Application of recombinant adeno-associated virus in the preparation of drugs for treating intervertebral disc degeneration

Abstract

This application relates to the field of biotechnology, and more particularly to the application of a recombinant adeno-associated virus (AAV) in the preparation of a medicament for treating intervertebral disc degeneration. A recombinant AAV is provided for use in the preparation of a medicament for treating intervertebral disc degeneration, wherein the recombinant AAV carries a nucleic acid sequence encoding a phosphorylated mimic mutant of the SMTNL2 protein; the phosphorylated mimic mutant at least includes mutations corresponding to a threonine mutation at position 305 of the SMTNL2 protein being replaced by an aspartic acid mutation and / or a serine mutation at position 344 being replaced by an aspartic acid mutation. By mimicking the sustained phosphorylation of the SMTNL2 protein (T305D / S344D), the process of intervertebral disc degeneration can be effectively reversed from the source of mitochondrial energy metabolism, providing a novel strategy for gene therapy of intervertebral disc degenerative diseases.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, and in particular relates to the application of a recombinant adeno-associated virus in the preparation of a drug for treating intervertebral disc degeneration. Background Technology

[0002] Intervertebral disc degeneration (IVDD) is the main pathological basis for low back pain, and its incidence continues to rise with population aging, becoming a global public health challenge. Nucleus pulposus cells (NPCs) maintain disc height and hydration by secreting proteoglycans, and are the core cells supporting the physiological function of the intervertebral disc. Current treatment strategies for IVDD mainly include conservative treatment (such as medication and physical therapy) and surgical treatment (such as nucleotomy and fusion), but these methods primarily relieve symptoms and cannot fundamentally reverse the degenerative process. In recent years, gene therapy strategies (such as delivery of TGF-β and IL-1Ra) have shown some potential, but they are mostly limited to anti-inflammatory or matrix synthesis-promoting effects, failing to intervene at the metabolic source.

[0003] Numerous studies have shown that mitochondrial dysfunction is one of the core pathological events driving intervertebral disc degeneration. During the degeneration process, mitochondrial DNA damage and decreased respiratory chain complex activity lead to an imbalance in the ratio of oxidative phosphorylation to glycolysis, resulting in severe ATP synthesis deficiency, which in turn induces cell senescence, apoptosis, and abnormal expression of matrix degrading enzymes.

[0004] However, current technologies lack targeted therapies that can effectively restore mitochondrial function in nucleus pulposus cells and restore energy metabolism balance. Summary of the Invention

[0005] The purpose of this application is to provide the application of recombinant adeno-associated virus in the preparation of a drug for treating intervertebral disc degeneration, aiming to solve the problem of how to treat intervertebral disc degeneration by restoring the mitochondrial function of nucleus pulposus cells.

[0006] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows: In a first aspect, this application provides the use of a recombinant adeno-associated virus in the preparation of a medicament for treating intervertebral disc degeneration, wherein the recombinant adeno-associated virus carries a nucleic acid sequence encoding a phosphorylated mimic mutant of the SMTNL2 protein; the phosphorylated mimic mutant contains at least a mutation corresponding to a mutation of threonine at position 305 to aspartic acid and / or a mutation of serine at position 344 to aspartic acid in the SMTNL2 protein.

[0007] In some embodiments, the phosphorylation mimic mutant is the T305D / S344D phosphorylation mimic double mutant.

[0008] In some embodiments, the amino acid sequence of the T305D / S344D phosphorylation mimic double mutant is shown in SEQ ID NO.1 and SEQ ID NO.2.

[0009] In some embodiments, the nucleic acid sequence encoding the T305D / S344D phosphorylation mimic double mutant is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0010] In some embodiments, treatment of intervertebral disc degeneration is achieved by delivering recombinant adeno-associated virus to the nucleus pulposus cells of the intervertebral disc, causing overexpression of a phosphorylation mimic mutant, thereby restoring mitochondrial function of the nucleus pulposus cells, restoring the metabolic balance between oxidative phosphorylation and glycolysis, reducing apoptosis, and increasing cell proliferation.

[0011] In some embodiments, the recombinant adeno-associated virus also carries an operatively linked promoter, including at least one of the CAG promoter, CMV promoter, EF1α promoter, and PGK promoter.

[0012] In some embodiments, the serotype of the recombinant adeno-associated virus is selected from at least one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAVrh10.

