A dual-aptamer functionalized cell membrane biomimetic magnetic nanomaterial and its preparation and application

Abstract

This invention provides a dual-aptamer-functionalized biomimetic magnetic nanomaterial for cell membranes, its preparation method, and its applications. The nanomaterial has a core-shell structure, comprising iron oxide nanoparticles as the core and a tumor cell membrane layer as the shell. The surface of the tumor cell membrane layer is modified with EpCAM nucleic acid aptamers, epithelial markers that highly specifically recognize circulating tumor cells, and CDH2 nucleic acid aptamers, mesenchymal markers. The preparation process involves: firstly, coating the tumor cell membrane onto the surface of iron oxide nanoparticles using a co-extrusion method; then, further modifying the outer surface of the cell membrane with EpCAM and CDH2 nucleic acid aptamers, thereby obtaining a dual-aptamer-functionalized biomimetic magnetic nanomaterial for capturing circulating tumor cells. This invention combines highly specific aptamer-based artificial antibody technology with cell membrane technology targeting homologous cells, enabling efficient capture of circulating tumor cells.

Description

Technical Field

[0001] This invention relates to the field of nanomaterial preparation technology, specifically to a simple preparation method of a dual-aptamer functionalized cell membrane biomimetic magnetic nanomaterial and its application in the specific capture of circulating tumor cells. Background Technology

[0002] Circulating tumor cells (CTCs) are malignant tumor cells that detach from primary tumor tissue or metastases and enter the peripheral blood circulation. They carry important information about the primary tumor, possess invasive and metastatic potential, and exhibit a wide range of phenotypic and genotypic variations. Numerous studies have shown that the presence of CTCs in peripheral blood is a key step in the formation of metastases. Currently, the detection of CTCs in peripheral blood is gradually becoming an emerging non-invasive liquid biopsy technique for monitoring cancer progression and treatment efficacy, which is of great significance for early cancer diagnosis and prevention of metastasis. However, CTCs are very rare in blood and exhibit high heterogeneity, making it extremely difficult to efficiently capture circulating tumor cells from blood samples.

[0003] Immunocapture based on the interaction between cancer cell surface proteins and antibody functional materials is a widely used technique for capturing circulating tumor cells (CTCs). Aptamers are synthetic oligonucleotide ligands with high affinity and specificity for their targets, comparable to antibody / antigen interactions, and are easier to synthesize in large quantities and modify with various chemical groups. Epithelial cell adhesion molecule (EpCAM) is a major epithelial tumor antigen overexpressed in most cancer cells; therefore, EpCAM antibodies and their targeting aptamers have become commonly used recognition ligands for detecting circulating tumor cells (CTCs). However, due to the presence of epithelial-mesenchymal transition (EMT) during cancer progression, relying solely on EpCAM to capture CTCs will lead to the failure to detect EpCAM-negative CTCs. The mesenchymal marker CDH2 (neural cadherin, also known as N-cadherin) belongs to the cadherin family and is upregulated in various malignant tumors such as breast cancer, gastric cancer, and lung cancer, and is closely related to tumor invasion and metastasis. Dual nucleic acid aptamers that combine high affinity for two biomarkers can more effectively capture CTCs of both epithelial and mesenchymal phenotypes, reducing false negatives caused by phenotypic heterogeneity and EMT.

[0004] Meanwhile, traditional CTC capture methods based on the "hard interface" of inorganic nanomaterials suffer from low capture efficiency and low activity. Biomimetic cell membrane-coated nanomaterials retain the characteristics of the cell membrane as a "soft interface" and inherit the ability of tumor cells to self-target and adhere to homologous cells, enabling them to efficiently identify and capture CTCs in peripheral blood.

[0005] This invention combines two technologies—highly specific recognition aptamer artificial antibodies and "bionic soft interface" cell membranes—to address the shortcomings of existing technologies and achieve more efficient capture of CTCs. Summary of the Invention

[0006] The purpose of this invention is to overcome the problems in the prior art and provide a simple preparation method for biaptamer-functionalized cell membrane biomimetic magnetic nanomaterials and their application in the specific capture of circulating tumor cells.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A dual-aptamer functionalized cell membrane biomimetic magnetic nanomaterial, represented as CCM-IMBs, involves coating a cell membrane onto the surface of iron oxide nanoparticles, and then further modifying the outer surface of the cell membrane with two nucleic acid aptamers: the epithelial marker EpCAM and the mesenchymal marker CDH2, to form a cell membrane biomimetic magnetic nanomaterial with a core-shell structure.

[0009] The cell membrane described in this invention is a tumor cell membrane with the ability to self-target and adhere to homologous tumor cells. The tumor cell membrane can be the cell membrane of various tumor cells, such as the cell membrane of lung cancer, nasopharyngeal carcinoma, esophageal cancer, gastric cancer, colorectal cancer, liver cancer, breast cancer, cervical cancer, leukemia, and lymphoma.

