A T1 nuclear magnetic resonance contrast agent material, its preparation method and application

Abstract

This invention provides the application of manganese-containing magnetic ferritin in the preparation of tumor imaging localization diagnostic reagents. The manganese-containing magnetic ferritin can target and bind abnormally expressed TfR1 / CD71 molecules, showing good application potential in the non-invasive detection of early esophageal cancer and precancerous lesions, and can be used as a T1-type nuclear magnetic resonance molecular probe.

Description

Technical Field

[0001] This invention belongs to the field of biomimetic synthesis technology of magnetic nanomaterials, specifically relating to a tumor-targeting T1 nuclear magnetic resonance contrast agent material, its preparation method and application. Background Technology

[0002] The development of molecular imaging technology has provided important tools for the early diagnosis and precision treatment of tumors. Among them, magnetic resonance imaging (MRI) occupies a central position in clinical diagnosis and treatment due to its high spatial resolution, lack of ionizing radiation, and excellent soft tissue contrast. Unlike traditional structural imaging, molecular probe-based MRI molecular imaging can reflect the molecular and microenvironmental characteristics of tumors at the in vivo level, and has unique advantages in early tumor detection, precise subtyping, and companion diagnosis.

[0003] The outer shell of the magnetic ferritin material is derived from human H subunit ferritin and can specifically recognize transferrin receptor 1 (TfR1 / CD71) highly expressed on the surface of tumor cells, exhibiting good tumor targeting. Simultaneously, its superparamagnetic ferrite core possesses MRI imaging capabilities, making it a natural MRI molecular probe with both targeted recognition and imaging functions. Our previous work has demonstrated that magnetic ferritin can target and bind to early-stage microtumors in animal models and achieve T2-weighted MRI imaging, showing its potential for clinical applications.

[0004] However, the magnetic ferritin with an Fe3O4 core primarily exhibits T2 contrast agent characteristics. Its negative contrast profile is susceptible to artifacts and bleeding during clinical use, potentially reducing diagnostic accuracy. In contrast, T1 contrast agents provide positive enhancement signals and have broader clinical applicability. Therefore, modifying the superparamagnetic core of magnetic ferritin to enhance its T1 contrast agent capability would have greater clinical application value.

[0005] Manganese doping is a feasible strategy to improve the imaging performance of magnetic ferritin T1. Manganese ions (Mn) 2+ ) has high spin d 5 With its electronic configuration and lack of orbital degeneracy, ferritin's large magnetic moment and short electron spin relaxation time effectively enhance proton longitudinal relaxation, thus significantly increasing the r1 value. By manganese doping, the tumor-targeting and biocompatibility advantages of ferritin can be maintained while overcoming its limitations in T1-weighted imaging, thereby promoting the application of magnetic ferritin as a novel MRI molecular probe in tumor diagnosis and treatment. Summary of the Invention

[0006] The main objective of this invention is to provide a tumor-targeting T1 magnetic resonance imaging contrast agent material, its preparation method, and its application.

[0007] To achieve the above objectives, the technical solution of the present invention is implemented as follows:

[0008] On one hand, the present invention provides an application of manganese-containing magnetic ferritin in the preparation of tumor imaging localization diagnostic reagents, wherein the imaging localization diagnostic reagents are selected from nuclear magnetic resonance contrast agents or molecular probes, and the manganese-containing magnetic ferritin is prepared by the following method: synthetic ferritin undergoes biomimetic mineralization to form nanoparticles inside the ferritin, and finally the manganese-containing magnetic ferritin is obtained by separation and purification.

[0009] In one embodiment, the MRI contrast agent is a T1 type MRI contrast agent.

[0010] In one embodiment, the tumor is an esophageal cancer tumor.

[0011] In one embodiment, the dose of the manganese-containing magnetic ferritin does not exceed 20 mg. [金属离子] / Kg [体重] .

[0012] In one embodiment, the dosage of the manganese-containing magnetic ferritin is 20 mg. [金属离子] / Kg [体重] Or 10mg [金属离子] / Kg [体重] .

[0013] In one embodiment, the iron salt solution used in the biomimetic mineralization process is an iron salt solution containing manganese ions.

[0014] In one embodiment, the iron salt solution used in the biomimetic mineralization process is a mixed salt solution of iron ions and manganese ions.

[0015] In one embodiment, the iron ion is a ferrous ion.

[0016] In one embodiment, the manganese ion is a divalent manganese ion (Mn). 2+ ).

[0017] In one embodiment, the iron salt solution used in the biomimetic mineralization process is an iron salt solution containing manganese ions.

[0018] In one embodiment, the iron salt solution containing manganese ions is prepared by mixing iron salt and manganese salt.

[0019] In one embodiment, the mixed salt solution of iron ions and manganese ions is prepared by mixing iron salts and manganese salts.

[0020] In one embodiment, the ferric salt is a ferrous salt. In another embodiment, the ferrous salt is a water-soluble ferrous salt, such as ferrous sulfate, ferrous ammonium sulfate, or ferrous chloride.

[0021] Preferably, the mixed salt solution of iron and manganese ions is a mixed salt solution of ferrous ammonium sulfate and manganese sulfate. The iron salt solution containing manganese ions is a mixed salt solution of ferrous ammonium sulfate and manganese sulfate.

[0022] In one embodiment, the concentration of manganese ions is not higher than 30%, for example, 1.25%-30%, 3%-20%. Preferably, the concentration of manganese ions is less than 30%. Preferably, the concentration of manganese ions is not higher than 20%. Preferably, the concentration of manganese ions is not higher than 15%. Preferably, the concentration of manganese ions is not higher than 10%. Preferably, the concentration of manganese ions is not higher than 5%. Preferably, the concentration of manganese ions is 3%, 5%, 10%, or 20%. Preferably, the concentration of manganese ions is 3%. Preferably, the concentration of manganese ions is 5%. Preferably, the concentration of manganese ions is 10%. Preferably, the concentration of manganese ions is 20%. In one embodiment, the concentration of manganese ions refers to the ratio of manganese ions to metal ions (including iron ions and manganese ions), that is, in an iron salt solution containing manganese ions (or a mixed salt solution of iron ions and manganese ions), the ratio of manganese ions to metal ions (including iron ions and manganese ions). For example, the concentration of manganese ions is 3% or 5%.

[0023] In one embodiment, the actual concentration of manganese ions is not higher than 20%. Preferably, the actual concentration of manganese ions is 1.6%, 5%, or 16.6%. Preferably, the actual concentration of manganese ions is 1.6%.

[0024] In one embodiment, the average particle size of the manganese-containing magnetic ferritin is less than 5 nm. Preferably, the average particle size of the manganese-containing magnetic ferritin is 4-5 nm, 4.5-5 nm, or 4.5-4.8 nm. More preferably, the average particle size of the manganese-containing magnetic ferritin is 4.4, 4.5, 4.7, or 4.8 nm.

[0025] In one embodiment, the manganese-containing magnetic ferritin is obtained through a single biomimetic mineralization process.

[0026] In one embodiment, the biomimetic mineralization process is as follows: An iron salt solution containing manganese ions and an oxidant are added to a ferritin solution for reaction, controlling the pH value to 7-11 and the temperature to 25-90°C, forming nanoparticles within the ferritin; the iron salt solution is added at a rate of 10-200 ions per minute per ferritin molecule, resulting in a theoretical number of metal atoms (including iron and manganese) per protein molecule between 100 and 20,000; the oxidant concentration is such that the ratio of H₂O₂ molecules added each time to the number of metal ion atoms (including iron and manganese) added is 3:1; the protein concentration is ≥0.25 mg / ml; then, the mixture is centrifuged, the precipitate is removed, and the solution is concentrated.

[0027] In one embodiment, the biomimetic mineralization process is as follows: an iron salt solution containing manganese ions and an oxidant are added to a ferritin solution for reaction, with the pH value controlled at 8.5 and the temperature controlled at 65°C, forming nanoparticles inside the ferritin; the iron salt solution is added at a rate of 80 ions per minute per ferritin molecule, and the theoretical number of metal atoms (including iron and manganese) added to each protein molecule is 5000; the concentration of the oxidant is such that the ratio of the number of H2O2 molecules added each time to the number of metal ion atoms (including iron and manganese) added is 3:1; the protein concentration is ≥0.25 mg / ml; then centrifugation is performed, the precipitate is removed, and the solution is concentrated.

[0028] In one embodiment, the ferritin is selected from human ferritin, plant ferritin, or bacterial ferritin.

[0029] In one embodiment, the ferritin is recombinant human ferritin.

[0030] In one embodiment, the recombinant human ferritin includes the H chain of recombinant human ferritin, the L chain of recombinant human ferritin, an assembly of the H chain and L chain of recombinant human ferritin, a mutant or fusion protein of the H chain of recombinant human ferritin, and a mutant or fusion protein of the L chain of recombinant human ferritin.

[0031] In one embodiment, the ferritin includes the H chain of recombinant human ferritin, the L chain of recombinant human ferritin, an assembly of the H chain and L chain of recombinant human ferritin, a mutant or fusion protein of the H chain of recombinant human ferritin, a mutant or fusion protein of the L chain of recombinant human ferritin, recombinant plant ferritin, a mutant of recombinant plant ferritin, a fusion protein of recombinant plant ferritin, bacterial ferritin, a mutant of bacterial ferritin, or a fusion protein of bacterial ferritin.

[0032] In one embodiment, the ferritin is the H chain of recombinant human ferritin.

