROSC significantly promotes osteogenic differentiation of mesenchymal stem cells in vitro and in vivo, while knockdown of circPROSC showed the opposite effect. Furthermore, targeting circPROSC expression with AAV-circPROSC shRNA significantly alleviated the symptoms of premature coronal suture fusion in a mouse model of craniosynostosis. This invention provides a novel minimally invasive treatment option for craniosynostosis targeting circPROSC, with potential benefits for clinical practice. Attached Figure Description
[0024] Figure 1 This study investigated the differential expression of circRNAs in the plasma of patients with craniosynostosis. (A) Flowchart of key circRNA screening steps; (B) Expression profile of abnormally high-expressing circRNAs; (C) circRNA levels in skull tissues of the control group (n = 6) and patients with craniosynostosis (n = 8); Plasma was collected from the control group (n = 67) and patients with craniosynostosis (n = 81), and the levels of circPABPC1 (D), circPROSC (E), and circCMTM3 (F) were detected by qRT-PCR; (G) Dynamic expression of circRNAs during mesenchymal stem cell osteogenic processes at days 0, 3, and 7; (H) qRT-PCR analysis of osteogenic marker genes (RUNX2, OPN, and COL1A1) in skull tissues of the control group (n = 6) and patients with craniosynostosis (n = 8); (I) Correlation analysis of circPROSC with osteogenic marker genes.
[0025] Figure 2 This relates to the effect of circPROSC on osteogenic differentiation of mesenchymal stem cells.
[0026] (A) Efficiency of circPROSC overexpression and knockdown; (B) ALP staining and ALP activity detection of hMSCs on day 7 after induced differentiation of mesenchymal stem cells; (C) Alizarin red staining and quantitative analysis on day 14 after induced differentiation of mesenchymal stem cells; (D) Western blot detection of the relative protein levels of RUNX2 and OPN.
[0027] Figure 3This study examines the effect of circPROSC on osteogenic differentiation of mesenchymal stem cells in vivo. (A) Flowchart of ectopic osteogenic differentiation; (B) HE staining and Masson staining of subcutaneous bone tissue; (C) Micro-CT images of subcutaneous bone tissue; (D) Quantitative analysis of BMD and BV / TV in bone tissue; (E) Immunofluorescence detection of relative protein levels of RUNX2 and OPN.
[0028] Figure 4 It inhibits the effect of circRNAs associated with craniosynostosis on the cranial sutures of mice with craniosynostosis.
[0029] (A) A mouse model of craniosynostosis was constructed using CRISPR-Cas9 technology; (B) A schematic diagram of mice with craniosynostosis treated with adeno-associated virus; (C) Micro-CT image of mouse skull; (D) HE staining of the coronal suture of mouse skull. Detailed Implementation
[0030] The technical solutions for specific implementations of the present invention will be further described in detail below. Unless otherwise specified, the conditions and methods in the implementation process are carried out in a conventional manner. Unless otherwise specified, the experimental materials used in the described embodiments are all commercially available ordinary products.
[0031] Example 1: Sample Collection
[0032] From July 2020 to October 2022, the inventors collected blood samples from eligible children with craniosynostosis and healthy controls at the Children's Hospital Affiliated to Nanjing Medical University. After data analysis, 72 healthy controls and 86 children with craniosynostosis were selected as experimental subjects. For the children with craniosynostosis, skull tissue was collected from tissue discarded during their own craniotomy reconstruction, yielding 8 skull tissue samples. For the control group, skull tissue was collected from tissue discarded during decompression craniotomy in children with severe traumatic brain injury, yielding 6 skull tissue samples. Informed consent was obtained from the guardians of all subjects.
[0033] Example 2:
[0034] Five cases were selected from both the control group and the craniosynostosis group. A craniosynostosis circRNA expression profile was established, and circRNAs associated with craniosynostosis were screened. Based on the sequencing data, circRNAs upregulated in the plasma of craniosynostosis patients were screened, and circRNAs highly expressed in the skull tissue of children with craniosynostosis were identified and validated with a larger sample size.