[0013] In some embodiments, the dosage form of the drug includes at least one of tablets, capsules, granules, powders, oral liquids, suspensions, emulsions, pills, injections, ointments, and creams.

[0014] In some embodiments, the intervertebral disc degeneration is classified as Pfirrmann grade 2 or 3.

[0015] In some embodiments, intervertebral disc degeneration includes mechanically overload-induced intervertebral disc degeneration or inflammation-induced intervertebral disc degeneration.

[0016] In some embodiments, the drug is selected from intradiscal injection formulations, and the titer of recombinant adeno-associated virus is 5 × 10⁻⁶. 12 Virus particles / 0.5 μL.

[0017] The first aspect of this application provides a recombinant adenovirus as a gene delivery vector. This virus carries a nucleic acid sequence encoding a phosphorylation mimic mutant of the SMTNL2 protein. The phosphorylation mimic mutant contains at least mutations corresponding to the mutation of threonine at position 305 of the SMTNL2 protein to aspartic acid (T305D) and / or serine at position 344 to aspartic acid (S344D). This application mutates these two sites to negatively charged aspartic acid to simulate a sustained phosphorylation activation state. After this phosphorylation mimic mutant is delivered to nucleus pulposus cells via recombinant adenovirus, the physiological function of SMTNL2 can be restored, thereby upregulating the expression of mitochondrial respiratory chain complex subunits, promoting oxidative phosphorylation, and simultaneously inhibiting the activity of key glycolytic enzymes, thus restoring energy metabolism balance. This application is the first to intervene in intervertebral disc degeneration from the source of mitochondrial energy metabolism. The provided nucleus pulposus cells expressing the T305D and / or S344D mutants show significantly increased oxidative phosphorylation levels, decreased glycolysis levels, and restored ATP synthesis, thereby inhibiting apoptosis and promoting proliferation. This application provides a novel strategy for gene therapy of intervertebral disc degeneration by mimicking the continuous phosphorylation of SMTNL2 protein (T305D / S344D) at the source of mitochondrial energy metabolism, effectively reversing the process of intervertebral disc degeneration. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 The Seahorse metabolic analysis results provided in the embodiments of this application show the effects of overexpression of different SMTNL2 mutants on oxidative phosphorylation (OCR) and glycolysis (ECAR) in nucleus pulposus cells. Among them, the T305D / S344D biphosphorylation mimic mutant (DD) group significantly increased OCR and decreased ECAR compared with the wild type and phosphorylation deletion mutant (AA) group, indicating that it can restore energy metabolism balance.

[0020] Figure 2 The real-time fluorescence quantitative PCR detection results provided in the embodiments of this application show the relative expression levels of extracellular matrix synthesis genes (ACAN, COL2A1) and matrix degradation enzyme genes (ADAMTS5, MMP13) in nucleus pulposus cells of different treatment groups. The DD mutant can significantly upregulate the synthesis genes and downregulate the degradation enzyme genes.

[0021] Figure 3The cell proliferation detection results (CCK-8 or Edu incorporation assay) provided in the embodiments of this application show that overexpression of the DD mutant can significantly promote the proliferation of nucleus pulposus cells, while the AA mutant inhibits proliferation.

[0022] Figure 4 The flow cytometry apoptosis detection results (Annexin V-FITC / PI double staining) provided in the embodiments of this application show that overexpression of the DD mutant can significantly reduce nucleus pulposus cell apoptosis (proportion of early and late apoptotic cells), while the AA mutant has the opposite effect.

[0023] Figure 5 Representative images of intervertebral disc histology (including hematoxylin-eosin staining, safranin O-fast green staining, and Masson's trichrome staining) provided in the embodiments of this application show that after intradiscal injection of AAV6-mediated SMTNL2 (T305D / S344D) double mutant, the area of ​​nucleus pulposus tissue, cell number, and proteoglycan content (safranin O positive area) of the degenerated intervertebral disc were significantly restored compared with the empty vector control group.

[0024] Figure 6 The quantitative analysis results of the degree of intervertebral disc degeneration provided in the embodiments of this application, including the intervertebral disc height index (DHI) and the modified Pfirrmann grading score, show that the intervertebral disc height of mice in the double mutant treatment group was significantly restored and the degeneration grade was significantly reduced, with statistically significant differences (P<0.01). Detailed Implementation

[0025] To make the technical problems, technical solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0026] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.