[0010] The nucleotide sequence of the EpCAM aptamer, an epithelial marker described in this invention, is: CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG (as shown in SEQ ID No. 1 in the sequence listing).

[0011] The nucleotide sequence of the mesenchymal marker CDH2 aptamer is: TTGCACTATGTTTTAGCTAGGGTTCCCGGAGATAGTAAGTGCAA (as shown in SEQ ID No. 2 in the sequence listing).

[0012] The two nucleic acid aptamers described in this invention, the epithelial marker EpCAM and the mesenchymal marker CDH2, both have an amino group modified at one end. Their specific nucleotide sequences are as follows:

[0013] Aminated EpCAM aptamers:

[0014] 5'-NH2-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGG GTTTGGCCTG-3';

[0015] Aminated CDH2 aptamers:

[0016] 5'-NH2-TTGCACTATGTTTTAGCTAGGGTTCCCGGAGATAGTAAGT GCAA-3'.

[0017] The specific synthesis method of the dual-aptamer-functionalized cell membrane biomimetic magnetic nanomaterial CCM-IMBs described in this invention is as follows: First, tumor cell membranes are obtained using a combination of repeated freeze-thaw cycles and ultrasonic lysis. Then, tumor cell membrane nanovesicles are prepared using an extrusion method. Further, the tumor cell membrane nanovesicles are co-extruded onto the surface of iron oxide nanoparticles to obtain the cell membrane biomimetic magnetic nanomaterial, namely CCM-MBs. Finally, two nucleic acid aptamers, EpCAM (an epithelial marker) and CDH2 (a mesenchymal marker), are modified on the surface of CCM-MBs using an amidation reaction to specifically capture circulating tumor cells, thus obtaining the dual-aptamer-functionalized cell membrane biomimetic magnetic nanomaterial, namely CCM-IMBs. The specific synthesis steps are as follows:

[0018] Step (1) Obtaining tumor cell membranes:

[0019] Scrape tumor cells with a cell density of approximately 60-80% from a 15cm cell culture dish into 0.8-1.2mL (preferably 0.9-1.1mL, more preferably 0.95-1.05mL) of buffer lysis buffer (20mM Tris-HCl pH=7.5; 2mM magnesium chloride; 10mM KCl). Repeat the freeze-thaw cycle three to five times between 34-40℃ (preferably 35-39℃, more preferably 36-38℃) and liquid nitrogen. Then, disrupt the cell suspension using ultrasound (20-30kHz, preferably 22-28kHz, more preferably 24-26kHz) for 5-15min (preferably 7-13min, more preferably 9-11min). Finally, centrifuge the cell suspension at 0-4℃ at 2000-6000g (preferably 3000-5000g, more preferably 3500-4500g) for 5-15min (preferably 7-13min, more preferably 9-11min). Centrifuge the supernatant at 16000-22000g (preferably 17000-21000g, more preferably 18000-20000g) for 20-60min (preferably 25-50min, more preferably 30-40min) at 0-4℃ to remove the supernatant. The precipitate is the tumor cell membrane fragment. Resuspend the fragment in 0.8-1.2mL (preferably 0.9-1.1mL, more preferably 0.95-1.05mL) PBS buffer to obtain the tumor cell membrane solution, and store it at 4℃ for later use.

[0020] Step (2) Preparation of tumor cell membrane nanovesicles using extrusion method:

[0021] The tumor cell membrane solution obtained in step (1) is first extruded repeatedly through a polycarbonate membrane with a pore size of 400 nm for 12-30 times (preferably 15-25 times, more preferably 18-22 times), and then extruded repeatedly through a polycarbonate membrane with a pore size of 200 nm for 12-30 times (preferably 15-25 times, more preferably 18-22 times) to obtain a tumor cell membrane vesicle solution with a diameter of 150-250 nm (preferably 160-240 nm, more preferably 190-210 nm) 200 nm.

[0022] The preparation process of CCM-MBs in step (3) is as follows: 0.8-1.2 mL (preferably 0.9-1.1 mL, more preferably 0.95-1.05 mL) of tumor cell membrane vesicle solution obtained in step (2) is mixed with 80-120 μg (preferably 90-110 μg, more preferably 95-105 μg) of iron oxide nanoparticles, and then repeatedly extruded through a polycarbonate membrane with a pore size of 200 nm 12-30 times (preferably 15-25 times, more preferably 18-22 times), and the supernatant is removed by magnetic separation to obtain CCM-MBs material.

