An egg yolk peptide that promotes longitudinal bone growth and its preparation method

Abstract

This invention discloses an egg yolk peptide that promotes longitudinal bone growth and its preparation method. The preparation steps are as follows: Step 1: Sift defatted egg yolk powder and dissolve it in water to obtain a mixed solution; Step 2: Adjust the pH of the mixed solution and add trypsin for enzymatic hydrolysis; Step 3: Adjust the pH and add alkaline protease for enzymatic hydrolysis; Step 4: Add keratinase and continue enzymatic hydrolysis to obtain an enzymatic hydrolysate; Step 5: Inactivate the enzyme, remove the precipitate, and obtain a supernatant; Step 6: Concentrate the supernatant and freeze-dry it to obtain the final product. The egg yolk peptide of this invention that promotes longitudinal bone growth contains active egg yolk peptides with the amino acid sequences HIPY, LGPQ, MHPV, and NAHVPV. These active peptides can significantly promote chondrocyte differentiation, increase the activity of the biomarker ALP, and upregulate the expression levels of related proteins such as Runx2, thereby playing a role in promoting bone development. Adolescent animal experiments (rats) showed that the egg yolk peptide has a significant effect on promoting the growth of the femur and tibia.

Description

Technical Field

[0001] This invention belongs to the field of bioactive peptide technology, specifically relating to an egg yolk peptide that promotes longitudinal bone growth and its preparation method. Background Technology

[0002] Eggs are a nutrient-rich natural food, with the yolk containing abundant protein, lipids, and various bioactive components. Egg yolk proteins mainly consist of phosphoprotein, high-density lipoprotein, low-density lipoprotein, and vitellin. These proteins not only have excellent nutritional value but are also considered to possess potential bioactive functions. Studies have shown that enzymatic hydrolysis of egg yolk proteins can release various bioactive peptides, exhibiting antioxidant, blood pressure-lowering, anti-inflammatory, and bone-health-improving functional activities.

[0003] Skeletal development begins in the embryonic period, undergoes continuous growth and rapid acceleration during childhood and adolescence, and reaches structural maturity in early adulthood. Adolescence is the most critical period for bone mass accumulation and longitudinal bone growth. Longitudinal bone growth determines final height and is closely related to adolescent height. Longitudinal bone growth occurs due to skeletal activity at the growth plate, located proximal and distal to the epiphysis near the ends of long bones. Growth plate development and the proliferation and gene expression of chondrocytes within it play a crucial role. The growth plate consists of four chondrocyte subsets: quiescent chondrocytes, proliferating chondrocytes, preproliferative chondrocytes, and proliferative chondrocytes. These cells are arranged in an orderly manner within their respective regions and express different genes. Longitudinal bone growth depends on endochondral ossification occurring within the growth plate. This process begins with the aggregation of mesenchymal stem cells. The central cells first differentiate into chondrocyte progenitor cells, then into chondrocytes, and finally, through continuous differentiation, into hypertrophic chondrocytes, i.e., proliferative chondrocytes. Finally, as the cartilage matrix partially calcifies, chondrocytes undergo apoptosis and are replaced by osteoblasts, thus completing endochondrial ossification. Bone development requires the combined action of appropriate external nutrition and internal hormones. Internal hormones mainly include growth hormone and sex hormones, with growth hormone playing a crucial role in bone formation. Growth hormone deficiency leads to abnormally slow growth and short stature. Currently, the most common clinical treatment for growth retardation is growth hormone injection. While this therapy is effective, long-term use may have some side effects. Therefore, developing natural bioactive peptides that promote bone development is of great significance.

[0004] Currently, most research on the effects of egg yolk peptides on bone development focuses on increasing bone density and promoting osteoblast differentiation, while direct research on growth plate chondrocytes—a key regulatory site for longitudinal bone growth—is relatively limited. In fact, longitudinal bone growth primarily depends on the proliferation, differentiation, and hypertrophy of growth plate chondrocytes. Therefore, it is necessary to develop novel bioactive peptides that can regulate chondrocyte proliferation and differentiation, and further validate their biological effects on promoting longitudinal bone growth in animal models. This would provide a theoretical basis for developing health foods or nutritional supplements that promote longitudinal bone growth.

[0005] Defatted egg yolk powder is a byproduct of lecithin and egg yolk oil extraction from egg yolks. It is abundant and relatively inexpensive. Its main component is egg yolk protein. Preparing egg yolk peptides that promote longitudinal bone growth using defatted egg yolk powder and developing a method for separating highly active peptides are of great significance for enhancing the economic value of defatted egg yolk powder and realizing its industrial application. Summary of the Invention

[0006] Technical Problem to be Solved: To address the aforementioned problems, the objective of this invention is to provide an egg yolk peptide that promotes longitudinal bone growth and its preparation method. The egg yolk peptide obtained by this invention contains the amino acid sequences HIPY, LGPQ, MHPV, and NAHVPV, and is an active egg yolk peptide that significantly promotes chondrocyte differentiation, increases the activity of the biomarker alkaline phosphatase (ALP), and upregulates the expression levels of related proteins such as Runx2, thereby playing a role in promoting bone development. The optimal effect is observed at a concentration of 200 μg / mL, with chondrocytes treated with this active egg yolk peptide exhibiting an ALP activity of 140%.

[0007] Technical solution: An egg yolk peptide that promotes longitudinal bone growth, wherein the egg yolk peptide that promotes longitudinal bone growth contains active peptide components that can significantly promote the proliferation and differentiation of chondrocytes, including but not limited to HIPY (His-Ile-Pro-Tyr), LGPQ (Leu-Gly-Pro-Gln), MHPV (Met-His-Pro-Val), and NAHVPV (Asn-Ala-His-Val-Pro-Val), and has functional activity that promotes longitudinal bone growth; The preparation method includes the following steps: Step 1: Pass the defatted egg yolk powder through a 60-mesh sieve and mix it with water. Sonicate the mixture to fully dissolve it and obtain a mixed solution. Step 2: Adjust the pH of the mixture to 7.0-7.5, and add trypsin for enzymatic hydrolysis; Step 3: Adjust the pH to 9.5-10 and add alkaline protease for enzymatic hydrolysis; Step 4: Add keratinase directly and continue enzymatic hydrolysis to obtain the hydrolysate; Step 5: Heat the enzyme hydrolysate to above 90℃ for 10-20 min to inactivate the enzyme, remove the precipitate, and obtain the supernatant; Step 6: Concentrate the supernatant and freeze-dry it to obtain egg yolk peptides that promote longitudinal bone growth.