[0027] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single or multiple items. For example, "at least one of a, b, or c", or "at least one of a, b, and c", can both mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple.

[0028] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0029] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application. The singular forms "a" and "the" as used in the embodiments of this application and the appended claims are also intended to include the plural forms, unless the context clearly indicates otherwise.

[0030] The weights of the relevant components mentioned in the embodiments of this application can refer not only to the specific content of each component, but also to the proportional relationship between the weights of the components. Therefore, any scaling up or down of the content of the relevant components according to the embodiments of this application is within the scope disclosed in the embodiments of this application. Specifically, the mass in the embodiments of this application can be a well-known unit of mass in the chemical industry, such as µg, mg, g, or kg.

[0031] The terms "first" and "second" are used for descriptive purposes only, to distinguish objects, such as substances, from one another, and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. For example, without departing from the scope of the embodiments of this application, "first XX" may also be referred to as "second XX," and similarly, "second XX" may also be referred to as "first XX." Thus, features defined with "first" and "second" may explicitly or implicitly include one or more of that feature.

[0032] The function of intervertebral disc nucleus pulposus cells is highly dependent on mitochondrial energy metabolism. During intervertebral disc degeneration (IVDD), mitochondrial DNA damage and decreased respiratory chain complex activity lead to a reduction in oxidative phosphorylation (OXPHOS) levels, forcing cells to switch to glycolysis for energy. However, the ATP produced by glycolysis is far from sufficient to meet the needs of nucleus pulposus cells in synthesizing extracellular matrix and resisting mechanical stress. SMTNL2 protein is a direct substrate of JNK kinase, and the phosphorylation status of its threonine at position 305 and serine at position 344 plays an important regulatory role in mitochondrial function.

[0033] The first aspect of this application provides the use of recombinant adeno-associated virus in the preparation of a medicament for treating intervertebral disc degeneration, wherein the recombinant adeno-associated virus carries a nucleic acid sequence encoding a phosphorylated mimic mutant of the SMTNL2 protein; the phosphorylated mimic mutant contains at least a mutation corresponding to a mutation of threonine at position 305 to aspartic acid and / or a mutation of serine at position 344 to aspartic acid in the SMTNL2 protein.

[0034] The first aspect of this application provides a recombinant adenovirus as a gene delivery vector. This virus carries a nucleic acid sequence encoding a phosphorylation mimic mutant of the SMTNL2 protein. The phosphorylation mimic mutant contains at least mutations corresponding to the mutation of threonine at position 305 of the SMTNL2 protein to aspartic acid (T305D) and / or serine at position 344 to aspartic acid (S344D). This application mutates these two sites to negatively charged aspartic acid to simulate a sustained phosphorylation activation state. After this phosphorylation mimic mutant is delivered to nucleus pulposus cells via recombinant adenovirus, the physiological function of SMTNL2 can be restored, thereby upregulating the expression of mitochondrial respiratory chain complex subunits, promoting oxidative phosphorylation, and simultaneously inhibiting the activity of key glycolytic enzymes, thus restoring energy metabolism balance. This application is the first to intervene in intervertebral disc degeneration from the source of mitochondrial energy metabolism. The provided nucleus pulposus cells expressing the T305D and / or S344D mutants show significantly increased oxidative phosphorylation levels, decreased glycolysis levels, and restored ATP synthesis, thereby inhibiting apoptosis and promoting proliferation. This application provides a novel strategy for gene therapy of intervertebral disc degeneration by mimicking the continuous phosphorylation of SMTNL2 protein (T305D / S344D) at the source of mitochondrial energy metabolism, effectively reversing the process of intervertebral disc degeneration.

[0035] In some specific embodiments, the recombinant adenovirus is selected from AAV6 serotype recombinant adenovirus.

[0036] In some embodiments, the phosphorylation mimic mutant is the T305D / S344D phosphorylation mimic double mutant.

[0037] Further defining the phosphorylation mimic mutant as the T305D / S344D phosphorylation mimic double mutant, the T305D / S344D double mutant can more comprehensively mimic the natural phosphorylation state of SMTNL2 under endogenous JNK signaling activation. The aspartate substitutions at the two sites produce a synergistic effect: T305D mainly affects the interaction between SMTNL2 and the mitochondrial respiratory chain complex, while S344D may regulate the nuclear translocation of SMTNL2 or its binding with other transcriptional coactivators. The double mutant simultaneously restores the function of two key regulatory nodes, thereby maximally restoring the energy metabolism homeostasis of nucleus pulposus cells.