[0023] Step (4) The synthesis process of CCM-IMBs material is as follows: Take 80-120 μg (preferably 90-110 μg, more preferably 95-105 μg) of CCM-MBs and 80-120 μL (preferably 90-110 μL, more preferably 95-105 μL) of DSPE-PEG-COOH (dipalmitoylphosphatidylethanolamine) with a concentration of 1.5-2.5 mg / mL (preferably 1.7-2.3 mg / mL, more preferably 1.9-2.1 mg / mL). (Polyethylene glycol-carboxyl) is mixed in a constant temperature mixer at 25-28°C for 20-60 min (preferably 25-50 min, more preferably 30-40 min), and the supernatant is removed by magnetic separation; 80-120 μL (preferably 90-110 μL, more preferably 95-105 μL) of EDC and NHS solutions, each with a concentration of 8-12 mg / mL (preferably 9-11 mg / mL, more preferably 9.5-10.5 mg / mL), are added separately and mixed at a constant temperature of 25-28°C. Mix for 20-60 min (preferably 25-50 min, more preferably 30-40 min), remove the supernatant by magnetic separation, and wash three times with PBST solution to remove free carboxyl groups; add 8-12 μL (preferably 9-11 μL, more preferably 9.5-10.5 μL) each of 10 μM aminated CDH2 aptamer and 10 μM aminated EpCAM aptamer solutions, and bring the volume to 80-120 μL (preferably 90-110 μL) with PBST solution. Mix the CCM-MBs magnetic beads in a constant temperature mixer at 0-4℃ for 9-14 hours (preferably 10-13 hours, more preferably 11-12 hours) and remove the supernatant. Add PBST (containing 1% BSA) to resuspend the CCM-MBs magnetic beads and react at room temperature for 40-80 minutes (preferably 50-70 minutes, more preferably 55-65 minutes) to block the unreacted carboxyl groups on the surface of the magnetic beads. Keep the magnetic beads suspended during the process. Wash three times with deionized water to obtain the CCM-IMBs material.

[0024] The average particle size of the iron oxide nanoparticles is 90-110 nm.

[0025] The prepared dual-aptamer functionalized cell membrane biomimetic magnetic nanomaterials CCM-IMBs have a core-shell structure, with the core being iron(III) oxide nanoparticles and the shell being a tumor cell membrane encapsulating the iron(III) oxide nanoparticles. Furthermore, the outer surface of the tumor cell membrane is modified with the epithelial marker EpCAM nucleic acid aptamer and the mesenchymal marker CDH2 nucleic acid aptamer. This material can be used to specifically capture circulating tumor cells and has great application prospects in tumor prevention and treatment.

[0026] This invention application also provides the application of CCM-IMBs in the specific capture of circulating tumor cells, including the following steps:

[0027] Add 0.8-1.2 mL (preferably 0.9-1.1 mL, more preferably 0.95-1.05 mL) of CCM-IMBs solution (using PBS as solvent) with a concentration of 80-120 μg / mL (preferably 90-110 μg / mL, more preferably 95-105 μg / mL) to a solution containing 8 × 10⁸ μg / mL of PBS. 4 -1.2×10 5 (preferably 9×10) 4 -1.1×10 5 More preferably 9.5 × 10 4 -1.05×10 5 The tumor cells were incubated in a solution of (number) tumor cells at 37°C for 20-90 minutes in a cell culture incubator; then separated by a magnet to obtain captured circulating tumor cells. This invention coats the tumor cell membrane onto the surface of iron oxide nanoparticles, creating a gentler "soft interface" for the cells and inheriting the tumor cells' ability to self-target and adhere to homologous cells, enabling efficient identification and capture of circulating tumor cells in peripheral blood.

[0028] The aptamers used in this invention are synthetic oligonucleotide ligands, which have high affinity and specificity for the target, comparable to antibody / antigen interactions, and are more cost-effective, easier to synthesize in large quantities, and can be modified by different chemical groups than antibodies.

[0029] This invention combines two nucleic acid aptamers that bind with high affinity to the epithelial marker EpCAM and the mesenchymal marker CDH2, which can more effectively capture CTCs of both epithelial and mesenchymal phenotypes, reducing false negatives caused by phenotypic heterogeneity and EMT.

[0030] Based on the above characteristics, the present invention synthesizes dual-aptamer functionalized cell membrane biomimetic magnetic nanomaterials CCM-IMBs, which provide a promising platform for the specific, efficient, and gentle capture of circulating tumor cells in complex samples. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the synthesis route for CCM-IMBs.

[0032] Figure 2 These are transmission electron microscope (TEM) images of MBs (Fe3O4 nanoparticles) and CCM-MBs.

[0033] Figure 3 This is an SDS-PAGE protein analysis diagram of MBs, tumor cell membranes, and CCM-MBs.

[0034] Figure 4 This is a fluorescence image of CCM-MBs after DiD staining of the cell membrane.