[0008] Furthermore, the mass of the water mentioned in step 1 is 9-10 times the mass of the defatted egg yolk powder.

[0009] Furthermore, in step 2, the amount of pancreatic enzyme added is 1.8-2.1% of the mass of the defatted egg yolk powder; the enzymatic hydrolysis temperature is 36-38℃, and the enzymatic hydrolysis time is 2.5-3.5h.

[0010] Furthermore, in step 3, the amount of alkaline protease added is 1.4%-1.6% of the mass of defatted egg yolk powder, the enzymatic hydrolysis temperature is 50-55℃, and the enzymatic hydrolysis time is 2-3 hours.

[0011] Furthermore, in step 4, the amount of keratinase added is 1.6-2.0% of the mass of the defatted egg yolk powder, the enzymatic hydrolysis temperature is kept constant, and the enzymatic hydrolysis time is 1-2 hours.

[0012] The present invention also provides a method for separating and purifying egg yolk active peptides. The egg yolk peptides obtained above that promote longitudinal bone growth are separated and purified by using a macroporous resin XAD1600 chromatography column, and the solution eluted with 80% ethanol is collected to obtain the egg yolk active peptides.

[0013] Furthermore, the above-mentioned egg yolk active peptides were further separated and purified using a Sephadex LH-20 dextran gel chromatography column, and the solution from the last elution was collected to obtain the secondary egg yolk active peptides.

[0014] Furthermore, the solution undergoes concentration and drying processes.

[0015] The present invention also provides a composition comprising the above-described egg yolk peptide that promotes longitudinal bone growth.

[0016] The present invention also provides the use of the above-mentioned egg yolk peptides or compositions that promote longitudinal bone growth in the preparation of products that promote longitudinal bone growth.

[0017] Furthermore, the product that promotes longitudinal bone growth is a dietary supplement, functional food, health food, or pharmaceutical that helps support the growth and development of the femur and tibia by promoting chondrocyte differentiation.

[0018] Furthermore, the product that promotes longitudinal bone growth activates the BMP / Smad signaling pathway, enhances p-Smad1 / 5 protein phosphorylation, upregulates Runx2 protein expression, and ultimately promotes chondrocyte differentiation and mineralization.

[0019] Furthermore, the product that promotes longitudinal bone growth also contains any one or more of the following ingredients: functional additives and any acceptable excipients.

[0020] The present invention also provides an active peptide derived from egg yolk that promotes chondrocyte differentiation, wherein the active peptide is HIPY, LGPQ, MHPV and NAHVPV.

[0021] Furthermore, the preparation methods of the active peptides (HIPY, LGPQ, MHPV and NAHVPV) include, but are not limited to, enzymatic hydrolysis, microbial fermentation and solid-phase chemical synthesis.

[0022] The present invention also provides the application of an egg yolk-derived bioactive peptide that promotes chondrocyte differentiation in the preparation of a pharmaceutical product that promotes longitudinal bone growth.

[0023] Furthermore, the active peptide is one or more of HIPY, LGPQ, MHPV, and NAHVPV. Beneficial effects

[0024] 1. The present invention provides a method for preparing egg yolk peptides that promote longitudinal bone growth. This method yields active egg yolk peptides containing the amino acid sequences HIPY, LGPQ, MHPV, and NAHVPV. These active peptides significantly promote chondrocyte differentiation, increase the activity of the biomarker alkaline phosphatase (ALP), and upregulate the expression levels of related proteins such as Runx2, thereby playing a role in promoting bone development. The optimal effect is observed at a concentration of 200 μg / mL, with chondrocytes treated with this active egg yolk peptide exhibiting an ALP activity of 140%.

[0025] 2. The egg yolk peptide (egg yolk protein hydrolysate) that promotes longitudinal bone growth provided by this invention can be used as a dietary supplement. It has the effects of increasing the body length, tibia and femur length of adolescent rats, improving bone strength and bone density, and improving the microstructure of bone tissue. It is natural, safe and has no toxic side effects.

[0026] 3. The tetrapeptide HIPY in the egg yolk active peptide provided by this invention promotes chondrocyte differentiation and mineralization through the BMP / Smad signaling pathway. The tetrapeptide HIPY can upregulate the expression of the nuclear transcription factor Runx2 protein by increasing p-Smad1 / 5 protein phosphorylation, ultimately promoting chondrocyte differentiation and mineralization.

[0027] 4. The preparation method provided by this invention is simple and mild, suitable for large-scale industrial production. It not only provides new functional ingredients for promoting bone growth and development, but also enables the high-value application of defatted egg yolk powder. Attached Figure Description

