Application of hepatic SCD1 in the treatment of atherosclerosis and related metabolic disorders

Abstract

This invention belongs to the field of biopharmaceutical technology and provides the application of hepatic SCD1 in the treatment of atherosclerosis and related metabolic disorders. This application involves using SCD1 inhibitors to prepare drugs for treating atherosclerosis. This invention establishes a mouse model of atherosclerosis and performs AAV-mediated knockdown of the hepatic SCD1 gene, evaluating the effect of SCD1 expression levels on atherosclerosis. The results show that: reducing SCD1 can improve lipid metabolism, reduce lipid deposition and macrophage infiltration in arterial plaques, and inhibit the occurrence and development of atherosclerosis; it reduces hepatic lipid levels, induces specific changes in phospholipid composition, and promotes the remodeling of hepatic lipid metabolism; it regulates the expression of MAMs-related proteins, restoring MAM homeostasis. SCD1 can serve as a therapeutic target for atherosclerosis, and SCD1 gene inhibitors can be used for the treatment of atherosclerosis.

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceutical technology and relates to the recovery and treatment of atherosclerosis and related metabolic disorders, specifically the application of liver SCD1 in the treatment of atherosclerosis and related metabolic disorders. Background Technology

[0002] Atherosclerosis-associated cardiovascular disease (ASCVD) remains a leading cause of death worldwide. Systemic lipid metabolism disorders are a clearly defined key driver of this pathological condition. The liver, as the central hub of systemic lipid homeostasis, regulates key processes such as cholesterol synthesis, transport, and fatty acid metabolism, all of which are closely related to the formation of atherosclerosis. Although existing lipid-lowering strategies have demonstrated clear clinical efficacy, ASCVD remains a leading cause of death, especially in the elderly. This indicates that, in addition to overall lipid level reduction, the specific mechanisms and regulatory systems of hepatic lipid metabolism in the context of atherosclerosis are not yet fully elucidated. Elucidating these unexplored hepatic metabolic pathways is crucial for discovering novel therapeutic targets.

[0003] Stearoyl-CoA desaturase (SCD) in mammals is the rate-limiting enzyme that regulates the fatty acid composition of cellular lipids by catalyzing the conversion of saturated fatty acids (SFAs) to monounsaturated fatty acids (MUFAs) in the endoplasmic reticulum (ER). Specifically, SCD introduces a cis double bond at the Δ9 position of palmitic acid (16:0) and stearic acid (18:0), converting them to palmitoleic acid (16:1n7) and oleic acid (18:1n9), respectively. Monounsaturated fatty acids (MUFAs) are key components of phospholipids, triglycerides, and cholesterol esters, influencing membrane fluidity, lipoprotein assembly, and signal transduction. In obesity and metabolic syndrome, the expression and activity of hepatic SCD1 are upregulated, and its inhibition has been shown to improve hepatic steatosis and enhance insulin sensitivity in preclinical models. In LDLR-deficient mice, while global SCD1 knockout improves metabolic syndrome, endothelium-specific SCD1 deficiency induces persistent vascular inflammation, a phenotype that can be reversed by SCD1 overexpression. However, the specific role and mechanistic contribution of SCD1 in the progression of atherosclerosis—especially the interaction between regulating hepatic lipid metabolism and atherosclerotic plaque formation—remain unclear.

[0004] Phospholipids are fundamental structural components of cell membranes and circulating lipoproteins. As major components of cell membranes, phospholipids determine key biophysical membrane properties, primarily determined by the length and saturation of their acyl chains. This remodeling typically manifests as alterations in acyl chain composition, thereby disrupting membrane properties and promoting disease pathogenesis. In atherosclerosis, polyunsaturated fatty acids are integrated into phospholipids, a process co-mediated by very long chain fatty acid extension protein 5 (ELOVL5) and lysophosphatidylcholine acyltransferase 3 (LPCAT3) in macrophages, crucial for maintaining membrane homeostasis and limiting the expansion of necrotic cores in plaques. Simultaneously, in endothelial cells, LPCAT3-driven lipid raft remodeling is essential for TNFα-induced NF-κB inflammatory signaling. Conversely, inhibition of LPCAT3 alters the fatty acid composition of membrane phospholipids and reduces vascular inflammation. Although lipidomics studies have precisely characterized the significant compositional changes of phospholipids during the progression of atherosclerosis, the precise mechanisms driving these lipidomics alterations and their downstream functional consequences remain poorly understood.