[0035] Figure 5These are fluorescence images of fluorescein-labeled EpCAM and CDH2 aptamers on CCM-IMBs.

[0036] Figure 6 It is a surface potential diagram of MBs, tumor cell membrane (CCM), CCM-MBs, and CCM-IMBs.

[0037] Figure 7 This represents the capture rate of CCM-IMBs on non-small cell lung cancer cells (PC9) at different concentrations and times.

[0038] Figure 8 This refers to the capture efficiency of CCM-MBs on human non-small cell lung cancer cells (PC9) and human renal epithelial cells (293T).

[0039] Figure 9 This is a comparison chart of the capture efficiency of PC9 cells by MBs, CCM-MBs, and CCM-IMBs.

[0040] Figure 10 This is a Western blot analysis of the expression levels of CDH2 and EpCAM in MCF7 and HeLa cells.

[0041] Figure 11 This is a comparison of the specific capture rates of CCM-IMBs, CCM-EpCAM-IMBs, and CCM-CDH2-IMBs on MCF7 cells and HeLa cells.

[0042] Figure 12 A bar chart showing the capture rate of PC9 cells by three materials—MBs, CCM-MBs, and CCM-IMBs—in artificial CTC blood samples.

[0043] Figure 13 Graphpadprism regression analysis of PC9 cells captured from blood samples of artificial CTCs using three materials: MBs, CCM-MBs, and CCM-IMBs. Detailed Implementation

[0044] The invention will now be described in detail with reference to the accompanying drawings. This example is for illustrative purposes only and is not intended to limit the invention.

[0045] Example 1

[0046] The synthesis of biaptamer-functionalized cell membrane biomimetic magnetic nanomaterials (CCM-IMBs) involves the following four steps:

[0047] Step 1: Obtain tumor cell membranes. Scrape PC9 (human non-small cell lung cancer) tumor cells with a healthy cell density of approximately 60-80% from a 15cm cell culture dish into 1mL of buffered lysis buffer (20mM Tris-HCIPH = 7.5; 2mM magnesium chloride; 10mM KCI). Repeat the freeze-thaw cycle three times at 37℃ and in liquid nitrogen, then lyse the cells using ultrasound (100W power, 25kHz frequency) for 10 minutes. Centrifuge the cell suspension at 4000g for 10 minutes at 4℃ and collect the supernatant. Centrifuge the collected supernatant at 20000g for 30 minutes at 4℃, remove the supernatant, and the precipitate is the PC9 tumor cell membrane fragment. Resuspend the cell membrane in 1mL of PBS buffer to obtain the tumor cell membrane solution, and store at 4℃ for later use.

[0048] Step 2: Tumor cell membrane nanovesicles were obtained by extrusion. The 1 mL tumor cell membrane solution obtained in Step 1 was first extruded 20 times through a polycarbonate membrane with a pore size of 400 nm, and then extruded 20 times through a polycarbonate membrane with a pore size of 200 nm, to obtain a tumor cell membrane nanovesicle solution with a diameter of 150-250 nm.

[0049] Step 3: Mix the tumor cell membrane vesicle solution obtained in Step 2 with 100 μg of iron oxide nanoparticles with an average particle size of 100 nm (Zhongke Leiming (Beijing) Technology Co., Ltd.), and then repeatedly extrude the mixture through a polycarbonate membrane with a pore size of 200 nm 20 times to obtain the CCM-MBs solution.

[0050] Step 4: After magnetic separation of the CCM-MBs solution obtained in Step 3, the supernatant is removed. The solution is then mixed with 100 μL of 2 mg / mL DSPE-PEG-COOH (dipalmitoylphosphatidylethanolamine-polyethylene glycol-carboxyl) in a 28°C constant-temperature mixer for 30 min, followed by magnetic separation to remove the supernatant. Next, 100 μL of 10 mg / mL EDC (1-ethyl-(3-dimethylaminopropyl)carbodiimide) and NHS (N-hydroxysuccinimide) solutions are added, and the mixture is mixed in a 28°C constant-temperature mixer for 30 min, followed by magnetic separation to remove the supernatant. The solution is then washed three times with PBST solution to remove free carboxyl groups. Finally, 10 μL each of 10 μM aminated CDH2 aptamer and aminated EpCAM aptamer solutions are added.

[0051] The nucleotide sequence of the amino-modified EpCAM aptamer is: 5'-NH2-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTT GGCCTG-3'; (synthesized by Shanghai Sangon Biotech Co., Ltd.)

[0052] The nucleotide sequence of the aminated CDH2 aptamer is: 5'-NH2-TTGCACTATGTTTTAGCTAGGGTTCCCGGAGATAGTAAGTGCA A-3' (synthesized by Shanghai Sangon Biotech Co., Ltd.).