[0035] The specific experimental plan is as follows:
[0036] (1) RNA extraction was performed using the Invitrogen Trizol kit instructions. The specific steps are as follows:
[0037] ① Add 1 mL of Trizol reagent to plasma and skull tissue samples. ② Mix the samples well and incubate at room temperature (20-30℃) for 5 min. ③ Add 300 μL of chloroform, vortex vigorously for 30 s, incubate on ice for 10 min, and centrifuge at 12000 rpm for 10 min at 4℃. Collect the supernatant. ④ Add an equal volume of isopropanol to the supernatant, mix well, and incubate at room temperature for 10 min. ⑤ Centrifuge at 12000 rpm for 10 min at 4℃ and discard the supernatant. ⑥ Add 1 mL of 75% anhydrous ethanol, mix well, centrifuge at 7500 g for 10 min at 4℃, discard the supernatant, and wash twice. ⑦ Dry the RNA precipitate at room temperature until clear, add an appropriate amount of DEPC water, incubate at 4℃ for 2-3 hours to fully dissolve the RNA, determine the concentration, and store at -80℃.
[0038] (2) The reverse reaction system is prepared as shown in Table 1:
[0039] Table 1
[0040]
[0041] The χ² reaction volume can be increased as needed; a 10 μL reaction volume can be used for a maximum of 500 ng of total RNA. All operations should be performed on ice.
[0042] (2) Reverse transcription:
[0043] First, reverse transcription was performed (37℃, 15 min), followed by reverse transcriptase inactivation (85℃, 5 s). At the end, the temperature was lowered to 4℃, and the sample was stored in a 4℃ refrigerator.
[0044] The primers used were designed and synthesized by Shanghai Invitrogen Biotechnology Co., Ltd., and their specific sequences are shown in Table 2:
[0045] Table 2
[0046]
[0047] (3) To detect the expression level of circRNA in the sample, the reaction system (10 uL) was as follows:
[0048] SYBR Green Master Mix 5 μL
[0049] Primer F 0.5 μL
[0050] Primer R 0.5 μL
[0051] cDNA 2 μL
[0052] ddH2O 2 μL
[0053] The reverse transcribed cDNA stock solution was diluted 10 times and then added to the PCR reaction system.
[0054] (4) Reaction conditions for qRT-PCR:
[0055] Pre-denaturation: 95℃ for 5 min
[0056] Cyclic reaction: [95℃ 10 s]
[0057] 60℃ 30 s] 40 cycles
[0058] Melting curve: 95℃ for 15 s
[0059] 60℃ 80 s
[0060] 95℃ for 15 seconds.
[0061] Real-time quantitative PCR was performed using Roche RT-PCR LC480 II. After the reaction, the melting curve was analyzed on the software, and the Ct value was calculated. GAPDH was used as an internal control to correct the PCR cycle copy number. (-△△Ct) To compare the differences of each gene between the treatment group and the control group.
[0062] (5) Results are shown Figure 1 Compared with the control group, the expression of circPABPC1, circPROSC, and circCMTM3 was significantly upregulated in skull tissue and plasma samples from craniosynostosis patients and normal controls. Furthermore, circPROSC was found to be the only circRNA that gradually increased during osteogenic differentiation of hMSCs. In addition, correlation analysis showed a positive correlation between the expression levels of osteogenic differentiation markers and circPROSC expression in skull tissue.
[0063] Example 3: Cell Culture and Transfection
[0064] Human mesenchymal stem cells (hMSCs) were cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C in a cell culture incubator containing 5% CO2. CircPROSC siRNA, overexpression plasmids, and negative controls (200 nM, Guangzhou Ruibo Biotechnology Co., Ltd.) were transfected into cells using Lipofectamine RNAiMAX reagent (Invitrogen). The interfering sequences involved in this study are shown in Table 3.
[0065] Table 3
[0066]
[0067] Example 4: Effect of knockdown or overexpression of circPROSC on osteogenic differentiation capacity of hMSCs in vitro.
[0068] (1) hMSCs were seeded in 6- or 12-well plates. After the cell confluence reached 40%, they were transfected with circPROSC siRNA and overexpressed with circPROSC plasmid, respectively. After 24 hours, the osteogenic induction medium was replaced and the cells were cultured in a cell culture incubator at 37°C and 5% CO2, with the medium changed every two days. After 7 days of culture, the cells were collected and Western blot was performed to detect changes in the expression of osteogenic differentiation marker genes RUNX2 and OPN protein, as well as ALP staining and ALP activity detection. After 14 days of culture, alizarin red staining and calcium quantification were performed to detect the effects of different treatments on the osteogenic differentiation of hMSCs.