[0038] In some embodiments, the amino acid sequences of the T305D / S344D phosphorylation mimic double mutant are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The amino acid sequence of T305D is SEQ ID NO.1, specifically: LVRSQ-D-LPRTSE; the amino acid sequence of S344D is SEQ ID NO.2, specifically: RLKRSQ-D-FGVAS.

[0039] In some embodiments, the nucleic acid sequences encoding the T305D / S344D phosphorylation mimic double mutant are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. The nucleic acid sequence encoding T305D is SEQ ID NO.3, specifically: ctggtgaggtcgcag GAC‎ctgccccgcacctcggag; the nucleic acid sequence encoding S344D is SEQ ID NO.4, specifically: aggctgaagcggtcgcag GAC ttcggcgtggccagc.

[0040] In some embodiments, treatment of intervertebral disc degeneration is achieved by delivering recombinant adeno-associated virus to the nucleus pulposus cells of the intervertebral disc, causing overexpression of a phosphorylation mimic mutant, thereby restoring mitochondrial function of the nucleus pulposus cells, restoring the metabolic balance between oxidative phosphorylation and glycolysis, reducing apoptosis, and increasing cell proliferation.

[0041] Recombinant adenoviruses possess naturally high transduction efficiency in nucleus pulposus cells, allowing for direct delivery of viral particles to the nucleus pulposus region via intradiscal injection. Once inside the cell, the virus's nucleic acid sequence is transcribed and translated under promoter-driven conditions, producing the T305D / S344D mutant protein. This mutant protein mimics the phosphorylation activation state induced by JNK kinase, which facilitates the upregulation of mitochondrial respiratory chain complex I and IV subunits, restoring oxidative phosphorylation; inhibiting the activity of key glycolytic enzymes PKM2 and LDHA, reducing lactate accumulation; and activating the PI3K / Akt pathway by restoring ATP levels, upregulating Bcl-2 and downregulating Bax, thus inhibiting apoptosis. It also promotes the expression of cyclin D1 and CDK4, increasing cell proliferation.

[0042] In some embodiments, the recombinant adeno-associated virus also carries an operatively linked promoter, including at least one of the CAG promoter, CMV promoter, EF1α promoter, and PGK promoter. Various different promoters can be selected and used according to specific needs.

[0043] In some embodiments, the serotype of recombinant adeno-associated virus (AAV) is selected from at least one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAVrh10. Different serotypes of adeno-associated virus (AAV) have different capsid protein structures, which is beneficial for selection according to specific needs. AAV6 has a natural high affinity for nucleus pulposus cells and can efficiently enter nucleus pulposus cells by binding to heparan sulfate proteoglycans and sialic acid receptors on the cell surface through its capsid protein. AAV2 is widely used in gene therapy, but it has a high positive rate of neutralizing antibodies; AAV8 and AAV9 are mainly hepatotropic; AAVrh10 is derived from rhesus monkeys and has low immunogenicity. This invention validates the efficient transduction of AAV6 in the nucleus pulposus based on animal experiments, while providing multiple serotype options to accommodate pre-existing neutralizing antibodies in different patient populations.

[0044] In some embodiments, the dosage form of the drug includes at least one of tablets, capsules, granules, powders, oral liquids, suspensions, emulsions, pills, injections, ointments, and creams.

[0045] In some embodiments, the intervertebral disc degeneration is classified as Pfirrmann grade 2 or 3.

[0046] The Pfirrmann classification is the gold standard for clinically assessing the degree of intervertebral disc degeneration. It is divided into four grades based on the nucleus pulposus signal strength, the boundary between the nucleus pulposus and annulus fibrosus, and the disc height on T2-weighted images. Grades 2 and 3 represent early to mid-stage degeneration: Grade 2 is characterized by a slightly decreased nucleus pulposus signal and a relatively clear boundary between the annulus fibrosus and nucleus pulposus; Grade 3 is characterized by a significantly decreased nucleus pulposus signal, blurred boundary, and a slight decrease in disc height. At this stage, the number of nucleus pulposus cells has not yet decreased significantly, there is still some reserve of extracellular matrix, and the energy metabolism disorder is reversible.