[0005] Meanwhile, recent evidence suggests that mitochondrial-associated endoplasmic reticulum membranes (MAMs) act as key signaling hubs, coordinating core processes such as lipid metabolism, calcium ion transport, and redox balance. The integrity of MAMs is maintained by molecular anchoring structures such as the IP3R / GRP75 / VDAC1 complex, which is crucial for cellular metabolic homeostasis. Inositol triphosphate (IP3) triggers endoplasmic reticulum calcium ion release by binding to IP3 receptors (IP3Rs). Voltage-dependent anion channel 1 (VDAC1) is an outer mitochondrial membrane channel that regulates the mitochondrial transport of metabolites and calcium ions. Glucose regulatory protein 75 (GRP75) mediates the coupling of IP3 and VDAC1, thereby promoting calcium signaling between the endoplasmic reticulum and mitochondria. Notably, lipid saturation is a key determinant of membrane properties, and this saturation state is directly regulated by enzymes such as SCD1. This suggests that SCD1 activity may play a role by influencing the stability and function of intercellular contact sites. Therefore, this invention aims to explore whether inhibiting SCD1 (a key regulator of lipid metabolism) can inhibit the progression of atherosclerosis by restoring the structure and function of MAMs. Summary of the Invention

[0006] The purpose of this invention is to provide the application of hepatic SCD1 in the treatment of atherosclerosis and related metabolic disorders, and to apply inhibitors targeting SCD1 to the treatment of atherosclerosis and related metabolic disorders, thereby providing a new therapeutic target for the treatment of atherosclerosis and related lipid metabolism disorders.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] This invention provides the application of SCD1 inhibitors in the preparation of drugs for treating atherosclerosis and related metabolic disorders.

[0009] Preferably, the SCD1 inhibitor includes a substance that inhibits SCD1 gene expression, and the substance includes one or more of nucleic acid molecules, carbohydrates, lipids, small molecule compounds, antibodies, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

[0010] Preferably, the drug is used to improve lipid metabolism, reduce lipid deposition and macrophage infiltration in arterial plaques, and inhibit the occurrence and development of atherosclerosis.

[0011] Preferably, the drug is used to reduce liver lipid levels, induce specific changes in phospholipid composition, and promote the remodeling of liver lipid metabolism.

[0012] Preferably, the drug is used to restore MAMs homeostasis, including restoring IP3R protein expression, reversing GRP75 elevation, and promoting the aggregation of the VDAC1 / GRP75 / IP3R complex.

[0013] Preferably, the drug comprises an SCD1 inhibitor and medically approved excipients.

[0014] Preferably, the drug includes various acceptable dosage forms.

[0015] Preferably, the dosage form is an injection, pill, capsule, granule, tablet, or oral liquid.

[0016] The beneficial effects of this invention are:

[0017] This invention established a mouse model of atherosclerosis and performed AAV-mediated knockdown of the liver SCD1 gene to evaluate the effect of SCD1 expression level on atherosclerosis. The results showed that SCD1 reduction can improve lipid metabolism, reduce lipid deposition and macrophage infiltration in arterial plaques, and inhibit the occurrence and development of atherosclerosis; reduce liver lipid levels, induce specific changes in phospholipid composition, and promote the remodeling of liver lipid metabolism; restore MAMs homeostasis, restore IP3R protein expression, reverse GRP75 elevation, and promote the aggregation of VDAC1 / GRP75 / IP3R complex. SCD1 can serve as a therapeutic target for atherosclerosis, and SCD1 inhibitors can be used for the treatment of atherosclerosis. Attached Figure Description

[0018] Figure 1 The SCD1 gene knockdown in this invention alleviates ApoE. - / -Partial experimental results related to atherosclerosis in mice (A: serum triglyceride (TG) levels in the ND, HFD, AAV9-GFP, and AAV9-SCD1 groups; B: total cholesterol (TC) levels in the four groups of mice; C: low-density lipoprotein cholesterol (LDL-C) levels in the four groups of mice; D: representative ORO staining images of the thoracic aorta in the four treatment groups; n=6; ns, ** P < 0.01, intergroup comparison; ** P < 0.01, intergroup comparison; ** P < 0.01, * P < 0.05, intergroup comparison;