[0028] Figure 1The effects of egg yolk peptide (JYP) on chondrocyte proliferation and differentiation activity in Example 1 are shown below. A represents the effect of JYP on chondrocyte survival; B represents the effect of JYP on chondrocyte ALP activity; C represents the effect of JYP on the expression of the nuclear transcription factor Runx2 protein in chondrocytes; and D represents the effect of continuous JYP treatment for 24 h and 48 h on the expression of Col2α1 and Col10α1 genes in chondrocytes. Figure 2 This is a diagram showing the macroscopic effects of egg yolk peptide JYP on chondrocyte mineralization at 14 and 21 days in Example 1. Figure 3 The graph shows the effect of egg yolk peptide JYP on organ indices in adolescent rats in Example 2. Figure 4 The graphs show the effects of egg yolk peptide JYP on the body weight, body length, and tail length of adolescent rats in Example 2, along with the results at the time of sacrifice. A represents the change in body weight; B represents the change in body length; C represents the change in tail length; D represents the body weight at sacrifice; E represents the body length at sacrifice; and F represents the tail length at sacrifice. Figure 5 The image shows the effect of egg yolk peptide JYP on the length of the femur and tibia in adolescent rats in Example 2; where A is a photograph of the femur; B is the length of the femur; C is a photograph of the tibia; and D is the length of the tibia. Figure 6 The figure shows the effect of egg yolk peptide JYP on bone mineral density, bone strength, and microstructure in adolescent rats in Example 2; where A is a micro-CT image of the tibia; B is BMD; C is BMC; D is BV / TV; E is Tb.N; F is Tb.Sp; G is Tb.Th; H is the maximum load. Figure 7 This is a diagram showing the effect of egg yolk peptide JYP on growth plate height in adolescent rats in Example 2; where A is a section of tibial growth plate tissue stained with H&E; and B is the statistical results of growth plate height in each group. Figure 8 The graph shows the effect of egg yolk peptide JYP on the concentrations of calcium, phosphorus, IGF-1, and BALP in the serum of adolescent rats in Example 2; where A represents calcium content; B represents phosphorus content; C represents IGF-1; and D represents BALP. Figure 9 The images show the separation pattern of the active peptides in egg yolk and the ALP activity pattern obtained in Example 4; where A is the separation pattern and B is the relative activity of ALP. Figure 10 The images show the separation pattern of the active peptides in egg yolk and the ALP activity pattern obtained in Example 5; where A is the separation pattern and B is the relative activity of ALP. Figure 11 The total ion chromatogram of the JYP5-3 component in Example 7 is shown in the LC-MS / MS analysis. Figure 12 This is the primary mass spectrum of the eight active peptides in egg yolk from Example 7; Figure 13 MS / MS spectra of the eight active egg yolk peptides in Example 7; Figure 14 This is a graph showing the effect of eight egg yolk active peptides on the survival rate of ATDC5 cells in Example 8; Figure 15 This is a graph showing the effect of eight egg yolk active peptides on ALP activity in ATDC5 cells in Example 8. Figure 16 The figure shows the effect of the four egg yolk active peptides in Example 8 on the expression of Runx2 protein in ATDC5 cells; Figure 17 The figure shows the effect of three egg yolk active peptides on the mineralization of ATDC5 cells at 14 and 21 days in Example 8. Figure 18 The diagram shows the effects of the tetrapeptide HIPY on key proteins of the BMP pathway and ALP activity in Example 9. A represents the effect of peptide HIPY on the expression of p-Smad1 / 5, Smad1 / 5, and β-actin proteins in chondrocytes; B represents the effect of peptide HIPY on p-Smad1 / 5 protein expression in chondrocytes after the addition of the BMP receptor inhibitor LDN-193189; C represents the effect of peptide HIPY on Runx2 protein expression in chondrocytes after the addition of the BMP receptor inhibitor LDN-193189; D represents the effect of peptide HIPY on chondrocyte survival rate after the addition of the LDN-193189 receptor inhibitor; and E represents the effect of peptide HIPY on ALP activity in chondrocytes after the addition of the LDN-193189 receptor inhibitor. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0030] The following enzymes have an activity of 200,000 U / g: trypsin, alkaline protease ...

[0031] Example 1: Preparation of egg yolk peptide (JYP) that promotes longitudinal bone growth and determination of its activity on chondrocytes. 1. A method for preparing an egg yolk peptide that promotes longitudinal bone growth, comprising the following steps: Step 1: Dissolve 5 g of defatted egg yolk powder in 50 mL of deionized water, and sonicate the egg yolk liquid (300W, 20 min, sonicate for 3 s, stop for 3 s). Step 2: Adjust the pH of the solution to 7.3, add 0.1 g of trypsin (enzyme to substrate mass ratio (E / S) = 2%), and start the enzymatic hydrolysis reaction at 37℃ for 3 h; Step 3: Adjust the pH to 10.0, add 0.075 g of alkaline protease (E / S=1.5%), and continue enzymatic hydrolysis at 50℃ for 2.5 h; Step 4: Without adjusting the pH, add 0.1 g of keratinase (E / S=2%), hydrolyze for 1.5 h, then inactivate the enzyme with boiling water for 10 min, cool to room temperature, and adjust the pH to 7.0; Step 5: Centrifuge at 5000 rpm for 15 min, collect the supernatant, freeze dry to obtain egg yolk peptide (JYP).

[0032] 2. Effects of JYP on chondrocyte proliferation activity The effect of different concentrations of JYP treatment for 24 h on the viability of ATDC5 cells was evaluated using the MTT assay. ATDC5 cells in the logarithmic growth phase were harvested and treated at a concentration of 5 × 10⁶ cells / cells. 3 After seeding cells into 96-well plates and culturing for 24 h, the original culture medium was discarded, and 200 μl of culture medium containing different samples was added to each well for another 24 h. Then, 20 μl of 5 mg / mL MTT solution was added to each well, and after incubation for 4 h, the culture medium was discarded, and 150 μl of DMSO was added to each well. The absorbance was measured at 490 nm. With the control group having a cell viability of 100%, the cell viability of each treatment group was calculated using the following formula: Cell viability (%) = (OD experimental group / OD control group) × 100%.

[0033] The results are as follows Figure 1 As shown in Figure A, JYP did not significantly affect cell viability within the concentration range of 25-200 μg / mL (P>0.05), indicating that JYP treatment for 24 h had no toxic side effects on ATDC5 cells and did not significantly promote cell proliferation.