[0033] In one embodiment, the preparation method comprises the following steps:

[0034] 1) Using recombinant human ferritin as a template, the DNA sequence of human ferritin was cloned and constructed into a plasmid;

[0035] 2) Transform or co-transform bacteria with recombinant plasmids containing human ferritin, add isopropyl-β-D-thiogalactoside to activate the T7 promoter, and induce expression;

[0036] 3) After expression, the protein is broken down by sonication to release it;

[0037] 4) Separate and purify the protein;

[0038] 5) Add an iron salt solution containing manganese ions and an oxidant to the ferritin solution for reaction, controlling the pH value to 7-11 and the temperature to 25-90℃, to form nanoparticles inside the ferritin; the iron salt solution is added at a rate of 10-200 ions per ferritin per minute, and the theoretical number of metal atoms (including iron and manganese) per protein molecule can be between 100 and 20,000; the concentration of the oxidant is 3:1, with the ratio of the number of H2O2 molecules added each time to the number of metal ion atoms (including iron and manganese); the protein concentration is ≥0.25 mg / ml; then centrifuge, remove the precipitate, and concentrate; this step is repeated at least once, for example, once, twice, three times, or four times;

[0039] 6) After purification by molecular sieve, manganese-containing magnetic ferritin was obtained.

[0040] In one embodiment, step 5 is a biomimetic mineralization process, that is, the manganese-containing magnetic ferritin is obtained through a single biomimetic mineralization process.

[0041] In one implementation, after step 1, the coding sequence is sequenced to ensure that it has the correct DNA sequence.

[0042] In one embodiment, in step 2, when the bacteria multiply to an OD value of 0.6-0.8, IPTG is added to activate the T7 promoter, and expression is induced at 30°C.

[0043] In one embodiment, in step 2, when the bacteria multiply to an OD value of 0.7, IPTG is added to activate the T7 promoter, and expression is induced at 30°C.

[0044] In one embodiment, in step 3, the bacteria are resuspended in PBS buffer solution and subjected to ultrasonic disruption to release proteins.

[0045] In one embodiment, in step 2, the bacteria is Escherichia coli.

[0046] In one embodiment, in step 4, proteins are separated using chromatography, ammonium sulfate precipitation, ion exchange, or size exclusion chromatography.

[0047] In one embodiment, step 4 is performed as follows: centrifuge at 4°C, 20000G, for 20 minutes to collect the supernatant; heat the supernatant at 75°C for 20 minutes; centrifuge at 4°C, 20000G, for 20 minutes to collect the supernatant.

[0048] In one embodiment, in step 5, the ferrous salt is a water-soluble ferrous salt: ferrous sulfate, ferrous ammonium sulfate, or ferrous chloride; the oxidant is hydrogen peroxide; and the ferritin solution refers to a 0.5 mg / mL NaCl solution containing ferritin.

[0049] In one embodiment, in step 5, the ferrous salt is ferrous sulfate with a concentration of 50 mM; the oxidant is hydrogen peroxide with a concentration of 16.67 mM.

[0050] In one embodiment, the manganese salt is [value], and its concentration is [value].

[0051] In one embodiment, in step 5, the pH is controlled to be 8 to 8.5; and the temperature is controlled to be 37°C or 65°C.

[0052] In one embodiment, the magnetic nanoparticles formed inside the manganese-containing magnetic ferritin are manganese-containing (Mn) 2+ Fe3O4.

[0053] On the other hand, the present invention provides a nuclear magnetic resonance contrast agent, which is prepared by the above method.

[0054] On the other hand, the present invention provides a manganese-containing magnetic ferritin obtained by the above method.

[0055] In one embodiment, the r1 value of the manganese-containing magnetic ferritin is increased. The r1 value is a core parameter of T1 imaging performance.

[0056] In one embodiment, the manganese-containing magnetic ferritin has a higher r1 value compared to ordinary magnetic ferritin. Preferably, the ordinary magnetic ferritin does not contain manganese.

[0057] In one embodiment, the present invention provides the use of the manganese-containing magnetic ferritin in the preparation of nuclear magnetic resonance contrast agents.

[0058] In one embodiment, the present invention provides the use of the manganese-containing magnetic ferritin in the preparation of T1-type nuclear magnetic resonance contrast agents.

[0059] Beneficial effects of the invention:

[0060] This invention provides a method for preparing manganese-containing magnetic ferritin and its application. The manganese-containing magnetic ferritin can target and bind abnormally expressed TfR1 / CD71 molecules, and has higher contrast and specificity than traditional gadolinium-based contrast agents in the imaging of early cancer lesions. It shows good application potential in the non-invasive detection of early esophageal cancer and precancerous lesions. Attached Figure Description

[0061] Figure 1 This is a characterization of purified ferritin.

[0062] Figure 2 The morphology (a) and particle size statistics (b) of the manganese-doped series samples are shown.

[0063] Figure 3 These are the magnetic test results of manganese-doped series samples. (a) 300K hysteresis loop, (b) 5K hysteresis loop and local magnification, (c) ZFC-FC curve (green dashed line represents ZFC, red solid line represents FC).

[0064] Figure 4 These are the magnetic parameters of the manganese-doped series samples.

[0065] Figure 5 This is the XRD pattern of the mMHFn-5% sample.

[0066] Figure 6 This is an in vivo fluorescence imaging study using a mouse subcutaneous model of glioma U87 cell line. Dosage: 20 mg [金属离子] / Kg [体重] NO.1, NO.2, and NO.3 are three parallel experimental model mice. The images were acquired at time points 0h-24h after the material was injected into the tail vein. The red arrows indicate the tumor locations.

[0067] Figure 7 This is an in vivo fluorescence imaging study using a mouse subcutaneous model of glioma U87 cell line. Dosage: 10mg [金属离子] / Kg [体重] NO.4, NO.5, and NO.6 are three parallel experimental model mice, and the images were acquired at time points 0h-24h after the material was injected into the tail vein.

[0068] Figure 8 These are the fluorescence residues in the major organs of two groups of mice used in in vivo fluorescence imaging experiments, 24 hours after injection of the material. NO.1-3 correspond to a dose of 20mg. [金属离子] / Kg [体重] Dosage group, NO.4-6 corresponding dose 10mg [金属离子] / Kg [体重] Dosage group.

[0069] Figure 9These are the results of H&E staining of cardiac tissue. Control group: NO.1, NO.2, NO.3, administered PBS via tail vein injection; Experimental group: NO.4, NO.5, NO.6, administered 20mg via tail vein injection. [金属离子] / Kg [体重] mMHFn-5% material.

[0070] Figure 10 These are the results of H&E staining of liver tissue. Control group: NO.1, NO.2, NO.3, administered PBS via tail vein; Experimental group: NO.4, NO.5, NO.6, administered 20mg via tail vein. [金属离子] / Kg [体重] mMHFn-5% material.

[0071] Figure 11 These are the results of H&E staining of spleen tissue. Control group: NO.1, NO.2, NO.3, administered PBS via tail vein injection; Experimental group: NO.4, NO.5, NO.6, administered 20mg via tail vein injection. [金属离子] / Kg [体重] mMHFn-5% material.

[0072] Figure 12 These are the results of H&E staining of lung tissue. Control group: NO.1, NO.2, NO.3, administered PBS via tail vein; Experimental group: NO.4, NO.5, NO.6, administered 20mg via tail vein. [金属离子] / Kg [体重] mMHFn-5% material.

[0073] Figure 13 These are the results of H&E staining of kidney tissue. Control group: NO.1, NO.2, NO.3, administered PBS via tail vein injection; Experimental group: NO.4, NO.5, NO.6, administered 20mg via tail vein injection. [金属离子] / Kg [体重] mMHFn-5% material.

[0074] Figure 14 This is the timeline and key time nodes for induction of the C57 mouse orthotopic esophageal cancer model.

[0075] Figure 15 These are the gross and H&E staining results of the esophagus of the model mice. (ac) Gross, H&E staining, and magnified local results of the esophagus of normal mice; (df) Gross, H&E staining, and magnified local results of the esophagus of the ESPL model; (gi) Gross, H&E staining, and magnified local results of the esophagus of the ESCC model.

[0076] Figure 16These are immunohistochemical and magnified results of TfR1 / CD71 in the esophagus of normal mice (a, b), ESPL (c, d), and ESCC (e, f).

[0077] Figure 17 This section presents MRI images, gross specimens, and histopathological findings of mouse Ca266. (a) Images selected from whole-body MRI scans of mice before injection of mMHFn-5% material. (b) Images selected from whole-body MRI scans of mice after injection of mMHFn-5% material, with red arrows indicating lesion locations. (c) Gross morphological observation of the mouse esophagus. (d) High-resolution scans of the entire H&E stained section are shown, with esophageal lesions marked by red boxes, dashed lines indicating low-grade intraepithelial neoplasia, and solid lines indicating high-grade intraepithelial neoplasia. The left side indicates the direction closer to the stomach, and the right side indicates the direction closer to the mouth. Scale bar: 500 μm. (e) TfR1 / CD71 immunohistochemical staining of mouse esophageal tissue, with magnified areas marked by black boxes. Scale bar: 100 μm. (f) Magnified local area of ​​TfR1 / CD71 immunohistochemical staining in mouse esophageal tissue, scale bar: 50 μm. (g) H&E staining of mouse esophageal tissue, with magnified areas marked by black boxes. Scale bar: 100 μm. (h) Magnified H&E staining of mouse esophageal tissue, scale bar: 50 μm.

[0078] Figure 18 This section presents MRI images, gross specimens, and histopathological findings of mice designated Ca322. (a) Images selected from whole-body MRI scans of mice before injection of mMHFn-5% material. (b) Images selected from whole-body MRI scans of mice after injection of mMHFn-5% material, with red arrows indicating lesion locations. (c) Gross morphological observation of the mouse esophagus. (d) High-resolution scans of the entire H&E stained section are shown, with esophageal lesions marked in red boxes, low-grade intraepithelial neoplasia indicated by dashed lines, and high-grade intraepithelial neoplasia by solid lines. The left side indicates the direction closer to the stomach, and the right side indicates the direction closer to the mouth. Scale bar: 1 mm. (e) TFR1 / CD71 immunohistochemical staining of mouse esophageal tissue, with magnified areas marked by black boxes. Scale bar: 100 μm. (f) Magnified local area of ​​TFR1 / CD71 immunohistochemical staining of mouse esophageal tissue, scale bar: 50 μm. (g) H&E staining of mouse esophageal tissue, with magnified areas marked by black boxes. Scale bar: 100 μm. (h) Magnified local H&E staining of mouse esophageal tissue, scale bar: 50 μm.