[0047] In some embodiments, intervertebral disc degeneration includes mechanically overload-induced intervertebral disc degeneration or inflammation-induced intervertebral disc degeneration.

[0048] Intervertebral disc degeneration can be caused by a variety of factors, among which mechanical overload (such as long-term weight-bearing and spinal instability) and inflammatory response (such as immune inflammation secondary to disc herniation) are the two main types. Mechanical overload mainly induces nucleus pulposus cell apoptosis and matrix degradation through the JNK signaling pathway; while inflammation mainly activates MMPs and inflammatory factors through the NF-κB pathway.

[0049] In some embodiments, the drug is selected from intradiscal injection formulations, and the titer of recombinant adeno-associated virus is 5 × 10⁻⁶. 12 Virus particles / 0.5 μL.

[0050] The drug was further specified to be selected from an intradiscal injection formulation, and the titer of the recombinant adenovirus was 5 × 10⁻⁶. 12 Viral particles / 0.5 μL. Intradiscal injection is the preferred route for directly delivering gene therapy drugs to the lesion site, avoiding the dilution effect and hepatotoxicity risks of systemic administration. Titer is a key parameter determining the efficacy and safety of gene therapy: too low a titer will fail to reach the therapeutic threshold in nucleus pulposus cells; too high a titer may trigger an immune response or vector-related toxicity. A titer within this range is beneficial for safe and effective treatment.

[0051] The following description is based on specific embodiments.

[0052] Example 1 Construction, packaging, and intradiscal injection of recombinant adeno-associated virus AAV6-Smtnl2 (T305D / S344D) 1. Construction of AAV recombinant vectors Based on the coding sequence of the mouse Smtnl2 gene (NCBI Reference Sequence: NM_001146712.1, whose encoded protein is characterized by threonine residues at position 305 and serine residues at position 344), the full-length wild-type coding sequence of Smtnl2 was obtained using artificial gene synthesis methods. Using this as a template, overlap extension PCR was performed using primer pairs carrying point mutations of T305D (threonine → aspartic acid) and S344D (serine → aspartic acid) to construct T305D single mutant, S344D single mutant, and T305D / S344D double mutant, respectively. As a control, the phosphorylation deletion mutant T305A / S344A (threonine / serine → alanine) was also constructed. All the PCR products were identified and purified by agarose gel electrophoresis, then double-digested with restriction endonucleases (such as EcoRI and SalI) and directionally cloned into the pAV-CAG-MCS vector (containing a CAG promoter fused with a cytomegalovirus early enhancer and a chicken β-actin promoter) with a C-terminal Flag tag sequence. The recombinant plasmids were sequenced to verify the accuracy of the mutation sites and the correctness of the inserted sequences, and were named pAV-CAG-Smtnl2 (wild type), pAV-CAG-Smtnl2 (T305A / S344A), pAV-CAG-Smtnl2 (T305D), pAV-CAG-Smtnl2 (S344D), and pAV-CAG-Smtnl2 (T305D / S344D), respectively.

[0053] 2. AAV6 virus packaging and purification AAV6 serotype virus was packaged using a three-plasmid co-transfection system. The recombinant expression plasmid (pAV-CAG-Smtnl2 wild-type or mutant), the helper packaging plasmid pAAV-RC6 (carrying the AAV6 serotype capsid gene cap and replication gene rep), and the helper plasmid pHelper (carrying adenovirus E2A, E4, and VA genes) were mixed at a molar ratio of 1:1:1. Twenty-four hours before transfection, HEK293T cells (ATCC, CRL-3216) in logarithmic growth phase were seeded in 15cm cell culture dishes and cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator until cell confluence reached 70%-80%. Using polyethyleneimine (PEI) transfection reagent, a transfection complex was prepared at a DNA:PEI ratio of 1:3 (mass ratio). The complex was added dropwise to the cell culture medium. Six hours after transfection, the medium was replaced with fresh DMEM containing 2% fetal bovine serum, and the cells were cultured for another period of time.