[0069] (2) Experimental results
[0070] Compared with the control group, the CircPROSC overexpression group showed significantly increased ALP staining, ALP activity, and calcified nodules, as well as significantly increased expression of osteogenic differentiation genes RUNX2 and OPN proteins. Conversely, compared with the si-NC group, the circPROSC siRNA group showed significantly decreased ALP staining, ALP activity, and calcified nodules, as well as significantly decreased expression of osteogenic differentiation genes RUNX2 and OPN proteins. Results are shown below. Figure 2 .
[0071] Example 5: In vivo verification of the effect of circPROSC on the osteogenic differentiation capacity of hMSCs in nude mice ectopic osteogenic experiments.
[0072] (1) siRNA and overexpression circPROSC plasmid were transfected into hMSCs, respectively. After treating hMSCs with osteogenic induction solution for 7 days, the cells were loaded into β-TCP material and transplanted subcutaneously into the back of nude mice. After 8 weeks, the β-TCP material in the subcutaneous tissue of the nude mice was removed and bone density and bone volume were measured.
[0073] (2) Experimental results
[0074] Experimental model diagram as follows Figure 3 As shown in Figure A, Micro-CT results indicate that overexpression of circPROSC promotes bone formation of hMSCs in the subcutaneous tissue of nude mice, significantly increasing bone density and bone mass. However, inhibiting the expression of circPROSC blocks its osteogenic effect. Figure 3B). H&E and Masson staining showed that overexpression of circPROSC promoted the formation of collagen and osteoid tissue by hMSCs in vivo, while knockdown of circPROSC inhibited the formation of collagen and osteoid tissue by hMSCs in vivo. Figure 3 C). Immunohistochemical results showed that overexpression of circPROSC promoted the expression levels of osteogenic differentiation proteins RUNX2 and OPN in ectopic bone tissue, while knockdown of circPROSC inhibited the expression of RUNX2 and OPN. Figure 3 D). These results further validate in vivo that circPROSC plays an important role in nickel-induced osteogenic differentiation of hMSCs.
[0075] Example 6: In vivo knockdown of circRNAs associated with craniosynostosis to evaluate their therapeutic effect on mice with craniosynostosis.
[0076] (1) Twist1 + / - Mouse models are excellent for evaluating the therapeutic effects of craniosynostosis (CSI) treatment. We used adeno-associated virus (AAV) to knock down the expression of circRNAs associated with CSI and explored the therapeutic effects of circRNA intervention on CSI mice. On days 1 and 5 after birth, we locally injected AAV-circPABPC1 shRNA, AAV-circPROSC shRNA, and AAV-circCMTM3 shRNA into Twist1 cells of CSI mice. + / - Location of the coronal suture in mice. Tissue from the coronal suture was taken 6 days later to assess the development of the cranial sutures.
[0077] (2) Experimental results
[0078] Experimental model diagram as follows Figure 4 As shown in Figure A, Micro-CT and histological analysis results indicate that, compared with NC treatment, circPROSC shRNA treatment significantly alleviated Twist1. + / - Premature closure of coronary artery sutures in mice Figure 4 B). Meanwhile, circPROSC shRNA effectively attenuated Twist1. + / - Significant increases in static bone morphological parameters (BMD and BV / TV) in mice, while knockdown of other circRNAs had an effect on Twist1. + / - No therapeutic effect ( Figure 4 C). By Figure 4 It can also be seen that even circRNAs that are differentially expressed between craniosynostosis and the control group and are significantly upregulated in the craniosynostosis group may not necessarily serve as therapeutic targets for craniosynostosis.
Claims
1. The application of a substance that inhibits circular RNA circPROSC in the preparation of a drug for treating craniosynostosis, wherein the nucleotide sequence of the circular RNA circPROSC is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that... Substances that inhibit circular RNA circPROSC are shRNAs or siRNAs that silence circPROSC expression.