[0053] To visualize the modification effect of the aptamers, two fluorescent molecules, 6-FAM and Cy3 (synthesized by Shanghai Sangon Biotech Co., Ltd.), were modified at one end of the CDH2 and EpCAM aptamers, respectively. The mixture was then brought to a final volume of 100 μL with PBST solution and mixed at 4 °C for 12 h. The supernatant was removed. The magnetic beads were resuspended in PBST (containing 1% BSA) and reacted at room temperature for 60 min to block unreacted carboxyl groups on the surface of the magnetic beads, maintaining the beads in suspension throughout the process. The beads were washed three times with deionized water to obtain CCM-IMBs material, resuspended in deionized water, and stored at 4 °C for later use.

[0054] Figure 1 This is a schematic diagram of the synthesis route for CCM-IMBs. Figure 2 The image shows a transmission electron microscope (TEM) image of CCM-MBs. As can be seen from the image, compared with nanoparticles that are not coated with tumor cell membranes, CCM-MBs have a core-shell structure with a cell membrane shell layer about 10 nm thick on the surface. Figure 3 The image shows SDS-PAGE protein analysis of iron oxide nanoparticles (MBs), tumor cell membranes (CCMs), and CCM-MBs. The image shows that the same protein bands as those of the tumor cell membrane were detected in CCM-MBs, while no protein bands were detected on the surface of ordinary MBs that were not coated with tumor cell membranes, indicating that the cell membrane has been successfully coated on the surface of the nanoparticles. Figure 4 This is a fluorescence image of CCM-MBs, showing the red fluorescence emitted by the DiD-stained cell membrane at a wavelength of 665 nm. Figure 5 The fluorescence images of CCM-IMBs show green and orange fluorescence belonging to 6-FAM and Cy3, respectively, and the yellow fluorescence after the two fluorescences overlap has the same localization, indicating that the two aptamers have been successfully modified onto the surface of CCM-MBs. Figure 6 The surface potentials of magnetite nanoparticles (MBs), tumor cell membranes (CCMs), CCM-MBs, and CCM-IMBs were measured using a nanolaser particle size analyzer. The results showed that the CCM-MBs nanoparticles coated with tumor cell membranes had similar surface potentials to the tumor cell membranes. Due to the negative charge carried by the aptamers, the surface potential of the nanoparticles after further modification with the aptamers significantly decreased. These results demonstrate the successful synthesis of CCM-MBs and CCM-IMBs with further modified aptamers.

[0055] Examples 2 through 6 below all use the CCM-MBs and CCM-IMBs prepared in this example.

[0056] Example 2

[0057] Taking non-small cell lung cancer cells (PC9) as an example, the capture time and concentration were optimized.

[0058] When PC9 cells are in the logarithmic growth phase and in good condition, 1×10⁶ cells are harvested. 5 Each cell was incubated with 1 mL of CCM-IMBs at concentrations of 25, 50, 100, and 200 μg / mL at 37°C for 20, 40, 60, and 90 min, respectively. After incubation, the CCM-IMBs and the captured cells were separated from the system using a magnetic rack, and the capture efficiency was calculated. The capture efficiency was defined as the percentage of captured cells relative to the initial number of cells added.

[0059] like Figure 7 The results show that the capture efficiency is highest when the capture time is 60 min and the material concentration is 100 μg.

[0060] Example 3

[0061] A specific study of CCM-MBs on tumor cells.

[0062] To verify whether the tumor cell membrane-coated nanoparticles have specificity in capturing tumor cells, the capture efficiency of CCM-MBs on human non-small cell lung cancer cells (PC9) and human renal epithelial cells (293T) was compared. The specific experimental procedure was as follows: when the cells were in the logarithmic growth phase and in good condition, 1×10⁻⁶ cells were collected. 5 PC9 cells and 293T cells were mixed with 1 mL of CCM-MBs at a concentration of 100 μg / mL and incubated in a 37°C incubator for 60 min. After incubation, the CCM-MBs and the captured cells were separated from the system using a magnetic rack, and the capture efficiency was calculated. The capture efficiency was defined as the percentage of the number of cells captured relative to the initial number of cells added.

[0063] like Figure 8 As shown, CCM-MBs have a significantly higher capture efficiency for tumor cells than for ordinary cells, indicating that the nanoparticles coated with tumor cell membranes inherit the homologous targeting properties of tumor cell membranes, thereby improving the capture efficiency to a certain extent.

[0064] Example 4

[0065] Comparison of capture efficiency of iron oxide nanoparticles (MBs), cell membrane biomimetic magnetic nanomaterials (CCM-MBs), and dual aptamer-functionalized cell membrane biomimetic magnetic nanomaterials (CCM-IMBs).