[0054] Seventy-two hours post-transfection, cells and culture supernatants were collected separately. Cells were washed with PBS and then lysed to release viral particles via repeated freeze-thaw cycles (-80℃ / 37℃, 3 cycles). Cell debris was removed by centrifugation. The cell lysis supernatant and culture supernatant were combined, and Benzonase nuclease was added to a final concentration of 50 U / mL. The mixture was incubated at 37℃ for 30 minutes to degrade residual nucleic acids. Viral particles were purified using an iodixanol (OptiPrep) density gradient ultracentrifugation method: a gradient of 15%, 25%, 40%, and 60% iodixanol solutions was sequentially prepared, with the crude viral extract loaded at the top of the gradient. The mixture was then ultracentrifuged at 350,000 × g at 4℃ for 3 hours. After centrifugation, viral bands located at the 40%-60% boundary were collected. The PBS buffer was then concentrated using Amicon Ultra-15 ultrafiltration tubes (100 kDa molecular weight cutoff) to remove iodixanol and adjust the viral volume.

[0055] 3. Virus titer determination The physical titer of the recombinant AAV6 viral genome was determined using SYBR Green real-time quantitative PCR. A standard curve was prepared using the recombinant plasmid carrying the Smtnl2 coding sequence as a standard. qPCR detection was performed using primers specific to the Smtnl2 gene (forward primer: CCCCTGAGATTGCCCAAAACT (Seq. ID NO. 5); reverse primer: CATGGGTGATAGAGCCGCAG (Seq. ID NO. 6)). Viral samples were digested with DNase I to remove free DNA, and then lysed at 56°C in the presence of proteinase K and SDS to release viral genomic DNA. This DNA was purified by phenol / chloroform extraction and used as a template. The qPCR reaction conditions were: 95°C pre-denaturation for 3 minutes, followed by 40 cycles of 95°C denaturation for 15 seconds, 60°C annealing for 30 seconds, and 72°C extension for 30 seconds. The viral genome copy number was calculated based on the standard curve, and the titers of each recombinant AAV6 viral solution were adjusted to approximately 1 × 10¹³ viral particles / mL (vg / mL). After aliquoting, the solutions were stored at -80°C for later use. The purified viral solutions were then subjected to SDS-PAGE silver staining and Western blot analysis to detect the AAV capsid protein VP1 / VP2 / VP3 bands, confirming that the viral purity met the requirements for in vivo experiments.

[0056] 4. Intradiscal injection in animal experiments Select 8-10 week old males with Smtnl2 gene knockout (Smtnl2) - / -Mice were anesthetized with isoflurane inhalation (induction concentration 4%, maintenance concentration 1.5%-2%, oxygen flow rate 1L / min). After back preparation and disinfection, the caudal intervertebral disc was located under the assistance of a dissecting microscope (target segment 8-9 of the caudal vertebrae). A 33G microinjection needle (Hamilton) connected to a 10μL microinjector was used to percutaneously puncture the nucleus pulposus region under fluoroscopy, and 0.5μL of AAV6 virus solution (approximately 5×10⁻⁶) was slowly injected. 6 Virus particles / intervertebral disc (equivalent to a dilution injection concentration of approximately 5 × 10¹² vg / mL) were injected for 30 seconds, and the needle was left in place for 30 seconds before being slowly withdrawn to prevent backflow of the viral fluid. The experiment was divided into the following groups: (1) empty AAV vector control group; (2) AAV6-Smtnl2 wild-type group; (3) AAV6-Smtnl2 (T305A / S344A) phosphorylation deletion group; (4) AAV6-Smtnl2 (T305D) single mutation group; (5) AAV6-Smtnl2 (S344D) single mutation group; (6) AAV6-Smtnl2 (T305D / S344D) double mutation group. Each group had at least 6 mice.

[0057] 5. Establishment and histological evaluation of intervertebral disc degeneration model Following intradiscal injection, static compression load was applied to some experimental group mice to induce disc degeneration: two Kirschner wires were inserted into adjacent vertebral bodies on both sides of the target disc, and an Ilizarov-type external fixation device was used to apply a static compressive stress of 1.0 MPa for 14 days, establishing a mechanical overload-induced disc degeneration model. At week 4 post-modeling (week 6 post-injection), mice were euthanized with CO2, and the caudal vertebral segments were isolated. After fixation with 4% paraformaldehyde for 48 hours and decalcification with 10% EDTA for 21 days, the segments were embedded in paraffin and serially sectioned (5 μm thick). Hematoxylin-eosin staining was performed to assess nucleus pulposus morphology and cell number, safranin O-fast green staining to assess proteoglycan content, and Masson's trichrome staining to assess collagen fiber arrangement. The degree of intervertebral disc degeneration was semi-quantitatively assessed using the modified Pfirrmann grading system, while the disc height index (DHI, i.e., the ratio of disc height to adjacent vertebral body height) was measured to quantify the degree of degeneration.