[0019] Figure 2 The SCD1 gene knockdown in this invention alleviates ApoE. - / - Partial experimental results related to atherosclerosis in mice (A: HE staining, Oil Red O staining, Masson trichrome staining, and CD68 antibody staining sections of the aortic root of mice in the four treatment groups; scale bar is expressed in μm; B: aortic root plaque area; C: lipid accumulation ratio; D: collagen accumulation ratio; E: quantitative analysis results of CD68 positive results; n=5; ** P < 0.01, intergroup comparison; * P < 0.05 (between groups);

[0020] Figure 3 This is the biochemical analysis result of the liver after SCD1 gene knockdown in this invention (A: Oil Red and HE staining images of liver tissue from two groups of mice; Oil Red staining scale bar = 20 μm, HE staining scale bar = 50 μm; B: lipid droplet area fraction in liver tissue from two groups; C: vacuolated lipid area fraction; D: triglyceride (TG) level in liver tissue from two groups of mice with different treatments; E: total cholesterol (TC) level in liver tissue from two groups of mice with different treatments; F: low-density lipoprotein cholesterol (LDL-C) level in liver tissue from two groups of mice with different treatments; n=6; ** P < 0.01, intergroup comparison; * P < 0.05, between-group comparison; ns, between-group comparison).

[0021] Figure 4 This is a partial analysis of multivariate lipidomics in the liver after SCD1 gene knockdown in this invention (A is principal component analysis (PCA) of multivariate lipidomics; B is model validation through 200 permutation tests (R...). 2 =0.895, Q 2 =0.211); C is the lipid volcano plot);

[0022] Figure 5This is the result of lipidomics analysis of the liver after SCD1 gene knockdown in this invention (A is a bubble chart of the top 20 differentially altered lipid pathways; B is a comparison of the enrichment trends of the 10 KEGG pathways with the smallest up- and down-regulation P-values ​​(ListHits>1)).

[0023] Figure 6 This is a graph showing the changes in the proportions of various lipid subclasses in the liver after SCD1 gene deficiency in this invention.

[0024] Figure 7 These are the first 20 significantly altered lipid molecules in the liver after SCD1 gene knockdown in this invention;

[0025] Figure 8 This is a heatmap of the main lipid subclasses in the liver after SCD1 gene knockdown in this invention;

[0026] Figure 9 This is the overall distribution of all significantly differentially expressed lipids in the liver after SCD1 gene knockdown in this invention (VIP>1, OPLS-DA model; n=6).

[0027] Figure 10 This invention presents the transmission electron microscopy (TEM) observation results of liver SCD1 gene knockdown restoring mitochondrial-endoplasmic reticulum contact and MAMs anchoring protein complexes (A: TEM showing ultrastructural features of liver tissues in four different treatment groups (scale bar = nanometers); B: Quantitative analysis of mitochondrial-endoplasmic reticulum distance (nm) within mitochondrial-endoplasmic reticulum membranes (MAMs) in liver tissues of four different treatment groups using TEM images; C: Differences in mitochondrial morphology and size (μm) (n=5). * P < 0.05 (between groups);

[0028] Figure 11 These are the detection results of mitochondrial-endoplasmic reticulum membrane-related proteins in liver tissue lysates from different treatment groups in this invention (A represents the representative Western blot bands of IP3R, VDAC1, GRP75, and GPX4 proteins; BE represents the relative protein expression levels of IP3R, VDAC1, GRP75, and GPX4, respectively). * P < 0.05, between-group comparison; ns, between-group comparison).

[0029] Figure 12 These are the immunofluorescence analysis results of liver tissues from mice in four treatment groups in this invention (n=4). Detailed Implementation

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0031] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0033] Example

[0034] 1 Experimental Methods

[0035] 1.1 Animals and Experimental Design

[0036] All animal experiments were approved by the Medical Ethics Committee of Chengdu Women and Children's Central Hospital (Approval No.: [2023-07]) and conducted in strict accordance with institutional guidelines. Eight-week-old male apolipoprotein E deficiency (ApoE) animals were used in the experiments. - / - Mice, purchased from Hangzhou Ziyuan Laboratory Animal Technology Co., Ltd., were acclimatized for one week in a specific pathogen-free (SPF) environment (23°C, 12 / 12-hour light / dark cycle) with free access to food and water. Twenty-four mice were randomly divided into two groups: a normal diet group (ND) and a high-fat diet group (HFD group, fed a Clinton / Cybulsky high-fat rodent diet containing 1.25% cholesterol). The HFD group was continuously fed a high-fat diet for 12 weeks to induce atherosclerotic lesions, and weight changes were monitored weekly.