[0034] 3. Determination of JYP's chondrocyte differentiation-promoting activity ATDC5 cells in logarithmic growth phase were seeded at an appropriate density in 12-well plates and cultured in complete medium (DMEM + 10% FBS + 1% penicillin antibody) until cell confluence reached 90%. The old medium was discarded, and each well was rinsed with PBS buffer. The medium was then replaced with differentiation medium containing different concentrations of JYP (DMEM / F12 + 5% FBS + 1% penicillin antibody + 50 μg / mL ascorbic acid + 1% insulin iron selenide transfer protein (ITS-G)) and induced for 24 h. ALP activity was then measured. Afterwards, discard the culture medium, add 1 mL of PBS to each well to rinse the cells once, remove the rinsing buffer, add 75 μL of cell lysis buffer to each well, scrape the cells off the cell membrane with a spatula on ice, and transfer the cells and extract to a 1.5 mL centrifuge tube. After several pipetting cycles, centrifuge at 4°C for 5 min (10000 rpm) and collect the supernatant for later use. Determine ALP activity according to the alkaline phosphatase assay kit instructions, and determine protein content using the BCA method. Normalize the ALP activity to the protein content. Calculate the absolute enzyme activity using the formula: Absolute enzyme activity = DEA enzyme activity units / BCA concentration.

[0035] JYP's promoting effect on early differentiation of ATDC5 cells is as follows: Figure 1 As shown in Figure B, different concentrations of JYP can enhance ALP activity in chondrocytes, exhibiting a good dose-response relationship. At a concentration of 100 μg / mL, ALP activity was significantly increased compared to the control group (P<0.05), with the best effect observed at a JYP concentration of 200 μg / mL, increasing activity by 40%.

[0036] 4. Effects of JYP on the expression of chondrocyte differentiation-related proteins Runx2 is an important transcription factor in the differentiation of osteoblasts and chondrocytes. It regulates the expression of differentiation-related genes through the PI3K / Akt signaling pathway, thereby promoting the differentiation of ATDC5 cells into chondrocytes and is considered a positive regulator of chondrocyte maturation. Western blotting can be used for analysis. The specific steps are as follows: ATDC5 cells in the logarithmic growth phase are collected and analyzed at a ratio of 5 × 10⁻⁶ cells / cells. 4The cells were seeded into 12-well plates. Once the cells reached 100% confluence, the old culture medium was discarded, and the medium was replaced with differentiation medium containing different concentrations of egg yolk peptides. The plates were then incubated for 24 h. Afterward, the medium was discarded, and the cells were washed twice with PBS. RIPA lysis buffer containing 1% protease inhibitor and 1% phosphatase inhibitor was added to lyse the cells. The cells, along with the lysis buffer, were transferred to 1.5 mL centrifuge tubes using a spatula and lysed on ice for 20 min. The cells were centrifuged at 12000 rpm for 10 min, and the supernatant was collected. Protein concentration was then determined using the Solarbio BCA kit. 80 μL of the supernatant was taken, and 5×SDS-PAGE loading buffer was added at a 4:1 ratio. The mixture was boiled for 5 min, cooled to room temperature, and stored at -80 °C for later use. Samples were separated using a 5% stacking gel and a 10% separating gel, then transferred to a PVDF membrane using a wet transfer method (300 mA, 65 min). The membrane was then blocked with 5% skim milk powder at room temperature for 2 h, washed with TBST for 5 min four times, and incubated overnight at 4 °C with Runx2 monoclonal antibody. After washing away the primary antibody, the secondary antibody was added and incubated at room temperature for 1.5 h. Finally, ECL was used for color development, and images were taken using a gel imaging system. β-actin protein was used as an internal control protein, and the relative gray values ​​were analyzed using ImageJ software.

[0037] As chondrocytes differentiate, the expression level of Runx2 protein also changes. The effects of different concentrations of JYP on Runx2 protein expression in ATDC5 cells are as follows: Figure 1 As shown in Figure C, the results indicate that treatment with different concentrations (50, 100, and 200 μg / mL) of JYP can promote Runx2 protein expression to some extent. The effects are particularly pronounced at concentrations of 100 μg / mL and 200 μg / mL, showing a 28% increase compared to the model group.

[0038] 5. Effects of JYP on the expression of genes related to chondrocyte differentiation The expression levels of Col2α1 and Col10α1 genes were detected using qRT-PCR. ATDC5 cells in logarithmic growth phase were collected and processed at a concentration of 5 × 10⁻⁶ cells / cells. 4 Cells were seeded per well in 12-well plates and cultured until complete confluence. The original culture medium was discarded, and differentiation medium containing different concentrations of JYP was added, followed by 24 h of further culture. Total RNA was then extracted and analyzed by reverse transcription and real-time quantitative PCR.

[0039] RNA extraction: First, discard the culture medium from the differentiated ATDC5 cells, wash twice with pre-cooled PBS solution, and aspirate the PBS. Add 0.5 mL of TriQuick Reagent to each well to cover the cells, lyse on ice for 10 min, and pipette 2-3 times to ensure complete cell lysis. Then transfer to a centrifuge tube. Add 0.1 mL of chloroform, vortex thoroughly for 30 seconds, and incubate at room temperature for 3 minutes to allow for layering. Centrifuge at 12000 g at 4℃ for 15 min; the solution will separate into three layers: clear, white, and red. Carefully aspirate 150 µL of the clear liquid from the top into a new tube, add 150 μL of isopropanol, invert to mix, and incubate at room temperature for 15 min to allow for complete RNA precipitation. Then centrifuge again at 12000 g at 4℃ for 15 min; RNA precipitation can be observed at the bottom of the tube. Discard the supernatant, add 0.5 mL of 75% ethanol and gently mix to wash the precipitate. Centrifuge at 7500 rpm for 5 min to wash the precipitate once, discard the supernatant, and invert the centrifuge tube to air dry at room temperature for about 10 min. Finally, add 20 µL of DEPC water to dissolve the RNA precipitate, gently pipette to mix, and store at -80℃ for later use.

[0040] RNA reverse transcription: After thawing the RNA on ice, its concentration and purity were determined using a Nano Drop micro-spectrophotometer. The volume of 500 ng of RNA required for reverse transcription was calculated, and a 20 µL reaction mixture was prepared according to the reverse transcription kit instructions. Finally, cDNA synthesis was performed using a PCR amplification instrument: 37℃ for 15 min; 85℃ for 5 s; 4℃ forever.