[0058] 6. Seahorse metabolic experimental method Mitochondrial bioenergy metabolism in nucleus pulposus cells was detected using a Seahorse XF24 metabolic analyzer (Agilent Technologies, Santa Clara, CA). The experimental procedure was as follows: Nucleus pulposus cells in logarithmic growth phase were subjected to a 1×10⁻⁶ incubator. 4Cells were seeded at a density of cells / well in XF24-well cell culture plates and cultured adherently for 24 hours, followed by appropriate treatments according to the experimental design. Before assay, the cell culture medium was replaced with XF basal medium (pH 7.4) without sodium bicarbonate, and 10 mmol / L glucose was added. The plates were incubated at 37°C in a non-CO2 incubator for 1 hour. During assay, oligomycin (1.5 μmol / L), an inhibitor of the mitochondrial respiratory chain complex, FCCP (1.0 μmol / L), an uncoupling agent, and rotenone / antimycin A (0.5 μmol / L) were added sequentially through the injection port. The oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of the cells were monitored in real time using a Seahorse XF24 analyzer. Experimental data were analyzed using Wave software (Agilent Technologies).

[0059] 7. Western blot Take 2×10 6 Whole cell lysates were prepared by adding 200 µL of lysis buffer (formulation: 50 mM HEPES pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 10 mM sodium pyrophosphate, 10 mM sodium β-glycerophosphate, 50 mM NaF, 1.5 mM Na3VO4, 1 mM DTT) and a protease inhibitor mixture (Roche, 11697498001). Lysis was carried out at 4°C for 30 min, followed by centrifugation at 12,000×g for 15 min. The supernatant was collected and added to 5×SDS loading buffer, then boiled at 100°C for 5 min. Proteins were separated by SDS-PAGE and transferred to nitrocellulose or PVDF membranes. The membranes were blocked at room temperature with PBST containing 5% skim milk powder (PBS containing 0.1% Tween-20) for 30 min, then incubated with primary antibody overnight at 4°C, followed by incubation with the corresponding fluorescent secondary antibody at room temperature for 2 h. Signal detection was performed using the ChemiDoc MP gel imaging system (Bio-Rad).

[0060] 8. Cell viability and apoptosis detection Cell viability was assessed using the Cell Counting Kit-8 (CCK-8; Merck, 96992) and Edu staining methods (Edu kits, FineTest®, FNCK110 and FNCK111) according to the manufacturer's instructions. In the CCK-8 assay, cells were cultured at 5 × 10⁶ cells / year. 3 Cells were seeded at a density of 10 cells / well in 96-well plates. After a specified co-culture time or mechanical stress treatment, 10 μL CCK-8 reagent was added to each well, and the plates were incubated at 37°C for 1 hour. Absorbance was measured at 450 nm to assess cell viability. In the Edu staining experiment, after the specified treatment, cells were seeded at a density of 5 × 10⁶ cells / well.5 Cells were seeded at a density of cells / well in 12-well plates and incubated with 10 μmol / L Edu for 24 hours. Subsequently, cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes, permeabilized with 0.3% Triton X-100 (prepared in PBS) at room temperature for 20 minutes, and blocked / washed with 3% BSA (prepared in PBS) (three times, 5 minutes each). For the click reaction, 500 μL of Click reaction solution was applied per well and incubated at room temperature in the dark for 30 minutes. Cell nuclei were counterstained with DAPI. Fluorescence images were acquired using a Leica SP8 fluorescence microscope. The FineTest® 488 Edu kit (FNCK110) was used to label normal cells, and the FineTest® 594 Edu kit (FNCK111) was used to label GFP-tagged cells.

[0061] Apoptosis was assessed by flow cytometry using the Annexin V-FITC / PI apoptosis detection kit. After specified treatment, cells were collected, washed twice with cold PBS, and resuspended in 1× binding buffer. Annexin V-FITC and propidium iodide (PI) were added to the cell suspension, and the cells were incubated at room temperature in the dark for 15 minutes. Apoptotic cells were quantitatively analyzed by flow cytometry within 1 hour to differentiate early apoptotic cells (Annexin V-FITC-...). + / PI - ) and late-stage apoptotic / necrotic cells (Annexin V-FITC) + / PI + ).