[0066] Taking PC9 cells as an example, this study investigated the changes in the efficiency of biomimetic magnetic nanoparticles coated with cell membranes and nanoparticles with further modified aptamers in capturing tumor cells. The specific experimental steps were as follows: when the cells were in the logarithmic growth phase and in good condition, 1×10⁶ cells were collected. 5 Each nanoparticle was mixed with 100 μg of MBs, CCM-MBs, and CCM-IMBs, and incubated at 37°C for 60 min. After incubation, the nanoparticles and the captured cells were separated from the system using a magnetic rack, and the capture efficiency was calculated. The capture efficiency was defined as the percentage of the number of captured cells to the initial number of cells added.

[0067] like Figure 9 As shown, the capture efficiency of tumor cells by the three materials MBs, CCM-MBs, and CCM-IMBs increases progressively, indicating that the capture efficiency of iron oxide nanoparticles for tumor cells is progressively improved after coating the cell membrane and further modifying the nucleic acid aptamer. This suggests that CCM-MBs enhances tumor cell capture efficiency by inheriting the homologous targeting property of the tumor cell membrane, while CCM-IMBs modified with aptamers possess a high degree of specificity in recognizing target cells, further enhancing capture efficiency. Simultaneously, the formed "biomimetic soft interface" also enhances the affinity between the aptamer and the cell, ultimately optimizing the material's capture efficiency.

[0068] Example 5

[0069] The specificity of the two nucleic acid aptamers was investigated.

[0070] To investigate the specificity of the two nucleic acid aptamers used to modify the nanoparticles, human breast cancer cells (MCF7) with high EpCAM expression and low CDH2 expression were used to simulate epithelial phenotypes in CTCs; human cervical cancer cells (HeLa) with low EpCAM expression and high CDH2 expression were used to simulate mesenchymal phenotypes in CTCs. The two cell types were captured using immunomagnetic beads modified with dual aptamers (CCM-IMBs) and immunomagnetic beads modified with single aptamers (CCM-EpCAM-IMBs, CCM-CDH2-IMBs), and the capture efficiency was compared.

[0071] The preparation process of single-aptamer modified CCM-EpCAM-IMBs and single-aptamer modified CCM-CDH2-IMBs is the same as in Example 1. The difference is that in the fourth step of adding the aptamer, only 20 μL of each of the aminated CDH2 aptamer or aminated EpCAM aptamer solutions with a concentration of 10 μM are added to prepare and synthesize single-aptamer modified CCM-EpCAM-IMBs or single-aptamer modified CCM-CDH2-IMBs.

[0072] The specific experimental steps are as follows: When MCF7 cells and HeLa cells are cultured to the logarithmic growth phase and are in good condition, 1×10⁶ MCF7 cells and HeLa cells are taken from each cell. 5 Three portions of each nanoparticle were mixed with 100 μg of CCM-IMBs, 100 μg of CCM-EpCAM-IMBs, and 100 μg of CCM-CDH2-IMBs, respectively, and incubated at 37°C for 60 min. After incubation, the nanoparticles and the captured cells were separated from the system using a magnetic rack, and the capture efficiency was calculated. The capture efficiency was defined as the percentage of the number of captured cells to the initial number of cells added.

[0073] Figure 10 To detect the expression of two cell surface proteins using Western blotting, EpCAM was highly expressed and CDH2 was lowly expressed in MCF7 cells, while EpCAM was relatively lowly expressed and CDH2 was highly expressed in HeLa cells, meeting the criteria for simulating epithelial and mesenchymal CTCs; Figure 11 It is evident that CCM-EpCAM-IMBs exhibit higher capture efficiency for MCF7 than CCM-CDH2-IMBs. Similarly, CCM-CDH2-IMBs demonstrate higher capture efficiency for HeLa cells, while CCM-EpCAM-IMBs show relatively lower efficiency, though overall still higher than CCM-CDH2-IMBs for MCF-7. This is likely due to the relatively higher expression level of EpCAM in the HeLa cell line. These results are consistent with the trends observed in Western blotting. The capture efficiency of CCM-IMBs for both cell types is significantly improved compared to single-aptamer modification, demonstrating the superiority of dual-aptamer modified nanoparticles.