[0041] Real-time quantitative PCR: Add the required reaction mixture to an 8-tube array according to the SYBR Green quantitative PCR kit instructions. After centrifugation, place the tubes in a real-time quantitative PCR instrument and cycle as follows: ① 95℃ 30 s; ② 95℃ 5 s; ③ 60℃ 34 s; 40 cycles for stages ② and ③, followed by the standard melting curve program. -ΔΔCt The calculation formula yields the final relative expression level result.

[0042] The GAPDH gene was used as an internal reference gene. The primer sequences for each gene are as follows: COL2α1: The forward primer sequence (5'-3') is GGTCCTCCTGGTCCTGGCATC; The reverse primer sequence (5'-3') is CGTGCTGTCTCAAGGTACTGTCTG.

[0043] COL10α1: The forward primer sequence (5'-3') is ATGCCGCTTGTCAGTGCTAACC; The reverse primer sequence (5'-3') is GGGTCGTAATGCTGCTGCCTATTG.

[0044] GAPDH: The forward primer sequence (5'-3') is AGGTCGGTGTGAACGGATTTG; The reverse primer sequence (5'-3') is TGTAGACCATGTAGTTGAGGTCA.

[0045] Chondrocyte differentiation and maturation play a crucial role in intrachondral ossification. Within the growth plate, quiescent chondrocytes initially differentiate into proliferating chondrocytes, which actively proliferate and express chondrocyte markers, namely Sox9 and type II collagen (Col2α1). The upregulation of Col2α1 gene expression, which encodes type II collagen in the extracellular matrix of chondrocytes, is one of the early hallmark events of chondrocyte differentiation. As ATDC5 cells differentiate into near-mature chondrocytes, Col2α1 gene expression may decrease or stabilize. Figure 1 As shown in D, JYP did not significantly promote Col2α1 gene expression at concentrations of 50 μg / mL and 100 μg / mL, but it significantly increased Col2α1 gene expression at a concentration of 200 μg / mL. This indicates that in the early stages of chondrocyte differentiation, a concentration of 200 μg / mL of JYP has a better differentiation-promoting effect on ATDC5 cells.

[0046] After proliferating chondrocytes exit the cell cycle, they differentiate into pre-mast chondrocytes and mast chondrocytes, followed by increased expression of proliferative markers such as Runx2 and type X collagen (Col10α1). Through coordinated and sequential differentiation, mature chondrocytes are replaced by bone tissue. Therefore, chondrocyte hypertrophy is the terminal stage of chondrocyte differentiation, mediating the transformation of cartilage into bone. Normal expression of Col10α1, a specific marker of mast chondrocytes, is crucial for the mineralization process. Figure 1 As shown in D, JYP significantly upregulated the expression of the Col10α1 gene at concentrations of 100 μg / mL and 200 μg / mL (P<0.05), while it only showed a slight promoting effect at a concentration of 50 μg / mL, which did not reach a statistically significant level. Therefore, JYP's upregulation of Col10α1 gene expression in ATDC5 cells is stronger than that of Col2α1, indicating that JYP exerts its effect by promoting chondrocyte hypertrophy.

[0047] 6. Effects of JYP on chondrocyte mineralization Alizarin red staining was used to determine the mineralization level of chondrocytes. The specific method is as follows: [Staining was performed at 5 × 10⁻⁶...] 4Cells were seeded into 12-well plates. Chondrogenic differentiation induction began when cells reached 100% confluence. 1 mL of differentiation medium containing different samples (DMEM / F12 + 5% FBS + 1% penicillin-dextrose antibody + 50 μg / mL ascorbic acid + 1% insulin iron-selenium transfer protein (ITS-G) + 10 mM β-glycerophosphate) was added to each well. Cells were incubated for 14 and 21 days, with the medium changed every two days. After discarding the medium, cells were washed once with calcium- and magnesium-free PBS, fixed with 4% paraformaldehyde for 15 min, and then washed once with deionized water. 1 mL of alizarin red staining solution was added to each well, and the plates were incubated at room temperature for 30 min. After staining, the staining solution was discarded, and excess stain was washed away with plenty of deionized water until no obvious stain remained in the background. The plates were then inverted to air dry, and photographs of the entire plate were taken.

[0048] Mineralization is crucial for metabolism and healthy bone formation. The mineralization process primarily involves the orderly deposition of inorganic calcium phosphate in the form of hydroxyapatite crystals on an organic matrix. The effects of different concentrations of JYP treatment on ATDC5 cell mineralization at 14 and 21 days after differentiation are shown below. Figure 2 As shown in the figure, at 14 days of differentiation, the 200 μg / mL treatment group showed the largest and most uniformly distributed mineralized area, indicating the best promoting effect. At 21 days of differentiation, the mineralized areas of all treatment groups (50, 100, and 200 μg / mL) were higher than the control group, with the 200 μg / mL group still showing the most significant promoting effect. The overall results indicate that JYP can promote ATDC5 cell differentiation within the set dosage range, exhibiting a certain dose-dependent effect, with 200 μg / mL being the optimal concentration.

[0049] Example 2: Evaluation of the efficacy of egg yolk peptide (JYP) in promoting longitudinal bone growth (animal experiment) 1. Preparation of egg yolk peptide JYP JYP prepared using the same method as in Example 1 was used as the animal intervention sample.