[0079] Figure 19This section presents MRI images, gross specimens, and histopathological findings of mouse Ca326. (a) Images selected from whole-body MRI scans of mice before injection of mMHFn-5% material. (b) Images selected from whole-body MRI scans of mice after injection of mMHFn-5% material, with red arrows indicating lesion locations. (c) Gross morphological observation of the mouse esophagus. (d) High-resolution scans of the entire H&E stained section are shown, with esophageal lesions marked in red boxes, low-grade intraepithelial neoplasia indicated by dashed lines, and high-grade intraepithelial neoplasia by solid lines. The left side is closer to the mouth, and the right side is closer to the stomach. Scale bar: 1 mm. (e) TFR1 / CD71 immunohistochemical staining of mouse esophageal tissue, with magnified areas marked by black boxes. Scale bar: 100 μm. (f) Magnified local area of ​​TFR1 / CD71 immunohistochemical staining of mouse esophageal tissue, scale bar: 50 μm. (g) H&E staining of mouse esophageal tissue, with magnified areas marked by black boxes. Scale bar: 100 μm. (h) Magnified local H&E staining of mouse esophageal tissue, scale bar: 50 μm.

[0080] Figure 20 This section presents MRI images, gross specimens, and histopathological findings of mice designated Ca332. (a) Images selected from whole-body MRI scans of mice before injection of mMHFn-5% material. (b) Images selected from whole-body MRI scans of mice after injection of mMHFn-5% material, with red arrows indicating lesion locations. (c) Gross morphological observation of the mouse esophagus. (d) High-resolution scans of the entire H&E stained section are shown, with esophageal lesions marked in red boxes, low-grade intraepithelial neoplasia indicated by dashed lines, and high-grade intraepithelial neoplasia by solid lines. The left side indicates the direction closer to the stomach, and the right side indicates the direction closer to the mouth. Scale bar: 500 μm. (e) TFR1 / CD71 immunohistochemical staining of mouse esophageal tissue, with magnified areas marked by black boxes. Scale bar: 100 μm. (f) Magnified local area of ​​TFR1 / CD71 immunohistochemical staining of mouse esophageal tissue, scale bar: 50 μm. (g) H&E staining of mouse esophageal tissue, with magnified areas marked by black boxes. Scale bar: 100 μm. (h) Magnified local H&E staining of mouse esophageal tissue, scale bar: 50 μm.

[0081] Figure 21This section presents MRI images, gross specimens, and histopathological findings of mouse Ca331. (a) Images selected from a whole-body MRI scan of the mouse before injection of Magendie (Gd-DTPA). (b) Images selected from a whole-body MRI scan of the mouse 5 minutes after Gd-DTPA injection. (c) Gross morphological observation of the mouse esophagus. (d) High-resolution scans of the entire H&E stained section are shown, with esophageal lesions marked in red boxes, low-grade intraepithelial neoplasia indicated by dashed lines, and high-grade intraepithelial neoplasia indicated by solid lines. The left side is closer to the mouth, and the right side is closer to the stomach. Scale bar: 1 mm. (e) TFR1 / CD71 immunohistochemical staining of mouse esophageal tissue, with magnified areas marked in black boxes. Scale bar: 100 μm. (f) Magnified local area of ​​TFR1 / CD71 immunohistochemical staining of mouse esophageal tissue, scale bar: 50 μm. (g) H&E staining of mouse esophageal tissue, with magnified areas marked in black boxes. Scale bar: 100 μm. (h) Magnified local H&E staining of mouse esophageal tissue, scale bar: 50 μm. Detailed Implementation

[0082] To make the objectives, technical solutions, and advantages of this application clearer, the application will be further described in detail below with reference to the accompanying drawings. The described embodiments should not be regarded as limitations on this application. All other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0083] Example 1: Synthesis of manganese-containing magnetic ferritin

[0084] 1. Expression (shake method) and purification of recombinant human H subunit ferritin

[0085] The sequence and preparation method of recombinant human H subunit ferritin (HFn) in this embodiment are the same as those of ferritin in patent CN120887969A; the Escherichia coli expression strain used in this embodiment is the same as that in patent CCN120887969A.

[0086] The ferritin in this embodiment is the H chain of recombinant human ferritin, and its DNA sequence is shown in SEQ ID No. 1, while its amino acid sequence is shown in SEQ ID No. 2. In addition, ferritin can also be the L chain of recombinant human ferritin, an assembly of the H and L chains of recombinant human ferritin, plant ferritin, bacterial ferritin, etc.

[0087] The DNA sequence (SEQ ID No. 1) of ferritin (recombinant human ferritin H chain) in this embodiment:

[0088] CCATGGCATGTGAGCGGTACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCCTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCGATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCCGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAAGGATCCGCGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATATCCCGCAAGAGGCCCGGCAGTACCGGCATAACCAAGCCTATGCCTACAGCATCCAGGGTGACGGTGCCGAGGATGACGATGAGCGCATTGTTAGATTTCATACACGGTGCCTGACTGCGTTAGCAATTTAACTGTGAT;

[0089] The amino acid sequence of ferritin (recombinant human ferritin H chain) in this embodiment (SEQ ID No.2):

[0090] MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES*.

[0091] (1) Activate ferritin-expressing Escherichia coli by streaking three zones on LB solid plates (containing ampicillin); pick single clones and transfer them to 4 ml of liquid LB medium (with ampicillin) and culture for 8-10 h to the logarithmic phase; transfer them to 200 ml of liquid LB medium (with ampicillin) at a 1% inoculum and culture for 8-10 h to the logarithmic phase; transfer them to 500 ml of liquid LB medium (with ampicillin) at a 4% inoculum and when the expression strain grows to an OD value of 0.6-0.8, add a final concentration of 1 mM IPTG (isopropyl-β-D-thiogalactoside) to induce expression and induce at 30℃ for 12-14 h.

[0092] (2) Centrifuge at 4℃, 8000rpm, 6min to collect bacterial cells and resuspend them in PBS; centrifuge again to wash the bacterial cells, repeating twice; finally, resuspend the bacterial cells in PBS solution.

[0093] (3) Add 1mM EDTA (pH 8.0) and 100μg / ml lysozyme to the bacterial cells and incubate at 37℃ for 1 hour to dissolve the cell wall; use ultrasound to break the cells, centrifuge at 4℃, 20000G for 20 min to collect the supernatant.

[0094] (4) Heat the supernatant at 75°C for 20 min to remove impurities and protein. Centrifuge at 4°C, 20000G for 20 min to collect the supernatant.

[0095] (5) The supernatant was sterilized by filtration through a 0.22 μm filter membrane and stored at 4 °C.

[0096] Glyceryl Escherichia coli culture stored at -80℃ was used to isolate single colonies by streaking on solid LB medium containing Amp in three zones and incubating at 37℃. Single colonies were then inoculated into liquid LB medium containing Amp and cultured overnight at 37℃-200rpm. The resulting culture was then inoculated into liquid LB medium containing Amp in Erlenmeyer flasks at 37℃-200rpm with an inoculation rate of 4%. When OD600 reached 0.6, 0.5 mM IPTG was added, and expression was induced for 8 h at 30℃-200rpm. Cells were collected by centrifugation (4℃, 8000g, 10 min) and washed twice with PBS buffer. Cells were then sonicated (200W, 5s on, 5s off, 15 min, ice bath). The cells were heat-treated at 75℃ for 20 min to remove contaminating proteins, and the supernatant was collected by centrifugation (12,000g, 20 min). Molecular sieve purification (packing material model: HW-55F), collection of target protein, ultrafiltration concentration, sterilization by filtration and storage at 4℃. SDS-PAGE to verify purity (target band ~21kDa), DLS and negative staining electron microscopy to characterize the morphological integrity of ferritin, and BCA method to quantify ferritin concentration.

[0097] 2. Biomimetic mineralization of manganese-doped magnetic ferritin

[0098] Prepare a solution of 25 mM ferrous ammonium sulfate, 25 mM manganese sulfate, 8.33 mM H₂O₂, and 100 mM NaOH using deoxygenated water. Prepare 50 ml solutions of ferrous ammonium sulfate with different concentrations of manganese (0%, 5%, 10%, and 20% doping; for example, 45 ml of 25 mM ferrous ammonium sulfate plus 5 ml of 25 mM manganese sulfate equals 10% manganese doping), thus creating a metal ion mixture. Displace the purified HFn into a 0.1 M sodium chloride solution, determine the protein concentration using the BCA method, dilute the HFn to 0.5 mg / ml with 0.1 M sodium chloride solution, deoxygenate, and transfer to an anaerobic glove box. 50 ml of a 0.5 mg / ml HFn solution was transferred to a 100 ml reaction vessel. The protein solution was maintained at 65°C using a precisely temperature-controlled heating mantle (accuracy ±1°C). A titrator was used to control the pH and addition rate, stabilizing the pH at 8.5. The addition rates of the metal ion mixture and H₂O₂ were kept constant. The addition rate of the metal mixture was set at 50 metal ions per HFn molecule per minute, and the reaction endpoint was precisely controlled according to a dosage of 3000 metal atoms per HFn molecule. The proportions of manganese in the metal element mixture were 0%, 5%, 10%, and 20%, respectively. After addition, the mixture was stirred for 10 min, then 200 μL of 1 M sodium citrate solution was added to chelate the free metal ions, ending the reaction. The resulting sample was centrifuged at 10000g for 20 min to remove the precipitate, concentrated, and then purified using molecular sieves to remove polymer particles, yielding a manganese-doped magnetic ferritin material with an intact protein shell and monodispersity. The anaerobic environment was strictly controlled during the material synthesis process.