[0074] Example 6

[0075] Simulating the capture of CTCs in real samples

[0076] To further investigate the clinical applicability of CCM-IMBs, different numbers of PC9 cells were introduced into whole blood from healthy donors to simulate the capture of CTCs in actual samples. The specific experimental steps were as follows: 1 mL of venous whole blood from 9 healthy individuals was taken, and 3 times the volume of erythrocyte lysis buffer (Elabscience, China) was added to each sample. After mixing, the blood was lysed on ice for 15 min, centrifuged at 4℃, 450g, and 10 min, and the supernatant was removed. Then, 2 times the volume of erythrocyte lysis buffer was added to each sample, and the blood was centrifuged at 4℃, 450g, and 10 min, and the supernatant was removed to obtain whole blood cells other than erythrocytes. The cells were resuspended in 1 mL of PBS buffer. The 9 samples were then divided into three groups of 3 samples each, and 50 (Group 1), 100 (Group 2), and 200 (Group 3) PC9 cells (i.e., spiked cells) were added to each group to obtain artificial blood samples with CTCs. Each group of CTCs artificial blood samples was mixed with 100 μg MBs, 100 μg CCM-MBs, and 100 μg CCM-IMBs, respectively, and incubated in a 37°C constant temperature incubator for 60 min. After incubation, the nanoparticles and the cells they captured were separated from the system and counted using a magnetic rack.

[0077] Figure 12 , 13 The bar charts showing the number of cells captured and the regression analysis plots created using Graphpadprism software show that MBs, CCM-MBs, and CCM-IMBs all exhibited better cell capture performance than the former. This indicates that even in whole blood, CCM-MBs with cell membrane function and CCM-IMBs with dual aptamer specificity can effectively improve cell separation efficiency.

[0078] In summary, the dual-aptamer functionalized cell membrane biomimetic magnetic nanomaterials CCM-IMBs constructed in this invention can efficiently and specifically capture circulating tumor cells, and the preparation method is simple and economical.

Claims

1. A method for preparing a biaptamer-functionalized cell membrane biomimetic magnetic nanomaterial, characterized in that: First, tumor cell membranes are coated onto the surface of iron oxide nanoparticles using a co-extrusion method. Then, the outer surface of the cell membrane is further modified with epithelial marker EpCAM nucleic acid aptamer and mesenchymal marker CDH2 nucleic acid aptamer to obtain a dual-aptamer functionalized cell membrane biomimetic magnetic nanomaterial for capturing circulating tumor cells.

2. The method for preparing the biaptamer-functionalized cell membrane biomimetic magnetic nanomaterial according to claim 1, characterized in that: The preparation method includes the following steps: (1) Tumor cell membranes were obtained by combining repeated freeze-thaw cycles with ultrasonic lysis. (2) Tumor cell membrane nanovesicles were prepared by extrusion method; (3) Tumor cell membrane nanovesicles were coated onto the surface of iron oxide nanoparticles by co-extrusion to obtain cell membrane biomimetic magnetic nanomaterials, namely CCM-MBs. (4) The surface of CCM-MBs was modified by amidation reaction to obtain CCM-IMBs, which are epithelial markers EpCAM nucleic acid aptamers and mesenchymal markers CDH2 nucleic acid aptamers used to specifically capture circulating tumor cells.

3. The method for preparing the biaptamer-functionalized cell membrane biomimetic magnetic nanomaterial according to claim 1 or 2, characterized in that: The tumor cell membrane is a tumor cell membrane with the ability to self-target and adhere to homologous tumor cells; the average particle size of the iron oxide nanoparticles is 90-110 nm.

4. The method for preparing the biaptamer-functionalized cell membrane biomimetic magnetic nanomaterial according to claim 1 or 2, characterized in that: The epithelial marker EpCAM aptamer and the mesenchymal marker CDH2 aptamer are modified at one end with an amino group, and their specific nucleotide sequences are as follows: (1) Aminated E p CAM nucleic acid aptamers: 5'-NH2-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG-3'; (2) Aminated CDH2 nucleic acid aptamers: 5'-NH2-TTGCACTATGTTTTAGCTAGGGTTCCCGGAGATAGTAAGTGCAA-3'.

5. The method for preparing the biaptamer-functionalized cell membrane biomimetic magnetic nanomaterial according to claim 2, characterized in that: The process of obtaining tumor cell membranes in step (1) is as follows: Scrape tumor cells with a cell density of approximately 60-80% from a 15cm cell culture dish into 0.8-1.2mL (preferably 0.9-1.1mL, more preferably 0.95-1.05mL) of buffer lysis buffer (20mM Tris-HCl pH=7.5; 2mM magnesium chloride; 10mM KCl). Repeat the freeze-thaw cycle three to five times between 34-40℃ (preferably 35-39℃, more preferably 36-38℃) and liquid nitrogen. Then, disrupt the cell suspension using ultrasound (20-30kHz, preferably 22-28kHz, more preferably 24-26kHz) for 5-15min (preferably 7-13min, more preferably 9-11min). Finally, centrifuge the cell suspension at 0-4℃ at 2000-6000g (preferably 3000-5000g, more preferably 3500-4500g) for 5-15min (preferably 7-13min, more preferably 9-11min). Centrifuge the supernatant at 16000-22000g (preferably 17000-21000g, more preferably 18000-20000g) for 20-60min (preferably 25-50min, more preferably 30-40min) at 0-4℃ to remove the supernatant. The precipitate is the tumor cell membrane fragment. Resuspend the fragment in 0.8-1.2mL (preferably 0.9-1.1mL, more preferably 0.95-1.05mL) PBS buffer to obtain the tumor cell membrane solution, and store it at 4℃ for later use.