[0050] 2. Animal Experiment Design Twenty-four 3-week-old male Sprague-Dawley rats (weighing 65–75 g) were housed in a standard SPF barrier environment (temperature 22±2℃, humidity 55±5%, day / night cycle 12 / 12 h) with free access to food and water. After one week of acclimatization, the rats were randomly divided into four groups of six each for a three-week experiment. The normal control group received an equal volume of distilled water by gavage, the positive control group received 20 µg / kg bw recombinant human growth hormone subcutaneously, and the experimental groups received egg yolk protein hydrolysate JYP by gavage once daily at a volume of 5 mL / kg bw. The rats had free access to water and a standard diet during the experiment. Specific groupings, treatments, and diets are shown in Table 1. Table 1. Experimental animal design and grouping

[0051] 3. Measurement of rat body weight and organ indices Rats' body weight was measured weekly during the experiment. After 3 weeks of intervention, the changes in rat body weight were as follows: Figure 3 As shown, the weight gain patterns of the LJ and HJ groups were similar to those of the NC group. The weight of all groups showed a continuous upward trend over time, reflecting normal growth kinetics. This indicates that the experimental intervention did not significantly interfere with the overall weight accumulation of the rats, and also shows that the rats in each group were in a normal growth and development period.

[0052] After euthanasia, the rats were quickly dissected, and the heart, liver, spleen, kidneys, and thymus were separated. The organs were rinsed with pre-cooled physiological saline to remove residual blood and connective tissue. Surface moisture was blotted dry with filter paper, and the wet weight of each organ was measured. The organ index (g / 100g) was calculated. Organ index = Organ weight (g) / Body weight (100 g) × 100%.

[0053] The organ index results indicate that ( Figure 3 The relative weights of vital organs such as the liver, kidneys, spleen, heart, and thymus showed no significant differences among the groups. From a toxicological perspective, the stability of the organ indices suggests that the experimental intervention did not induce pathological changes in the organs, ruling out direct toxic effects on important metabolic (liver), excretory (kidneys), immune (spleen and thymus), and circulatory (heart) systems. This indicates that the experimental intervention did not have a significant adverse effect on the development and function of rat organs, providing strong support for the safety of the egg yolk peptide intervention. Regarding the coordination of growth and development, the organ indices showed a consistent trend with changes in body weight and body length, indicating that organ development and body growth in rats maintained good synchronicity during the experimental period, and no organ-body growth imbalance caused by the intervention was observed.

[0054] 4. Measurement of rat body length and tail length Body length (distance from nose to anus) and tail length (distance from anus to tail tip) were measured weekly using calipers. Results were as follows: Figure 4 As shown, the body length of each group increased from day 7 (adaptation period) to day 21 (third week). At the experimental endpoint (day 21), the body length of the positive control group (GH group) was significantly increased compared to the NC group, by 4.74% (P<0.01). There was no significant difference between the low-dose group (LJ group) and the NC group, while the body length of the high-dose group (HJ group) was significantly greater than that of the NC group, increasing by 3.94% (Figure E) (P<0.05). Tail length results showed that, similar to the changes in body length, the tail length of all groups increased over time, reflecting the synchronous development of the appendage skeletal structure.

[0055] 5. Measurement of tibia and femur length in rats Bilateral hind limbs of rats were isolated, and muscles and other connective tissues were removed, taking care not to damage the epiphyses. The remaining tissue on the bone surface was rinsed with pre-cooled physiological saline, and the water was blotted dry with filter paper to obtain isolated tibias and femurs, which were then placed on ice for later use. Bone lengths were measured using vernier calipers. Femoral length was defined as the straight-line distance from the femoral head to the intercondylar fossa, and tibial length as the straight-line distance from the proximal to the distal epiphysis.

[0056] The femur and tibia are core long bone indicators reflecting longitudinal bone growth in rats. Femur length is as follows: Figure 5 As shown in A and B, compared with the NC group (34.36 mm), there was no statistically significant difference in femur length in the LJ group, while the HJ group (34.87 mm) showed an increase of approximately 1.48% (P<0.05). The femur length in the GH group (34.92 mm) increased by approximately 1.63% (P<0.05). Figure 5 C presents representative images of the tibia in different groups (NC, GH, LJ, HJ), with the increase in tibial length being more pronounced in the HJ group. Figure 5 Statistical analysis of tibial length in group D showed that although the LJ group increased in length compared to the NC group, the difference was not statistically significant. The HJ group (40.97 mm) increased by approximately 3.91% compared to the NC group, showing a highly significant increase (P<0.001). The GH group (40.52 mm) increased in tibial length by approximately 2.76% compared to the NC group (39.43 mm) (P<0.05). This indicates that high-dose JYP has a significant promoting effect on longitudinal bone growth, and the effect is better than that of the GH group.

[0057] 6. Determination of the microstructure of rat bone The right tibia of rats was fixed with 4% tissue fixative, and the fixed tibia was scanned using Hiscan VM Pro Max for micro-CT. Subsequently, the cancellous bone region was selected as the ROI in HiscanAnalyzer, and common bone microstructure parameters were calculated based on the results, including bone volume fraction (BV / TV), trabecular thickness (Tb.Th), number of trabecular bones (Tb.N), intertrabecular spacing (Tb.Sp), bone mineral density (BMD), and bone mineral content (BMC).

[0058] The effects of JYP on rat bone microstructure, such as Figure 6 As shown, the differences in BMD among the groups were small ( Figure 6 B), BMD in the LJ and HJ groups increased by approximately 3.7% and 3.4% compared to the NC group, respectively, while the GH group increased by approximately 2.4% compared to the NC group. BMC results showed ( Figure 6 (C) All groups showed an increase compared to the NC group. The BMC of the GH group increased by about 15.2%, the JYP group showed a more significant increase, and the LJ and HJ groups increased by about 48.6% and 50.2% respectively compared to the NC group.