[0037] 1.2 AAV-mediated liver SCD1 knockdown and detection methods

[0038] 1.2.1 AAV-mediated knockdown of liver SCD1 gene

[0039] Twenty-four mice were randomly divided into two groups: a normal diet group (ND group, n=6) and a high-fat diet group (HFD group, n=18). The HFD group was fed a high-fat diet for 12 weeks to induce atherosclerotic lesions. After establishing the atherosclerotic model as described in the Animal and Experimental Design section, the HFD group was randomly divided into three subgroups (n=6 per subgroup): the HFD group; the AAV9 vector group encoding SCD1-targeting shRNA (AAV9-Scd1-RNAi[P25A1168], GCACCTTCTTGCGATACACTC); and the negative control group receiving non-targeting shRNA AAV (randomized shRNA control, Con305, CGCTGAGTACTTCGAAATGTC). 200 µL of AAV solution (2.25 × 10⁻⁶) was administered via retroorbital vein injection. 12(Genome copy number / mL). Mice were fasted for 12 hours three weeks after injection. Blood was collected via intraorbital sampling, followed by euthanasia. Liver and aortic root tissues were harvested for further analysis.

[0040] 1.2.2 Biochemical Analysis

[0041] After the blood samples were allowed to stand at room temperature for 30 minutes, they were centrifuged at 3,000 rpm for 15 minutes at 4°C to separate the serum. The levels of triglycerides (TG), total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C) in the serum were measured using a commercially available diagnostic kit (Nanjing Jiancheng Biotechnology Research Institute, China) according to the manufacturer's instructions.

[0042] 1.2.3 Histopathology and Immunohistochemical Staining

[0043] H&E, Masson, and CD68 staining: Formalin-fixed, paraffin-embedded liver sections (4 µm) were prepared. Overall histological features were assessed using H&E staining. Masson trichrome staining was used to visualize collagen deposition (blue). For CD68 immunohistochemistry, antigen retrieval was performed first in citrate buffer (pH 6.0), followed by blocking endogenous peroxidase and nonspecific binding. Sections were incubated overnight at 4°C with anti-CD68 primary antibody (1:50; Abcam, ab283654), followed by incubation with HRP-conjugated secondary antibody and DAB staining. Cell nuclei were counterstained with hematoxylin.

[0044] 1.2.4 Oil Red O staining

[0045] Fresh liver tissue was fixed in 4% paraformaldehyde for 15 minutes, embedded in OCT complex, frozen, and sectioned at 8 µm. After fixation, the sections were stained with Oil Red O working solution for 15 minutes, counterstained with hematoxylin, mounted, and then imaged. Lipid droplets appeared red.

[0046] 1.2.5 Immunofluorescence staining

[0047] Frozen liver sections were fixed, permeabilized, and blocked, then incubated overnight at 4°C with a primary antibody (e.g., anti-SCD1), followed by the addition of Alexa Fluor-labeled secondary antibody (1:500; Thermo Fisher Scientific). Cell nuclei were stained with DAPI, and images were acquired using a fluorescence confocal microscope.

[0048] 1.2.6 Western blot analysis

[0049] Liver tissue samples were lysed in RIPA lysis buffer (Applgen, China) containing a protease inhibitor (Beyotime, China). Protein concentration was determined using a BCA protein quantification kit (Thermo Fisher Scientific, USA). After separation by 12% SDS-PAGE electrophoresis, proteins were transferred to PVDF membranes (Merck Millipore, USA) and blocked with 5% skim milk. The membranes were incubated overnight at 4°C with the following primary antibodies: SCD1 (1:1000; CST #2794), IP3R (1:1000; GeneTex GTX637015), GRP75 (1:5000; Proteintech 14887-1-AP), VDAC1 (1:800; Proteintech 55259-1-AP), and GAPDH (1:50000; Proteintech 60004-1-Ig) (sample control). After incubation with HRP-labeled secondary antibody, protein bands were visualized using an ECL detection system (Merck Millipore, USA) and analyzed using ImageJ software.

[0050] 1.2.7 Transmission Electron Microscopy

[0051] Liver tissue was rapidly dissected and cut into cubes of approximately 1 mm³. Samples were washed with PBS and fixed with 4% paraformaldehyde at 4°C for 24 hours. After washing, they were post-fixed with 1% osmium tetroxide at room temperature for 1 hour, dehydrated with graded ethanol, and embedded in epoxy resin. Ultrathin sections (70–90 nm) were prepared, fixed on copper grids, and stained with uranium acetate and lead citrate. Images were acquired using a Hitachi HT7800 transmission electron microscope (80 kV) to assess mitochondrial morphology, endoplasmic reticulum integrity, mitochondrial-associated membranes (MAMs), and lipid droplet-mitochondrial contact.