6. The method for preparing the biaptamer-functionalized cell membrane biomimetic magnetic nanomaterial according to claim 2, characterized in that: Step (2) The process of preparing tumor cell membrane nanovesicles using the extrusion method: The tumor cell membrane solution obtained in step (1) is first extruded repeatedly through a polycarbonate membrane with a pore size of 400 nm for 12-30 times (preferably 15-25 times, more preferably 18-22 times), and then extruded repeatedly through a polycarbonate membrane with a pore size of 200 nm for 12-30 times (preferably 15-25 times, more preferably 18-22 times) to obtain a tumor cell membrane vesicle solution with a diameter of 150-250 nm (preferably 160-240 nm, more preferably 190-210 nm). The preparation process of CCM-MBs in step (3) is as follows: 0.8-1.2 mL (preferably 0.9-1.1 mL, more preferably 0.95-1.05 mL) of tumor cell membrane vesicle solution obtained in step (2) is mixed with 80-120 μg (preferably 90-110 μg, more preferably 95-105 μg) of iron oxide nanoparticles, and then repeatedly extruded through a polycarbonate membrane with a pore size of 200 nm 12-30 times (preferably 15-25 times, more preferably 18-22 times), and the supernatant is removed by magnetic separation to obtain CCM-MBs material.

7. The method for preparing the biaptamer-functionalized cell membrane biomimetic magnetic nanomaterial according to claim 2, characterized in that: The synthesis process of CCM-IMBs material in step (4) is as follows: Take 80-120 μg (preferably 90-110 μg, more preferably 95-105 μg) of CCM-MBs and 80-120 μL (preferably 90-110 μL, more preferably 95-105 μL) of DSPE-PEG-COOH (dispalmitoylphosphatidylethanol) with a concentration of 1.5-2.5 mg / mL (preferably 1.7-2.3 mg / mL, more preferably 1.9-2.1 mg / mL). The mixture (amine-polyethylene glycol-carboxyl group) was stirred in a constant temperature mixer at 25-28°C for 20-60 min (preferably 25-50 min, more preferably 30-40 min), and the supernatant was removed by magnetic separation. Then, 80-120 μL (preferably 90-110 μL, more preferably 95-105 μL) of EDC and NHS solutions, each with a concentration of 8-12 mg / mL (preferably 9-11 mg / mL, more preferably 9.5-10.5 mg / mL), were added separately and stirred at a constant temperature of 25-28°C. Mix thoroughly for 20-60 min (preferably 25-50 min, more preferably 30-40 min), remove the supernatant by magnetic separation, and wash three times with PBST solution to remove free carboxyl groups; add 8-12 μL (preferably 9-11 μL, more preferably 9.5-10.5 μL) each of 10 μM aminated CDH2 aptamer and 10 μM aminated EpCAM aptamer solutions, and bring the volume to 80-120 μL (preferably 90-110 μL) with PBST solution. Mix the CCM-MBs magnetic beads in a constant temperature mixer at 0-4℃ for 9-14 hours (preferably 10-13 hours, more preferably 11-12 hours) and remove the supernatant. Add PBST (containing 1% BSA) to resuspend the CCM-MBs magnetic beads and react at room temperature for 40-80 minutes (preferably 50-70 minutes, more preferably 55-65 minutes) to block the unreacted carboxyl groups on the surface of the magnetic beads. Keep the magnetic beads suspended during the process. Wash three times with deionized water to obtain the CCM-IMBs material.

8. A CCM-IMBs nanomaterial prepared by any one of the preparation methods described in claims 1-7.

9. The application of the CCM-IMBs nanomaterial of claim 8 in the specific capture of circulating tumor cells.

10. The application according to claim 9, characterized in that: The specific steps are as follows: Add 0.8-1.2 mL (preferably 0.9-1.1 mL, more preferably 0.95-1.05 mL) of CCM-IMBs solution (using PBS as solvent) with a concentration of 80-120 μg / mL (preferably 90-110 μg / mL, more preferably 95-105 μg / mL) to a solution containing 8 × 10⁸ μg / mL of PBS. 4 -1.2×10 5 (preferably 9×10) 4 -1.1×10 5 More preferably 9.5 × 10 4 -1.05×10 5 The tumor cells were incubated in a solution of 1000 tumor cells at 37°C for 20-90 minutes; then separated with a magnet to obtain the captured circulating tumor cells.

Images