[0059] Regarding trabecular microstructure, each intervention group showed varying degrees of improvement. Compared to the normal control group (NC), the GH group showed a 15.4% increase in bone volume fraction, while the JYP treatment groups showed a more significant improvement, with the low-dose group (LJ) and high-dose group (HJ) showing increases of 32.5% and 31.2%, respectively. These results indicate that JYP can increase bone volume and total bone mineral content, and its effect is superior to growth hormone intervention. Furthermore, all intervention groups increased the number of trabecular bone (Figure E), with the GH group showing an increase of approximately 35.6% compared to NC, and the LJ and HJ groups showing increases of approximately 53.4% ​​and 55.7%, respectively. All intervention groups reduced the intertrabecular gaps (Figure F), with the GH group showing a reduction of approximately 27.1% compared to NC, and the LJ and HJ groups showing reductions of approximately 35.8% and 38.0%, respectively. Regarding trabecular bone thickness (Figure G), GH, LJ, and HJ were 0.0839 mm, 0.0798 mm, and 0.0814 mm, respectively, showing no significant difference from the NC group (0.0874 mm). These results indicate that JYP is superior to growth hormone in improving trabecular bone microstructure, particularly in reducing trabecular gaps and increasing the number of trabeculae, thereby resulting in a denser cancellous bone structure and increased bone mass.

[0060] 7. Bone strength measurement After euthanizing the rats, the left tibia was harvested, the attached soft tissue was removed, and the bone was stored at −80 °C. Before testing, the bone was immersed in 0.9% physiological saline overnight at 4 °C, and then left at room temperature for 1 h to recover to the test condition. After drying the surface moisture, the maximum load was measured using a texture analyzer combined with a three-point bending fixture to assess bone strength.

[0061] Bone strength is determined by both bone mass and bone tissue quality, comprehensively reflecting bone's resistance to deformation and load-bearing capacity. This study evaluated the bone mechanical strength of each group by measuring the maximum load on the rat tibia. Figure 6 The results showed that there was no significant difference between the GH group and the NC group. The LJ and HJ groups were higher than the normal control group, increasing by 20.75% and 19.50% respectively, and the HJ group showed a significant difference (P < 0.05). This indicates that JYP can improve the mechanical properties (fracture resistance) of rat tibia and is beneficial to its longitudinal bone growth.

[0062] 8. H&E staining analysis of tibial growth plate Rat tibias were fixed with 4% tissue fixative, washed with PBS and distilled water, and transferred to 20–30 times their volume of decalcification solution for 10–30 days or longer. Afterward, they were dehydrated, paraffin-embedded, and sectioned. The sections were stained with hematoxylin and eosin (H&E). Growth plate height was measured using Slideviewer.

[0063] The growth plate is the site of longitudinal bone growth and consists of several different regions that reflect the gradual transition of cells at different stages of differentiation. Figure 7 In the study, compared with the control group, both low-dose and high-dose JYP interventions (LJ and HJ) increased tibial growth plate height, by 6.45% and 15.47%, respectively. The HJ group showed a statistically significant effect (P<0.01), while the GH group showed an 11.34% increase compared to the control group (P<0.05). These results indicate that JYP can increase tibial length by increasing growth plate height, exhibiting a dose-response effect.

[0064] 9. Determination of serum bone growth markers After 3 weeks of intervention, blood was collected via the abdominal aorta under aphrodisiac anesthesia. Blood was collected in anticoagulant-free blood collection tubes, allowed to stand at room temperature for 2 hours, and then centrifuged at 4 ℃ and 3500×g for 10 minutes. The supernatant serum was collected, and serum calcium, phosphorus, BALP activity, and IGF-1 levels were measured according to the corresponding kit instructions.

[0065] Blood calcium and phosphorus levels are core indicators of bone metabolism, and stable levels are fundamental to normal bone mineralization and growth. For example... Figure 8As shown, there were no significant differences in serum calcium and phosphorus levels among the groups (P>0.05). Serum insulin-like growth factor 1 (IGF-1) is a key factor directly regulating the proliferation and differentiation of epiphyseal growth plate chondrocytes. Higher serum IGF-1 levels promote the expansion of epiphyseal chondrocytes and matrix synthesis, directly enhancing intrachondral ossification and serving as a biomarker of longitudinal bone growth activity. IGF-1 levels showed significant statistical differences among the groups (P>0.05). Figure 8 C). The GH group concentration was 1036.84 ng / mL, an increase of 14.2% (P<0.01). The JYP treatment group showed a superior promoting effect compared to the positive control group, and this effect was dose-dependent: the IGF-1 level in the LJ group increased significantly by 18.3%, reaching a concentration of 1074.03 ng / mL (P<0.05); the HJ group showed a highly significant promoting effect (P<0.01), with an increase of up to 25.1%, reaching a concentration of 1135.14 ng / mL. Serum BALP content directly reflects osteoblast activity, and osteoblast-mediated bone matrix mineralization is a key subsequent step in longitudinal bone growth. The serum BALP content in the HJ group increased significantly to 10.69 ng / mL, an increase of 27.4% compared to NC (P<0.01). This indicates that the corresponding treatment can maintain high osteoblast activity, provide stable bone formation support for longitudinal bone growth, and ensure the smooth progress of intrachondral ossification.

[0066] 1. The molecular weight distribution of JYP was determined using a Shimadzu LC-15C HPLC system. A 2 mg / mL solution of JYP was prepared, filtered through a 0.22 μm aqueous filter, and 10 μL of the filtrate was manually injected into a TSK gel G2000 SWXL column (7.8 mm × 30 cm, 5 μm) for analysis. The mobile phase was 45% acetonitrile (containing 0.1% TFA), the flow rate was set to 0.5 mL / min, the elution time was 30 min, and the detection wavelength was 220 nm. Peptides with molecular weights of 6512 Da, 1423 Da, 674 Da, 322 Da, and 146 Da were used as standards, and a standard curve was plotted based on the relationship between elution time and the logarithm of molecular weight.

[0067] The molecular weight distribution of the egg yolk peptide JYP prepared in Example 1 is shown in Table 2. The products obtained after continuous hydrolysis with the three enzymes were mainly low-molecular-weight peptides, with approximately 78% of the peptides having a molecular weight less than 1000 Da. Among them, the 500-1000 Da range accounted for 19.8%, while peptides less than 500 Da accounted for the largest proportion, approximately 58%.