[0052] 1.2.8 Liver lipidomics analysis

[0053] Approximately 30 mg of liver tissue was collected and homogenized with cold methanol:water (1:1, v / v). Lipids were extracted using chloroform. The organic phase was collected, dried under nitrogen, and reconstituted with methanol:isopropanol (1:1). Lipid profiling was performed using ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS; e.g., Q Exactive Orbitrap) with a BEH C8 column. The mobile phase consisted of (A) acetonitrile:water (60:40) and (B) isopropanol:acetonitrile (90:10), both containing 10 mM ammonium acetate. Data were processed using LipidSearch or MS-DIAL software. After identification and quantification, lipid abundance was normalized to tissue weight. Multivariate analysis (PCA, OPLS-DA) was performed in MetaboAnalyst / SIMCA. Differentially expressed lipids were defined as projection importance variance (VIP) > 1.0 after correction. * Lipids with P < 0.05.

[0054] 1.3 Statistical Analysis

[0055] Data are expressed as mean ± standard error. Unpaired two-tailed Student's t-test was used to analyze differences between two groups. One-way ANOVA followed by Tukey's post-hoc test was used for comparisons among multiple groups. A p-value <0.05 was considered statistically significant.

[0056] 2. Experimental Results

[0057] 2.1 SCD1 gene knockdown can alleviate atherosclerosis

[0058] To further verify the effect of SCD1 gene knockdown on atherosclerosis, the thoracic aortas of four groups of mice were dissected in this study: normal feeding group (ND group), high-fat diet feeding group (HFD group), high-fat diet feeding group injected with negative control virus (HFD+AAV9-GFP), and high-fat diet feeding group injected with SCD1 knockdown virus (HFD+AAV9-shScd1). Lipid analysis was performed on serum samples from SCD1 knockdown mice and control mice in this study. SCD1 knockdown significantly reduced serum triglyceride (TG), total cholesterol (TC), and low-density lipoprotein (LDL-C) levels. Figure 1 In addition, the thoracic aorta of four groups of mice was dissected, and it was observed that vascular lipid deposition was significantly reduced in SCD1 knockdown mice (AC). Figure 1 D). To quantitatively assess plaque burden and composition, histological analysis was performed on aortic root sections from all groups. H&E staining ( Figure 2 (AB) showed a significant reduction in lesion area. Oil Red O staining ( Figure 2 A and Figure 2C) confirmed a significant decrease in plaque lipid content. Masson trichrome staining ( Figure 2 A and Figure 2 D) showed an increased area of ​​the fibrous collagen cap, while CD68 immunostaining ( Figure 2 A and Figure 2 E) The data revealed a reduction in positive macrophage infiltration. These data indicate that SCD1 knockdown effectively reduces lipid deposition, alleviates inflammatory responses, and promotes the stability of aortic root plaque morphology. This data suggests that hepatic SCD1 gene knockdown effectively inhibits the occurrence and development of atherosclerosis by improving lipid metabolism and reducing lipid deposition and macrophage infiltration in arterial plaques.

[0059] 2.2 SCD1 gene knockdown alters liver lipid profile in mice

[0060] Morphological phenotype showed that AAV9-shScd1 mice had significantly reduced hepatic lipid deposition and steatosis. Figure 3 (AC in the middle). Consistent with this phenotype, biochemical analysis showed that, compared with the control group, the levels of triglycerides (TG), total cholesterol (TC), and low-density lipoprotein (LDL-C) in the liver tissue of gene knockdown mice were significantly reduced. Figure 3 (DF in the text). Subsequently, lipidomics analysis was performed on liver tissues from AAV9-shScd1 mice and control mice in this embodiment. Principal component analysis (PCA) showed significant differences in lipid profiles between the two groups ( Figure 4 A). The permutation test confirmed the effectiveness of the model, indicating that the observed distinctions were statistically significant and non-random. Figure 4 B). Comparative analysis identified 814 lipids with significantly altered abundance, including 204 upregulated and 610 downregulated lipids. Figure 4 C).