[0062] 9. Results Experimental results are as follows Figure 1-4 As shown, compared with the wild-type SMTNL2 overexpression group, the T305D / S344D diphosphorylation mimic mutant (DD) overexpression group showed a significantly increased level of oxidative phosphorylation and a significantly decreased level of glycolysis in nucleus pulposus cells. Figure 1 Simultaneously, the DD mutant significantly upregulated the expression of extracellular matrix synthesis-related genes such as ACAN and COL2A1, and significantly inhibited the expression of matrix-degrading enzymes such as ADAMTS5 and MMP13. Figure 2 It promoted the proliferation of nucleus pulposus cells and inhibited apoptosis. Figure 3-4 The T305A / S344A phosphorylation deletion mutation (AA) group showed the completely opposite effect, indicating that T305 / S344 biphosphorylation of SMTNL2 plays a key activating role in regulating metabolic reprogramming and matrix homeostasis in nucleus pulposus cells.

[0063] Experimental results are as follows Figure 5 and Figure 6The results showed that, compared with the empty vector control group, the intervertebral disc height of mice injected with the AAV6-Smtnl2 (T305D / S344D) double mutant was significantly restored (P<0.01), the nucleus pulposus area increased, the number of nucleus pulposus cells increased significantly, and the Safranin O staining positive area was significantly expanded, indicating the restoration of proteoglycan content. Although the AAV6-Smtnl2 wild-type group and the T305A / S344A phosphorylation deletion group showed some improvement trend, the effect was not as good as the double mutant group, and there was no statistically significant difference between the T305A / S344A group and the empty vector group. This indicates that the T305D / S344D double phosphorylation mimic mutation, delivered intradiscally through AAV6-mediated AAV6, can effectively reverse the mechanical overload-induced intervertebral disc degeneration process and restore the structural and functional integrity of the intervertebral disc.

[0064] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The use of a recombinant adeno-associated virus in the preparation of a drug for treating intervertebral disc degeneration, characterized in that, The recombinant adeno-associated virus carries a nucleic acid sequence encoding a phosphorylated mimic mutant of the SMTNL2 protein; the phosphorylated mimic mutant contains at least a mutation corresponding to a threonine mutation at position 305 of the SMTNL2 protein being changed to aspartic acid and / or a serine mutation at position 344 being changed to aspartic acid.

2. The application according to claim 1, characterized in that, The phosphorylation-simulated mutant is a T305D / S344D phosphorylation-simulated double mutant.

3. The application according to claim 2, characterized in that, The amino acid sequence of the T305D / S344D phosphorylation mimic double mutant is shown in SEQ ID NO.1 and SEQ ID NO.2; or, The nucleic acid sequences encoding the T305D / S344D phosphorylation mimic double mutant are shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. The application according to any one of claims 1-3, characterized in that, The treatment of intervertebral disc degeneration is achieved by delivering the recombinant adeno-associated virus to the nucleus pulposus cells of the intervertebral disc, thereby overexpressing the phosphorylation mimic mutant, which restores the mitochondrial function of the nucleus pulposus cells, restores the metabolic balance between oxidative phosphorylation and glycolysis, reduces cell apoptosis, and increases cell proliferation.

5. The application according to any one of claims 1-3, characterized in that, The recombinant adeno-associated virus also carries an operatively linked promoter, the promoter including at least one of the CAG promoter, CMV promoter, EF1α promoter, and PGK promoter.

6. The application according to any one of claims 1-3, characterized in that, The serotype of the recombinant adeno-associated virus is selected from at least one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and AAVrh10.

7. The application according to any one of claims 1-3, characterized in that, The dosage form of the drug includes at least one of tablets, capsules, granules, powders, oral liquids, suspensions, emulsions, pills, injections, ointments, and creams.

8. The application according to any one of claims 1-3, characterized in that, The intervertebral disc degeneration is classified as Pfirrmann grade 2 or 3.

9. The application according to any one of claims 1-3, characterized in that, The intervertebral disc degeneration includes intervertebral disc degeneration induced by mechanical overload or intervertebral disc degeneration induced by inflammation.

10. The application according to claim 7, characterized in that, The drug is selected from intradiscal injection formulations, and the titer of the recombinant adeno-associated virus is 5 × 10⁻⁶. 12 Virus particles / 0.5 μL.

Images