[0099] 3. Characterization of the elements, structure, particle size and morphology of manganese-doped magnetic ferritin

[0100] 50 μL of purified manganese-doped magnetic ferritin sample was placed in a polytetrafluoroethylene digestion vessel, 1 mL of nitric acid was added, and the mixture was heated to 180 °C on a hot plate until only one drop of liquid remained. Another 1 mL of nitric acid was added, and this process was repeated twice. After cooling, the volume was adjusted to 1 mL with 1 M nitric acid. The resulting solution was filtered through a 0.22 μm filter membrane before testing. Before testing, the sample needed to be appropriately diluted to fall within the concentration range of the standard curve. The concentrations of Mn and Fe in the solution were determined using inductively coupled plasma optical emission spectrometry (ICP-OES). Calibration curves were plotted using the corresponding standard solutions, and the molar ratio of Mn to Fe in the material was calculated based on the measured concentrations.

[0101] The dried and purified manganese-doped magnetic ferritin nanomaterials were ground uniformly. An appropriate amount of sample was spread on the sample stage, and the surface was flattened as much as possible to reduce orientation effects. Powder X-ray diffraction (XRD) was performed using Cu Kα radiation (λ=1.5406Å), with a tube voltage of 40 kV and a tube current of 40 mA. The scanning range was set to 10°–80° (2θ), with a step size of 0.02° and a scanning rate of 2° / min. The obtained diffraction patterns were analyzed by comparing them with a PDF database to determine the phase composition of the sample, and the crystal structure of the material was determined by combining peak positions and relative intensities.

[0102] The microstructure and high-resolution crystal structure of manganese-doped magnetic ferritin were characterized by transmission electron microscopy, and the particle size was statistically analyzed. 5 μl of desalted sample (concentration 0.1-0.2 mg / mL) was dropped onto an ultrathin carbon film copper grid, allowed to air dry, and then observed using a transmission electron microscope (JEOL JEM-2100) with an accelerating voltage of 200 kV.

[0103] The microscopic morphology of ferritin needs to be negatively stained before it can be observed under a transmission electron microscope. After the purified ferritin sample is dropped onto a carbon film copper grid and dried, 5 μL of 1% uranium acetate is added for negative staining for 1 minute. Then, excess uranium acetate is absorbed from the edge of the copper grid with filter paper. After the copper grid dries, it is observed at 100 kV.

[0104] 4. Characterization of magnetic parameters of manganese-doped magnetic ferritin

[0105] Manganese-doped magnetic ferritin samples were desalted using a desalting column and then freeze-dried for 24 hours to obtain lyophilized powder samples. The lyophilized samples were then encapsulated in non-magnetic capsules, and their masses were accurately weighed and recorded. Magnetic parameter measurements were performed on a Quantum Design MPMS XP-5 low-temperature magnetic measurement system with a sensitivity of 5.0 × 10⁻⁶. -10 Am2 The following magnetic parameters were measured for this series of samples:

[0106] (1) Measure the hysteresis loop of the sample at 5K and 300K, with a measurement range of ±3.0T. The hysteresis loop can reflect the magnetic parameters such as the saturation magnetization (Ms) and coercivity (Bc) of the magnetic particles.

[0107] (2) Remanence was obtained under an external field of 1.5 mT, and the thermal demagnetization curves from 5 to 300 K were measured. The sample was first cooled to 5 K under zero field, then magnetized with a field of 1.5 mT. After the external magnetic field was removed, the thermal demagnetization curves from 5 to 300 K (zero field cooling ZFC curve) were measured. Then, the same sample was cooled to 5 K under an external magnetic field of 1.5 mT, the external magnetic field was removed, and the thermal demagnetization curves from 5 to 300 K (field cooling FC curve) were measured. The temperature corresponding to the maximum value of ZFC is the average deresisting temperature Tb of the sample, and the intersection of the ZFC and FC curves corresponds to the maximum deresisting temperature T of the sample. max .

[0108] (3) The isothermal remanence (IRM) curve and DC demagnetization curve (DCD) were measured at 5K. The sample was cooled from room temperature (300K) to 5K with zero field, and then the external field was gradually increased. After the external field was removed, the remanence of the sample was measured to obtain the IRM curve. After obtaining the remanence at the maximum field, the reverse DC demagnetization field was gradually increased, and the remanence of the sample was measured to obtain the DCD curve. The ordinate of the intersection of the normalized DCD and IRM curves can reflect the magnetic interaction between the sample particles.

[0109] 5. NMR characterization of manganese-doped magnetic ferritin

[0110] To evaluate the nuclear magnetic resonance (NMR) performance of manganese-doped magnetic ferritin nanomaterials, relaxation parameters were measured using a GE clinical magnetic resonance imaging system (3T magnetic field strength) at the Cancer Hospital of the Chinese Academy of Medical Sciences and a uMR890 (United Imaging Healthcare) clinical magnetic resonance imaging system (3T magnetic field strength) at the Beijing United Imaging Intelligent Imaging Technology Research Institute. Before testing, the total metal ion concentration of the samples was determined using ICP-OES, and the samples were diluted in a concentration gradient of 0.8 mM, 0.4 mM, 0.2 mM, 0.1 mM, and 0.05 mM. The samples were placed in 2 mL polypropylene centrifuge tubes, placed in a non-magnetic sample rack, and allowed to equilibrate at room temperature for 30 min before testing.

[0111] GE MRI imaging platform: The longitudinal relaxation time (T1) and transverse relaxation time (T2) of the material were determined using a cranial phased array coil and Brain MAGiC sequence. Specific scanning parameters were as follows: T1 repetition time (TR) was set to 500 ms, echo time (TE) was set to 10 ms, with one echo point acquired, slice thickness 1 mm, field of view (FOV) of 24 cm × 24 cm, and matrix size 320 × 256; T2 repetition time (TR) was set to 4500 ms, shortest echo time (TE) was set to 100 ms, with one echo point acquired; slice thickness 1 mm, field of view (FOV) of 24 cm × 24 cm, and matrix size 320 × 256. The raw images were analyzed using the system's built-in workstation, and fitted curves were used to obtain the T1 and T2 values ​​of the sample. The relaxation rates r1 and r2 (r1 = 1 / T1·c) were further calculated. -1 r2=1 / T2·c -1 (where c is the molar concentration of metal ions), and the slope is obtained by linear fitting, which is the corresponding r1 and r2 values.

[0112] United Imaging MRI platform: Longitudinal relaxation time (T1) was determined using GRE-MAPs sequence, and transverse relaxation time (T2) was determined using SE-ME sequence. Specific scanning parameters were as follows: T1 repetition time (TR) was set to 20 ms, echo time (TE) was set to 4.77 ms, a total of 4 echo points were acquired, slice thickness was 3 mm, field of view (FOV) was 17.6 cm × 7.5 cm, and matrix size was 384 × 384; T2 repetition time (TR) was set to 1126 ms, shortest echo time (TE) was set to 15.24 ms, a total of 5 echo points were acquired, slice thickness was 3 mm, field of view (FOV) was 17.6 cm × 7.5 cm, and matrix size was 320 × 320. The raw images were analyzed by the system's built-in workstation, and fitted curves were used to obtain the T1 and T2 values ​​of the samples, and r1 and r2 values ​​were further calculated.

[0113] 6. Experimental Results

[0114] (1) Preparation of ferritin

[0115] SDS-PAGE results are as follows Figure 1 As shown in the figure, the purified ferritin band was single, and the protein purity was over 90%.

[0116] (2) Biomimetic synthesis of manganese-doped magnetic ferritin and characterization of its elemental composition, particle size and morphology

[0117] The biomimetic mineralization doping method in this embodiment refers to the article (Enhanced peroxidase activity and tumor tissue visualization by cobalt-doped magnetoferritin nanoparticles, published on January 27, 2017). A 50 ml initial mineralization reaction system was used. Divalent manganese ions were added to the biomimetic mineralization system at molar ratios of 0%, 5%, 10%, and 20% of the total metal ion concentration, respectively. The added volume was controlled according to a chemical dosage of 3000 metal atoms per ferritin molecule. The pH was strictly controlled at 8.5 and an anaerobic environment was maintained throughout the process. A series of manganese-doped magnetic ferritin samples were obtained, named MHFn, mMHFn-5%, mMHFn-10%, and mMHFn-20%, respectively. The obtained series of samples were separated and purified by centrifugation (20000 g, 20 min), gel filtration chromatography (packing material: HW-55F), ultrafiltration concentration, and sterilization before storage at 4°C for subsequent testing and experiments.

[0118] The metal element composition of the manganese-doped magnetic ferritin series samples was analyzed by inductively coupled plasma optical emission spectrometry (ICP-OES). The results are shown in Table 1. Ferritin absorbs iron ions at a rate greater than that of manganese ions. The actual amount of manganese incorporated into the four groups of samples MHFn, mMHFn-5%, mMHFn-10%, and mMHFn-20% was lower than the manganese content in the reaction system, which were 0%, 1.6%, 5%, and 16.6%, respectively.

[0119] Table 1. Manganese content of manganese-doped samples

[0120]

[0121] Transmission electron microscopy results showed that the four groups of samples purified by molecular sieves exhibited good dispersibility. Figure 2 a). Particle size statistics show that, under this mineralization reaction system, manganese doping has little effect on the core size of the material. The average particle sizes of the magnetic cores are 4.6±1.0 nm, 4.4±0.9 nm, 4.5±0.9 nm, and 4.7±0.8 nm, respectively. Figure 2 (b, Table 2). High-resolution electron microscopy revealed lattice fringes in all four samples, indicating good crystallinity of the material.