[0061] Pathway enrichment analysis (KEGG) mapped these differentially abundant lipids to key metabolic processes, particularly highlighting significant downregulation of pathways associated with monounsaturated fatty acid (MUFA) synthesis and glycerophospholipid metabolism. Figure 5 (AB in the text). The three lipid subclasses with the largest abundance variations included TG, PC, and PE ( ). Figure 6 The top 20 lipid species with the greatest abundance variation are listed below. Figure 7 The test results showed decreased levels of lipids such as PI (19:0 / 20:4), SM (d53:4), and TG (18:1 / 18:1 / 22:4), while increased levels of TG (18:0 / 17:0 / 20:4), DG (18:0 / 16:0), and TG (16:0 / 17:0 / 18:1). Figure 7Further analysis revealed specific reprogramming of TG, PC, and PE metabolism, manifested as changes in acyl chain saturation and length. Figures 8-9 These data indicate that SCD1 gene knockdown not only leads to a decrease in liver lipid levels, but also triggers specific changes in phospholipid composition, thereby driving the remodeling of liver lipid metabolism.

[0062] 2.3 SCD1 gene knockdown can restore liver mitochondrial-associated membrane homeostasis.

[0063] Transmission electron microscopy revealed that mitochondrial ferroptosis was significantly reduced in the liver tissue of SCD1 knockdown mice, while impaired mitochondrial-endoplasmic reticulum connectivity was improved. Figure 10 To further investigate whether SCD1 affects mitochondrial-endoplasmic reticulum interactions during atherosclerosis, Western blotting was used to detect the expression levels of MAM-related proteins (including VDAC1, GRP75, and IP3R). Results showed that compared with the normal diet group, IP3R expression was significantly reduced in both the HFD group and the negative control virus group, while SCD1 knockdown significantly restored its expression. Figure 11 (AB); there was no significant difference in VDAC1 protein levels among the groups ( ). Figure 11 A and Figure 11 C). GRP75 expression was significantly increased in the liver of HFD mice, and this increase could be effectively reversed by SCD1 knockdown. Figure 11 A and Figure 11 D); GPX4 expression was significantly increased in the liver of HFD mice, and SCD1 knockdown reversed its high expression level (D); Figure 11 A and Figure 11 E). Immunofluorescence detection of the VDAC1 / GRP75 / IP3R complex revealed that the aggregation of this complex was significantly reduced in the liver tissue of mice with high-fat diet-induced atherosclerosis, suggesting impaired MAM homeostasis; while SCD1 gene knockdown significantly restored complex aggregation, thereby improving MAM connectivity. Figure 12 In summary, these results indicate that inhibiting SCD1 can effectively restore the steady state of MAMs.

[0064] In summary, reducing SCD1 can improve lipid metabolism, reduce lipid deposition and macrophage infiltration in arterial plaques, and inhibit the occurrence and development of atherosclerosis; it can also reduce liver lipid levels, induce specific changes in phospholipid composition, and promote the remodeling of liver lipid metabolism; it can restore the expression of IP3R protein, reverse the increase of GRP75, and promote the aggregation of VDAC1 / GRP75 / IP3R complex, thereby restoring MAM homeostasis. SCD1 can serve as a therapeutic target for atherosclerosis, and SCD1 inhibitors can be used for the treatment of atherosclerosis.

[0065] The above-described embodiments are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. Application of SCD1 inhibitors in the preparation of drugs for the treatment of atherosclerosis and related metabolic disorders.

2. The application according to claim 1, characterized in that, The SCD1 inhibitor includes substances that inhibit SCD1 gene expression, and the substances include one or more of the following: nucleic acid molecules, carbohydrates, lipids, small molecule compounds, antibodies, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

3. The application according to claim 1, characterized in that, The drug is used to improve lipid metabolism, reduce lipid deposition and macrophage infiltration in arterial plaques, and inhibit the occurrence and development of atherosclerosis.

4. The application according to claim 1, characterized in that, The drug is used to reduce liver lipid levels, induce specific changes in phospholipid composition, and promote the remodeling of liver lipid metabolism.

5. The application according to claim 1, characterized in that, The drug is used to restore MAMs homeostasis, including restoring IP3R protein expression, reversing GRP75 elevation, and promoting the aggregation of the VDAC1 / GRP75 / IP3R complex.

6. The application according to claim 1, characterized in that, The drug includes an SCD1 inhibitor and medically approved excipients.

7. The application according to claim 1, characterized in that, The drug includes various acceptable dosage forms.

8. The application according to claim 7, characterized in that, The dosage form is an injection, pill, capsule, granule, tablet, or oral liquid.

Images