[0122] (3) Magnetic parameter results of manganese-doped magnetic ferritin series samples

[0123] Magnetic parameters of manganese-doped samples MHFn, mMHFn-5%, mMHFn-10%, and mMHFn-20% were measured to investigate the effect of manganese doping on the magnetic properties of magnetic ferritin materials. The 300K hysteresis loop passes through the origin. Figure 3 a) This indicates that all four samples are superparamagnetic materials at room temperature. The saturation magnetization at 300 K is 6.6 emu / g, 6.5 emu / g, 7.8 emu / g, and 4.0 emu / g, respectively (Table 2). The doping of manganese shows a dual effect on the saturation magnetization. As the proportion of manganese added increases, the saturation magnetization first increases slightly and then decreases. This may be related to the enhanced local exchange interaction after manganese doping, which temporarily improves the order of magnetic moments; however, excessive doping enhances the antiferromagnetic interaction between manganese and iron and the lattice distortion, leading to a decrease in saturation magnetization.

[0124] Low-temperature magnetic tests revealed that, with increasing manganese content in the material core, the coercivity at 5K initially decreased and then increased, with values ​​of 15.1 mT, 9.9 mT, 4.6 mT, and 13.9 mT respectively (Table 2), assuming similar particle sizes. This initial decrease followed by an increase suggests that a small amount of manganese incorporation may weaken the exchange coupling between particles, making them more susceptible to magnetization reversal and resulting in lower coercivity. However, a high manganese content may introduce more lattice defects and local magnetic interactions, leading to an increase in coercivity. The effect of manganese incorporation on the saturation magnetization at 5K was similar to that at 300K, initially increasing slightly and then decreasing. Figure 3 (b, Table 2) further verified the dual effect of manganese doping on saturation magnetization.

[0125] The ZFC-FC curve results show that manganese doping has little effect on the average deblocking temperature, which remains at 11.1 K. Figure 3 c) indicates that the particle size and overall anisotropic energy did not change significantly after manganese incorporation, a conclusion consistent with the statistical results of the average particle size obtained from transmission electron microscopy. However, as the manganese content increased, the curve closure temperature gradually decreased to 91.8 K, 65.1 K, 41.3 K, and 29.3 K (Table 2), indicating a decrease in the maximum unblocking temperature. This phenomenon suggests that the proportion of high-barrier components in the material decreased, and the magnetic barrier distribution range narrowed. This implies that although the introduction of manganese does not change the average properties of the main particle group, it weakens the magnetic order in some local regions, thereby reducing the overall magnetic stability of the system. As a potential nuclear magnetic resonance contrast agent, reduced magnetic stability means a more uniform magnetic response, which can reduce the difference in magnetic hysteresis between particles and improve the controllability of the relaxation effect.

[0126] Table 2. Magnetic parameters of manganese-doped series samples

[0127]

[0128] (4) Results of NMR parameters of manganese-doped magnetic ferritin series samples

[0129] The MRI performance of a series of samples was tested under a 3T magnetic field condition on the GE MRI system. The results are shown in Table 3 and... Figure 4 As shown: the longitudinal relaxation rate r1, a core parameter reflecting the performance of T1-weighted nuclear magnetic resonance imaging, is 2.0, 3.0, 2.3, and 2.0, respectively. It first increases and then decreases with increasing manganese content in the material's core, with the mMHFn-5% group showing the highest r1 value, reaching 3.0 mM. -1 S -1 The MHFn level was 50% higher than that of the undoped manganese magnetic ferritin sample, approaching the longitudinal relaxation rate level (r1=4.4mM) of the clinical gadolinium-based contrast agent Magenvitol (Gd-DTPA). -1 S -1 The r2 value of the mMHFn-5% sample also increased compared to MHFn, but r2 / r1 < 10, indicating that mMHFn-5% is still a T1-dominant contrast agent. Subsequent experiments were conducted using samples from the 5% manganese-doped experimental group.

[0130] Table 3. NMR parameters of manganese-doped series samples

[0131]

[0132] (5) Crystal structure analysis of manganese-doped magnetic ferritin mMHFn-5%

[0133] mMHFn-5% is the material with the highest r1 value among the series of manganese-doped materials. The structure of the material was analyzed by X-ray diffraction (XRD) technology. Figure 5 The XRD pattern and Rietveld full-spectrum fitting results of the mMHFn-5% sample are presented. All diffraction peaks of the sample can be attributed to an inverse spinel structure with the Fd-3m space group, corresponding to the standard Fe3O4 phase (PDF#74-0748). Its main diffraction peaks are located at 2-θ≈18.4°, 30.2°, 35.6°, 43.3°, 57.2° and 62.8°, corresponding to the (111), (022), (113), (004), (115) and (044) crystal planes, respectively. No MnO, Fe2O3 or other impurity phase diffraction peaks were detected, indicating that the sample maintains a single inverse spinel structure, and the introduction of manganese forms a homogeneous solid solution without phase separation.

[0134] Therefore, in terms of structure and morphology, transmission electron microscopy and particle size statistics show that manganese doping did not significantly change the average size (approximately 4-5 nm) of the ferritin mineralized core, and the particles maintained good monodispersity. This is consistent with the fact that the average unblocking temperature revealed by the ZFC-FC curve remains basically unchanged, indicating that the magnetic anisotropy energy of the dominant particle population is not significantly affected. Regarding magnetic properties, manganese doping exhibits a typical "dual effect": with increasing manganese doping ratio, the saturation magnetization first slightly increases and then significantly decreases, while the coercivity first decreases and then increases. These changes in magnetic parameters, combined with the XRD single spinel structure peak diagram, indicate that manganese is incorporated into the lattice of the magnetic ferritin magnetite core. In terms of nuclear magnetic resonance imaging performance, manganese doping significantly affects the longitudinal relaxation rate r1: r1 reaches its highest value (3.0 mM) at a low doping ratio (mMHFn-5%). -1 s -1 The manganese doping concentration (r1) was approximately 50% higher than that of undoped materials, and the r2 / r1 ratio was less than 10, exhibiting typical T1 contrast characteristics, approaching the level of clinically used gadolinium-based contrast agents. However, as the manganese doping ratio continued to increase, r1 decreased, while the r2 / r1 ratio increased, showing a trend towards becoming a T2 contrast agent. This indicates that there is an optimal range for manganese doping; excessive doping disrupts lattice order and weakens the T1 enhancement effect. In the mMHFn-5% sample, the introduction of a small amount of manganese significantly improved r1 while maintaining a low r2 / r1 ratio without significantly increasing saturation magnetization. It is speculated that manganese mainly exerts its effect through a surface-site-dominated T1 relaxation pathway: firstly, Mn... 2+ Firstly, the formation of hydrated coordination centers on the particle surface increases the coordination number of inner spheres and water accessibility, thus strongly contributing to T1. Secondly, the increase in defects and strain increases the surface -OH and outer sphere water content, further promoting T1.

[0135] Example 2: In vivo distribution, metabolism and safety study of manganese-doped magnetic ferritin

[0136] This example describes the histological changes and potential toxic reactions of manganese-doped magnetic ferritin mMHFn-5% in vivo.

[0137] 1. Manganese-doped magnetic ferritin labeling of fluorescent molecules

[0138] Prepare the following solutions: 1M sodium bicarbonate solution, 25mM Tris-HCl solution (pH 8.0), and DMSO solution containing 2 mg / ml Cy5.5 fluorescent molecules. Replace the magnetic ferritin material with PBS buffer and ligate it according to the following system: 430 μL of magnetic ferritin (approximately 1.5 mg), 50 μL of 1M sodium bicarbonate solution, and 20 μL of Cy5.5. Ligate at 4°C in the dark for approximately 12 hours. Terminate the reaction by adding 500 μL of 25mM Tris-HCl solution and allowing it to stand at room temperature for 2 hours. Scale up or down the reaction system proportionally as needed. Finally, separate the free fluorescent molecules in the solution using a PD-10 desalting column, and simultaneously replace the Cy5.5-labeled material with PBS buffer, filter through a 0.22 μm filter membrane, and temporarily store at 4°C in the dark. Measure the iron concentration and calculate the subsequent injection dose, referring to the article (Targeted invivo imaging of microscopic tumors with ferritin-based nanoprobes across biological barriers, published in 2014), and administer 20 mg of the ferritin-labeled material. [金属离子] / Kg [体重] and 10mg [金属离子] / Kg [体重] The material was injected via tail vein, and images were acquired at 0, 0.5h, 1h, 2h, 4h, 6h, and 24h after injection. After acquiring images at the 24h time point, mice were euthanized by cervical dislocation, and the major organs were dissected and scanned for organ fluorescence images.

[0139] 2. Construction of a human glioma subcutaneous transplantation model in nude mice

[0140] Human glioma U87 cells were cultured and, in an SPF-grade animal laboratory, 100 μL of cells were seeded into the hindquarters of 4-week-old BALB / c nude mice with thymus deficiency (T lymphocyte absence) using a sterile syringe. The cell seeding volume was 8 × 10⁶ cells / mL. 7 Cells. Approximately 2-3 weeks after inoculation, when the tumor diameter reaches approximately 3-5 mm, in vivo imaging experiments are performed.

[0141] 3. In vivo fluorescence imaging of mouse tumor models

[0142] In vivo fluorescence imaging of a mouse tumor model was performed using the CRI-Mestro2 multispectral fluorescence small animal in vivo imaging system. Fluorescent molecule material was injected into the animals via tail vein injection at the designed dose. For Cy5.5 fluorescent molecules, the excitation and emission wavelengths were selected according to the instrument's program. The focus was first adjusted under low light, with an exposure time of approximately 5-6 seconds. Bright-field images were saved first, followed by fluorescence imaging in fluorescence mode. Images were acquired at 0, 0.5h, 1h, 2h, 4h, 6h, and 24h after material injection. After acquiring images at 24h, the mice were euthanized by cervical dislocation, and the major organs were dissected and their fluorescence images scanned.

[0143] 4. Mouse heart perfusion and tissue sampling

[0144] (1) Anesthesia and fixation

[0145] Mice were deeply anesthetized using ethically approved methods until they showed no foot reflexes (commonly determined by no response to toe clamping). The mice were then placed supine on the operating table, their limbs were secured with tape, and their skin was disinfected.

[0146] (2) Opening the chest and exposing the heart

[0147] Use scissors / scalpel to make an incision along the midline of the sternum to open the thoracic cavity (longitudinal or bilateral intercostal incision). Carefully separate the sternum or intercostal spaces to expose the heart and major blood vessels. Immediately prepare the outflow vent: make a small incision in the right atrium or right atrial appendage with dissecting scissors to facilitate outflow.

[0148] (3) Insertion and irrigation

[0149] Using a 20–25G needle (or a suitable perfusion needle) connected to a syringe or perfusion pump, insert the needle obliquely into the left ventricular cavity from the apex of the left ventricle, close to the aorta (with the needle tip pointing towards the aortic arch). Secure the needle to prevent slippage. First, perfuse the blood with room temperature PBS: recommended volume 30–50 mL PBS (adult mice), perfusion rate approximately 5–10 mL / min. Observe the liver color change from dark red to light red and the reflux fluid become clear, indicating that the blood has been adequately flushed. Immediately switch to 4% paraformaldehyde fixative and perfuse approximately 20 mL (or until neck / limb stiffness). Perfusion rate as above. During the perfusion of fixative, gradual stiffening of the entire body muscles can be observed.

[0150] (4) Stop the perfusion and dissect to obtain samples.

[0151] After completing the paraformaldehyde perfusion, the target tissue (such as heart, liver, kidney, spleen, lung, tumor) along with the surrounding tissue was completely removed and fixed in 4% paraformaldehyde at 4°C overnight.

[0152] (5) Cleaning and waste liquid treatment

[0153] After the irrigation is completed, the worktable is rinsed with plenty of tap water, and the paraformaldehyde waste liquid is centrally recycled according to the hazardous waste treatment process. Sharp instruments such as knives and needles are disposed of as biohazards.

[0154] 5. Paraffin-embedded tissue and sections

[0155] (1) Tissue fixation and dehydration

[0156] After fixation via cardiac perfusion, the target tissue was removed and post-fixed overnight in 4% paraformaldehyde at 4°C. The tissue was rinsed with tap water for 30 minutes to remove excess fixative. The tissue was then dehydrated sequentially in a gradient of ethanol: 70% ethanol for 2 hours, 80% ethanol for 2 hours, 90% ethanol for 2 hours, 95% ethanol for 1 hour, 95% ethanol for 1 hour, 100% ethanol for 1 hour, and 100% ethanol for 1 hour.

[0157] (2) Transparent

[0158] Transparent tissues were placed in xylene: xylene I: 30 min, xylene II: 30 min.

[0159] (3) Paraffin impregnation and embedding

[0160] The tissue was thoroughly impregnated in molten paraffin (approximately 60°C): Paraffin I, 1 h; Paraffin II, 1 h; Paraffin III, 1 h. The thoroughly impregnated tissue was then placed in a preheated paraffin embedding cassette, its orientation adjusted, and rapidly cooled to room temperature for solidification.

[0161] (4) Slicing

[0162] Trim the paraffin blocks and section them using a paraffin microtome. The standard histological thickness is 4–6 μm, and the immunohistochemical thickness is 3–5 μm. Unfold the sections in a 40–45°C water bath and then adhere them to a glass slide coated with poly-L-lysine. Incubate the slides overnight at 37–42°C or bake them in a 60°C oven for 1–2 hours to ensure firm tissue adhesion. The sections can be used for hematoxylin-eosin (H&E) staining and immunohistochemical (IHC) staining.

[0163] 6. HE staining of paraffin sections

[0164] (1) Dewaxing and rehydration of tissue sections

[0165] Place room temperature paraffin sections (4-5µm) in a 60℃ oven for 30-60 min to enhance tissue adhesion. Dewax and rehydrate the sections according to the following procedure: xylene I, 10 min; xylene II, 10 min; 100% ethanol, 5 min; 100% ethanol, 5 min; 95% ethanol, 5 min; 80% ethanol, 5 min; 70% ethanol, 5 min; rinse with running water for 5 min until neutral.

[0166] (2) Hematoxylin & Eosin (H&E) staining

[0167] After rehydration, the sections are stained in hematoxylin solution for 4-8 minutes, and then rinsed with running tap water for about 5 minutes. The sections are then stained in eosin solution for 1-3 minutes, rinsed quickly with running water for 30 seconds, and excess solution is removed.

[0168] (3) Dehydration and clearing process

[0169] Dehydration and clearing were performed according to the following procedure: 70% ethanol for 1 min, 80% ethanol for 1 min, 95% ethanol for 1 min, 100% ethanol for 2 min, 100% ethanol for 2 min, xylene for 5 min, xylene for 5 min.

[0170] (4) Sealing and observation

[0171] The tablet was sealed with a mounting medium and allowed to cure at room temperature. It was then observed and photographed under a microscope.

[0172] 7. Experimental Results

[0173] (1) Enrichment characteristics of mMHFn-5% material at tumor sites

[0174] The results are as follows Figure 6-8 As shown, according to 20mg [金属离子] / Kg [体重] The material was injected via the tail vein at a specific dose. 0.5 hours after injection, the fluorescence signal at the tumor site began to slightly increase; 1 hour after injection, the fluorescence signal at the tumor site significantly increased; and within 24 hours after injection, the fluorescence signal at the tumor site did not decrease and remained in a state of continuous enhancement. Figure 6 (Indicated by the red arrow). The mice in this group were euthanized 24 hours later. Upon dissection of the tumor, strong residual fluorescence signals were found within the tumor. Figure 8 (NO.1, NO.2, NO.3). Reduce the dosage by half, to 10mg. [金属离子] / Kg [体重] When the material is injected via the tail vein at the specified dose, no significant increase in fluorescence signal is observed at the tumor site within 24 hours. Figure 7 No obvious fluorescent signal remained after anatomical dissection of the tumor. Figure 8 (NO.4, NO.5, NO.6).

[0175] The above results indicate that the mMHFn-5% group material possesses tumor-targeting properties. The material begins to accumulate at the tumor site after injection, producing a significant accumulation effect within 1 hour, and this accumulation continues to build up over 24 hours. However, 10mg... [金属离子] / Kg [体重] The working dose may be too low; subsequent in vivo MRI experiments should refer to 20mg.[金属离子] / Kg [体重] For the working dose of injected material, it is recommended to begin MRI scanning 1 hour after injection.

[0176] (2) Distribution and metabolic characteristics of mMHFn-5% material in vivo

[0177] The distribution and metabolic characteristics of the material in organs after entering the body were analyzed based on the location and time of fluorescence signal enhancement. 0.5 hours after tail vein injection, the strongest signal was observed in the liver area. Figure 6 NO.1, 0.5h); until the end of the experiment, 24h, the liver fluorescence signal remained enhanced ( Figure 6 (NO.1, 24h), the residual fluorescence signal in the dissected liver also remained enhanced. Figure 8 ); the other two mice in the high-dose group ( Figure 6 Similar results were observed in NO.2 and NO.3; in the low-dose group, the liver fluorescence signal of the three mice showed a continuous increasing trend within 4 hours, and then began to decline. Figure 7 The above results indicate that the material is largely phagocytosed by the liver after entering the body via the tail vein, and the liver is one of the important pathways for material metabolism. 0.5 h after tail vein injection, the signal intensity at the kidney and bladder positions was significantly enhanced. Figure 6 NO.1, 0.5h); with increasing time, the renal fluorescence signal further increased ( Figure 6 (NO.1, 1h), the bladder maintained an enhanced signal state throughout; at the end of the experiment, the residual fluorescence signal of the dissected kidney was the strongest among all dissected organs; the other two mice in the high-dose group ( Figure 6 Similar results were observed in NO.2 and NO.3; in the low-dose group, the renal fluorescence signal of the three mice showed a continuous increasing trend within 4 hours, and then began to decline. Figure 7 The residual fluorescence signal in the dissected kidney was the strongest among all anatomically examined organs. Figure 8 The above results indicate that the material may be excreted in urine via the kidneys. The significantly enhanced fluorescent residual signal in the spleen after 24 hours of dissection suggests that the material was phagocytosed and metabolized by the spleen. Weak fluorescent residual signals were also found in the heart and lungs, indicating that the material was also partially phagocytosed, absorbed, and utilized by other organs of the mouse. Figure 8 (NO.1, NO.2, NO.3).

[0178] In summary, after the material enters the body, it is mainly metabolized by organs such as the liver, kidneys, and spleen, and is also absorbed by other major organs of the body. In the low-dose group, most of the material is captured, absorbed, and metabolized by the liver, kidneys, and spleen, and a decrease in signal appears after 4 hours. The amount of tumor accumulation is small, and the signal enhancement is not obvious.

[0179] (3) Histopathological results

[0180] To evaluate the in vivo biosafety of manganese-doped magnetic ferritin (mMHFn-5%), mice were sacrificed 48 hours after injection, and major organs such as the heart, liver, spleen, lung, and kidney were harvested for histological analysis. The control group (NO.1-NO.3) received PBS via tail vein injection, while the experimental group (NO.4-NO.6) received 20 mg via tail vein injection. [金属离子] / Kg [体重] The mMHFn-5% material was used. The results of H&E staining of various organs are as follows:

[0181] Heart H&E staining results as follows Figure 9 As shown, the results in the experimental and control groups were similar. Myocardial fibers were neatly arranged, myocytes were regularly shaped, with centrally located nuclei of uniform size; no edema, hemorrhage, or inflammatory cell infiltration was observed in the myocardial interstitium; no pathological changes such as myocardial necrosis, fibrosis, or cell degeneration were observed. The myocardial tissue in both groups was slightly looser and less compact, likely due to the tissue fixation and embedding process. These results suggest that the material at this dose had no significant toxic effects on cardiac tissue.

[0182] Liver H&E staining results Figure 10 As shown, the results in the experimental and control groups were similar. The liver tissue structure was intact, hepatocytes were regularly shaped, with uniform cytoplasm and centrally located round nuclei; no obvious necrosis, fatty degeneration, or fibrosis was observed. Ballooning degeneration was present in both groups of livers, and hepatic cords were not prominent; no other abnormalities were observed. The presence of the same liver abnormalities in both the control and experimental groups suggests the possibility of hepatitis, but it does not indicate liver toxicity of the experimental group material at this experimental dose.

[0183] Results for the spleen, kidneys, and lungs are as follows Figure 11-13 As shown, no obvious abnormalities were observed.

[0184] In summary, at 20mg [金属离子] / Kg [体重] At the specified dosage, the mMHFn-5% material did not cause significant pathological changes in the major organs of mice within 48 hours after tail vein injection, indicating that the material has good biocompatibility and high in vivo safety within this dosage range.

[0185] Example 3: Manganese-doped magnetic ferritin for nuclear magnetic resonance molecular imaging of precancerous lesions of the esophagus in mice.

[0186] In this embodiment, manganese-doped magnetic ferritin mMHFn-5% was used as a nuclear magnetic resonance molecular probe to perform molecular imaging in a mouse model of precancerous lesions of the esophagus, exploring its feasibility and application prospects in the early diagnosis of esophageal squamous cell carcinoma.

[0187] 1. Induction and construction of a mouse model of precancerous esophageal lesions

[0188] Four-week-old male C57BL / 6 mice were obtained from Beijing Spefol Biotechnology Co., Ltd., and housed in an SPF-grade environment with a temperature of 23±1℃, relative humidity of 50±10%, and a 12-hour light / dark cycle. After two weeks of acclimatization, 100 μg / mL of 4-nitroquinoline-1-oxide (4NQO, N8141, Merck KGaA, Germany) was added to the mice's drinking water for 16 weeks to induce a multi-stage esophageal squamous cell carcinoma model. After the 16-week carcinogen exposure period, the water containing 4NQO was replaced with ordinary purified water. By week 22, the model entered the precancerous lesion stage, and by week 26, it entered the esophageal squamous cell carcinoma stage. All mouse housing and experimental procedures in this study were strictly carried out in accordance with animal ethics guidelines and relevant regulations.

[0189] 2. Magnetic resonance imaging of a mouse orthotopic esophageal cancer model

[0190] (1) Nuclear magnetic resonance imaging system and conditions

[0191] Imaging was performed on a Bruker 7.0 T small animal MRI system (Bruker BioSpec70 / 20 USR) using a dedicated mouse body coil (35 mm inner diameter). The mouse was positioned in the center of the imaging bed, ensuring the esophageal tumor area was centered on the coil. Respiratory gating was employed to reduce motion artifacts.

[0192] (2) Scanning sequence and parameters

[0193] Positioning scan: Fast gradient echo (FLASH), TR=200ms, TE=3ms, flip angle 30°, field of view (FOV)=30×30mm², matrix 128×128, layer thickness 1mm.

[0194] T1-weighted imaging (T1_RARE sequence): TR=1500ms, TE=6.5ms, RARE factor=4, FOV=40×30mm², matrix 256×192, slice thickness 0.5mm, average number of times 2.

[0195] T2-weighted imaging (T2_TurboRARE sequence): TR=1583.19ms, TE=24ms, RARE factor=8, FOV=40×30mm², matrix 256×192, slice thickness 0.5mm, average number of times 4.

[0196] (3) Animal preparation and anesthesia

[0197] All animal experiments were ethically approved and conducted in accordance with laboratory animal use guidelines. Mice were fasted for 4 hours prior to imaging, but allowed free access to water. Anesthesia was induced using 3-4% isoflurane, and the anesthetic concentration was maintained at 1.5-2.0% (pure oxygen as the carrier gas). Mice were fixed on the MRI table in a supine position, and their body temperature was maintained at 36-37°C using a heating platform. Respiratory rate and body temperature were monitored using a small animal physiological monitor.

[0198] (4) Image scanning

[0199] Baseline images were acquired before material injection. Contrast agent injection: The experimental material was prepared with PBS to the required concentration and rapidly injected via the tail vein at a dose of 20 mg. [金属离子] / Kg [体重] The total injection volume was controlled within 200 μL. Images were acquired 60 minutes after injection.

[0200] (5) Endpoint processing

[0201] After the MRI imaging experiment, the mice were euthanized under deep anesthesia, and the tumors and major organs were harvested for histological examination.

[0202] 3. Mouse heart perfusion and tissue sampling, paraffin-embedded tissue and sections, HE staining of paraffin sections (reference experiment).

[0203] 4. Immunohistochemical staining of paraffin sections

[0204] (1) Reagent preparation

[0205] Antibodies: Anti-TfR1 / CD71 primary antibody, HRP-labeled anti-rabbit / anti-mouse secondary antibody; Blocking solution: 5% BSA; Antigen retrieval buffer: 10mM citrate buffer, pH 6.0; 3% H2O2 for blocking endogenous peroxidase; DAB chromogenic solution (prepared according to kit instructions), hematoxylin counterstain. Wash buffer: PBS (PBST) containing 0.05% Tween-20.

[0206] (2) Dewaxing and rehydration of tissue sections

[0207] Place room temperature paraffin sections (4-5µm) in a 60℃ oven for 30-60 min to enhance tissue adhesion. Dewax and rehydrate the sections according to the following procedure: xylene I, 10 min; xylene II, 10 min; 100% ethanol, 5 min; 100% ethanol, 5 min; 95% ethanol, 5 min; 80% ethanol, 5 min; 70% ethanol, 5 min; rinse with running water for 5 min until neutral.

[0208] (3) Antigen retrieval (thermal retrieval)

[0209] Place the slices in a container containing citrate buffer (pH 6.0) and autoclave them: pressurize and heat for 2-5 minutes, cool to room temperature for about 20 minutes, and then wash with PBS 3 times, 5 minutes each time.

[0210] (4) Blocking endogenous peroxidase

[0211] Add 3% H2O2 to the slices and incubate at room temperature for 10 min to remove endogenous peroxidase activity, then wash with PBS 3×5 min.

[0212] (5) Blocking non-specific sites

[0213] Block with 5% BSA at room temperature for 30 minutes, then gently shake off the excess blocking solution.

[0214] (6) Primary antibody incubation

[0215] Add diluted primary antibody (e.g., anti-TfR1 / CD71), place in a humidified chamber, and incubate overnight at 4°C. Wash with PBST 3 × 5 min.

[0216] (7) Secondary antibody incubation

[0217] Add HRP-labeled secondary antibody (diluted and used according to manufacturer's instructions) and incubate at room temperature for 30 min. Wash with PBST 3 × 5 min.

[0218] (8) DAB color development

[0219] Prepare DAB according to the kit instructions, add it dropwise and develop the color for 1-5 minutes (observe the color intensity in real time, and stop the reaction by rinsing with running water when the color reaches a satisfactory depth).

[0220] (9) Hematoxylin redyeing

[0221] The sections were stained in hematoxylin for 30-60 seconds, then rinsed with running water and blued.

[0222] (10) Dehydration, clearing and sealing

[0223] Mount the slides using neutral resin or mounting medium following the H&E dehydration and clearing procedure (gradient alcohol → xylene). Observe and photograph under an optical microscope.

[0224] 5. Experimental Results

[0225] (1) Identification of mouse model of in situ esophageal precancerous lesion induction

[0226] Nuclear magnetic resonance molecular imaging of manganese-doped magnetic ferritin mMHFn-5% material was performed on an in situ induced C57 mouse model of esophageal precancerous lesions. Figure 14The design scheme shown was used to induce the model. Based on past experience, mice induced by chemical inducers entered the precancerous lesion stage at week 22 and the in situ esophageal squamous cell carcinoma stage at week 26.

[0227] Random sampling of induced mice was conducted between weeks 22 and 26 for validation, and the esophagus was dissected to observe the model's progression. Results are as follows: Figure 15 As shown: The control group mice were fed purified water throughout the process, and their esophagus was healthy with no obvious lesions. H&E staining showed no dysplasia of the esophageal epithelium and a clear layered structure, which are typical characteristics of a healthy esophagus. Figure 15 ac); The induction group was fed water containing the potent carcinogen 4NQO, which caused significant lesions in the esophagus. Compared with the normal esophageal tissue structure, the esophageal precancerous lesion (ESPL) mucosal layer showed atypical hyperplasia and destruction of the layered structure. Figure 15 df); Some sampled mice had already progressed to the esophageal squamous cell carcinoma (ESCC) stage, with complete destruction of the layered structure of the mucosa and atypical cells in situ affecting the entire epithelial layer ( Figure 15 gi).

[0228] TfR1 / CD71 molecules play an important role in the progression of esophageal squamous cell carcinoma and are a key molecular target in this study. Immunohistochemical validation of TfR1 / CD71 molecules in precancerous lesion models is necessary. The immunohistochemical staining results of TfR1 / CD71 molecules are shown below. Figure 16 As shown, the normal esophageal epithelial tissue in the control group showed almost no brown staining, indicating low expression of TfR1 / CD71. Figure 16 a, b); Compared with normal esophageal tissue, the precancerous lesion tissue of the esophagus showed brown staining, indicating that TfR1 / CD71 expression was significantly upregulated ( Figure 16 c, d); the esophageal squamous cell carcinoma tissue showed the deepest brown staining, indicating the highest TfR1 / CD71 expression. Figure 16 e, f).

[0229] The above results demonstrate that the models induced in this batch entered the precancerous lesion stage of esophageal cancer after 22 weeks, with some individuals progressing to esophageal squamous cell carcinoma. The process of chemically inducing esophageal precancerous lesions to esophageal squamous cell carcinoma is similar to the clinical development of esophageal cancer in humans. TfR1 / CD71 was upregulated in the precancerous lesion stage, and its expression continued to increase as the disease progressed. This batch of chemically induced C57 mouse models of esophageal squamous cell carcinoma and precancerous lesions can be used for subsequent manganese-doped magnetic ferritin nuclear magnetic resonance molecular imaging studies.

[0230] (2) Nuclear magnetic resonance molecular imaging results of manganese-doped magnetic ferritin in a model of precancerous esophageal lesions

[0231] To verify the performance of the constructed manganese-doped magnetic ferritin molecular probe in MRI molecular imaging of esophageal precancerous lesions, this study selected four mice with esophageal precancerous lesions as the experimental group, numbered Ca226, Ca322, Ca326, and Ca332. mMHFn-5% was used as the molecular probe, administered at a dose of 20 mg. [金属离子] / Kg [体重] The working dose of the material was injected, and esophageal imaging in mice was performed using a 7T small animal MRI platform. MRI images of the esophageal region were performed before and after material injection, and pathological results were verified. Case results are presented using the Ca266 mouse as a representative example.

[0232] Before the injection of mMHFn-5% material, the MRI images of the esophageal region were unclear, and the esophageal structure was difficult to distinguish from the surrounding tissues, making it impossible to further determine the location of potential lesions. Figure 17 a). After the injection of the material, the imaging effect was significantly improved, and the overall structure of the esophagus was clearly distinguishable. Figure 17 b), and locations and regions showing positive T1 signal enhancement can be observed on the esophageal wall ( Figure 17 (b, marked with a red arrow) These enhanced signals indicate pathological changes and are accompanied by upregulation of TfR1 / CD71 molecule expression.

[0233] To verify the reliability of the imaging results, a gross anatomical dissection of the esophagus was performed. Figure 17 c), and performed H&E staining and TfR1 / CD71 immunohistochemical staining. The panoramic high-resolution scan results of H&E staining showed that this section covered most of the esophagus on the gastric and oral sides, with a small portion of the middle esophagus missing; lesions were present in approximately 80% of the mouse esophageal tissue, among which the high-grade intraepithelial neoplasia sites highly corresponded to bright spots with positive T1 signal enhancement in MRI imaging (c). Figure 17 d. Low-grade intraepithelial neoplasia is marked with a red dashed box, and high-grade intraepithelial neoplasia is marked with a red solid box. Further magnified observation of localized areas after H&E staining revealed that high-grade intraepithelial neoplasia (HGIN) areas exhibited typical pathological features, including: disordered epithelial layer structure, significant loss of cell polarity; significant nuclear atypia, with enlarged and irregularly shaped nuclei; atypical cells involving most or even the entire epithelial layer, and significantly weakened or even absent squamous epithelial differentiation characteristics. Figure 17 (gh). Immunohistochemical staining results for TfR1 / CD71 showed enhanced staining in the lesion area, with high-level expression of TfR1 / CD71 molecules, consistent with the enhanced signal on MRI imaging. In summary, the T1-weighted molecular imaging of the Ca266 mouse model was highly consistent with the pathological results.

[0234] The results for the other three samples (numbered: Ca322, Ca326, and Ca332) were similar to those for Ca226, such as... Figure 18-20 As shown, the esophageal structure imaging was significantly improved after the injection of the material, with enhanced signal at the lesion sites, especially high-grade intraepithelial neoplasia lesions, which showed significant high-brightness enhancement, consistent with the results of pathological H&E staining and TfR1 / CD71 immunohistochemical staining. These results confirm the effectiveness and application potential of manganese-doped magnetic ferritin in T1-weighted molecular imaging of precancerous esophageal lesions on MRI.

[0235] This example also compares with clinically used gadolinium-based contrast agents (Maganvista / Gd-DTPA) at a dose of 0.1 mmol / kg. [体重] MRI scans were performed on Ca331 model mice before and after injection of Gd-DTPA. The results showed that the esophageal structure was unclear before and after the injection, and the esophageal images were not improved by the use of contrast agent. There was no significant signal enhancement in any specific esophageal region. Figure 21 a, b). Esophageal pathology results showed lesions in most areas of the esophagus. Figure 21 d), some sites have reached the stage of esophageal squamous cell carcinoma in situ ( Figure 21 g, h), TfR1 / CD71 expression upregulated ( Figure 21 (e, f). The Ca331 model showed deeper esophageal lesions, but the imaging effect of Gd-DTPA was not as good as that of manganese-doped magnetic ferritin, indicating that traditional non-targeted contrast agents lack the ability to recognize the molecular characteristics of the tumor microenvironment, and have insufficient sensitivity and specificity in early cancer diagnosis.

[0236] Manganese-doped magnetic ferritin is an MRI T1-weighted imaging molecular probe designed to target TfR1 / CD71. It can recognize and bind to TfR1 / CD71 receptors, enabling active enrichment and precise imaging of lesion tissues. It not only reflects changes in anatomical structure, but also reveals abnormal expression of TfR1 / CD71 in lesion areas, providing higher sensitivity and specificity for the identification of early carcinogenesis and precancerous lesions.

[0237] Therefore, immunohistochemical results showed that TfR1 / CD71 was significantly upregulated in precancerous lesions and carcinoma areas, while its expression level was low in normal epithelial tissue. This validates the key role of TfR1 / CD71 in the development and progression of esophageal squamous cell carcinoma and provides a reliable basis for its use as a molecular imaging target. MRI imaging results showed that after injection of mMHFn-5%, the esophageal structure in mice became significantly clearer on T1-weighted images, with obvious positive enhancement signals in the lesion area, consistent with the high-grade intraepithelial neoplasia area shown by H&E staining. Similar phenomena were observed in all four model mice, indicating that the mMHFn-5% probe has good imaging consistency and reproducibility in vivo. Further immunohistochemical analysis showed that the spatial location of the high-signal area on MRI corresponded to the high-expression area of ​​TfR1 / CD71, suggesting that the imaging signal originated from the local relaxation rate change caused by the specific binding of the mMHFn-5% probe to the target. These results demonstrate the mechanism by which manganese-doped magnetic ferritin materials achieve molecular-level image enhancement based on TfR1 / CD71 targeting recognition. Compared with clinically used non-targeted gadolinium-based contrast agents (Gd-DTPA), mMHFn-5% significantly improved lesion recognition under the same model conditions. Before and after Gd-DTPA injection, there was almost no improvement in the esophageal imaging structure in mice, and no significant local signal enhancement was observed. This control result indicates that traditional non-targeted small molecule contrast agents mainly rely on differences in vascular permeability to achieve contrast enhancement, lacking the ability to recognize the molecular characteristics of early lesions, thus resulting in insufficient sensitivity in precancerous or small lesion stages. In contrast, the mMHFn-5% material achieves active targeting and aggregation in the lesion area through the specific interaction between the ferritin shell and TfR1 / CD71, and its T1 relaxation enhancement effect is significantly superior to that of non-targeted contrast agents. The manganese-doped magnetic ferritin material showed significant advantages in T1-weighted MRI. The paramagnetic properties of manganese ions improved the contrast of T1-weighted imaging by increasing the longitudinal relaxation rate (r1) and decreasing the r2 / r1 ratio. Combining the biocompatibility and targeting characteristics of ferritin, manganese-doped magnetic ferritin probes provide a new approach for non-invasive, high-resolution screening of very early esophageal cancer and precancerous lesions, as well as for MRI T1-weighted molecular imaging diagnosis.

Claims

1. The application of a manganese-containing magnetic ferritin in the preparation of a tumor imaging localization diagnostic reagent, wherein the imaging localization diagnostic reagent is selected from nuclear magnetic resonance contrast agents or molecular probes, characterized in that, The manganese-containing magnetic ferritin was prepared by the following method: the synthetic ferritin underwent biomimetic mineralization, forming nanoparticles inside the ferritin, and finally the manganese-containing magnetic ferritin was obtained by separation and purification.

2. The application according to claim 1, characterized in that, The nuclear magnetic resonance contrast agent is a T1 type nuclear magnetic resonance contrast agent.

3. The application according to claim 1, characterized in that, The tumor is an esophageal cancer.

4. The application according to claim 1, characterized in that, The dosage of the manganese-containing magnetic ferritin shall not exceed 20 mg. [金属离子] / Kg [体重] .

5. The application according to claim 1, characterized in that, The iron salt solution used in the biomimetic mineralization process is an iron salt solution containing manganese ions.

6. The application according to claim 2, characterized in that, The concentration of manganese ions is less than 30%.

7. Application 7 according to claim 3, characterized in that, Manganese-containing magnetic ferritin was prepared by the following method: 1) Using recombinant human ferritin as a template, the DNA sequence of human ferritin was cloned and constructed into a plasmid; 2) Transform or co-transform bacteria with recombinant plasmids containing human ferritin, add isopropyl-β-D-thiogalactoside, and induce expression; 3) After expression, the protein is broken down by sonication to release it; 4) Separate and purify the protein; 5) Add an iron salt solution containing manganese ions and an oxidant to the ferritin solution to react, controlling the pH value to 7-11 and the temperature to 25-90℃, to form nanoparticles inside the ferritin; the iron salt solution is added at a rate of 10-200 ions per ferritin per minute, and the theoretical number of metal atoms added to each protein molecule can be between 100 and 20,000; the concentration of the oxidant is such that the ratio of the number of H2O2 molecules added each time to the number of metal ion atoms added is 3:1; the protein concentration is ≥0.25mg / ml; 6) After purification by molecular sieve, manganese-containing magnetic ferritin was obtained.

8. The application according to claim 7, characterized in that, In step 5, the iron salt is ferrous salt; the oxidizing agent is hydrogen peroxide.

9. The application according to claim 7, characterized in that, In step 5, the pH is controlled at 8.5 and the temperature is controlled at 65℃.

10. A magnetic resonance imaging contrast agent, characterized in that, The nuclear magnetic resonance contrast agent is prepared using the method described in any one of claims 1-9.

Images