[0068] Table 2 Molecular weight distribution of JYP

[0069] 2. The amino acid composition of JYP was determined by HPLC-phenyl isothiocyanate (PITC) pre-column derivatization. JYP samples were prepared into a 1 mg / mL solution and hydrolyzed with 6 mol / L hydrochloric acid at 110 ℃ for 24 h. Then, 1 mL of the hydrolysate was placed in an evaporating dish and thoroughly dried in a 42 ℃ oven. The solution was then redissolved with 1 mL of 0.1 mol / L HCl before analysis. Take 200 μL of the reconstituted sample, add 100 μL of 0.1 mol / L phenyl isothiocyanate and 100 μL of 1 mol / L triethylamine, mix thoroughly, and let stand in the dark for 1 h. Then add 400 μL of n-hexane, vortex for 1 min, let stand for 10 min, collect the supernatant, filter through a 0.22 μm organic filter membrane, and manually inject 10 μL into an Agilent Advance Bio AAA column (4.6 × 100 mm, 2.7 µm) for chromatographic analysis at a detection wavelength of 254 nm. The mobile phase A for HPLC analysis was 10 mM disodium hydrogen phosphate and 10 mM sodium tetraborate, with the pH adjusted to 8.2 by hydrochloric acid; the mobile phase B was methanol-acetonitrile-water (45:45:10). The elution rate was 1.0 mL / min, the detection wavelength was 254 nm, and the elution gradient was as follows: 0-0.35 min, 2% B; 0.35-6.9 min, 2%-22% B; 6.9-13.4 min, 22%-56% B; 13.4-13.5 min, 56%-100% B; 13.5-15.7 min, 100% B; 15.7-15.8 min, 100%-2% B; 15.8-18 min, 2% B.

[0070] The amino acid composition of JYP is shown in Table 3 below. Isoleucine is the most abundant amino acid in JYP, at 16.37%, followed by lysine (12.91%) and threonine (10.57%). Studies have shown that lysine supplementation can promote osteoblast proliferation and differentiation.

[0071] Example 4: Preparation of egg yolk active peptides and detection of their chondrocyte differentiation-promoting activity Egg yolk peptide JYP prepared according to the same method as in Example 1 was dissolved in 10 ml of deionized water to prepare a 300 mg / mL solution. The solution was then packed into a chromatography column (2.5 cm × 40 cm) using XAD-1600 macroporous resin. The column was rinsed with distilled water until no change was observed at 220 nm. 10 ml of the enzymatic hydrolysate solution was manually loaded. The loading flow rate was set to 3 mL / min. The column was eluted sequentially with deionized water, 20% ethanol, 40% ethanol, 60% ethanol, 80% ethanol, and anhydrous ethanol, eluting one column volume (60 min) with each eluent. The eluent was collected, evaporated under vacuum at 45°C until no ethanol remained, and then lyophilized for later use.

[0072] The method for determining the chondrocyte differentiation-promoting activity is shown in Example 1.

[0073] To extract the active component of egg yolk peptide JYP that promotes longitudinal bone growth, JYP was separated and purified using a macroporous resin XAD1600 chromatography column. The separation chromatogram is shown below. Figure 9 As shown, six components were obtained, named JYP-1, JYP-2, JYP-3, JYP-4, JYP-5, and JYP-6, respectively. Their chondrocyte differentiation-promoting activities were measured sequentially. ALP activity results showed that JYP-2 to JYP-6 all exhibited some ALP-promoting activity, with JYP-5 showing the best effect. At a concentration of 100 μg / mL, the ALP-promoting activity increased by 50.87% compared to before separation, and the yield of active peptides was 4.6%.

[0074] According to polarity classification, JYP-5 belongs to strongly nonpolar components. Macroporous resin XAD1600 is a nonpolar resin with low cost and is a commonly used resin for chromatography columns in industrial separation (purification). Therefore, the active peptide separation method used in this embodiment has the potential for industrial production.

[0075] Example 5: Further isolation and purification of egg yolk active peptides JYP-5 from Example 4 was further separated using a Sephadex LH-20 dextran gel to obtain highly active components for identifying the active peptide components. The Sephadex LH-20 dextran gel separates components according to molecular weight; the first eluted components are the macromolecules, and the later eluted components are the small molecules. 0.20 g of the lyophilized active peptide powder from Example 4 was dissolved in 2 ml of 60% ethanol to prepare a 100 mg / mL solution. 2 mL of this solution was manually loaded into a Sephadex LH-20 column (2.5 cm × 40 cm), and chromatogram recording began. After the sample column entered the packing material, 60% ethanol was applied above the packing material, and the peristaltic pump was turned on. Both the equilibration and elution buffers were 60% ethanol. The peristaltic pump flow rate was controlled at 0.8 ml / min, the elution time was 360 min, and the elution volume was 450 mL. The absorbance was monitored at 220 nm. The chromatogram was recorded, and the sample components were collected. The method for determining the chondrocyte differentiation-promoting activity is shown in Example 1.

[0076] Separation patterns such as Figure 10 As shown, JYP-5 was divided into three components, named JYP-5-1, JYP-5-2, and JYP-5-3, and their chondrocyte differentiation-promoting activities were measured sequentially. ALP activity assay results ( Figure 10 B) shows that JYP-5-1 to 5-3 can all promote the relative expression of ALP, among which JYP-5-3 has the best ability to enhance ALP activity compared with JYP-5, the strongest active component isolated in the first step (P<0.05). Based on molecular weight, JYP-5-3 is the component with a relatively small molecular weight among the non-polar components.

[0077] Example 6: Molecular weight distribution and amino acid composition of egg yolk active peptides The molecular weight distribution of the highly active components after separation and purification is shown in Table 3 below. 84.9% of the components in the enzymatic hydrolysate JYP are <1000 Da. After separation by macroporous resin chromatography, the proportion of components with molecular weights between 500 and 3000 Da increased, because larger molecular weight peptides are more hydrophobic. After the second step of separation and purification, the proportion of small molecule components <500 Da increased, reaching 40.45%.

[0078] The amino acid composition of the egg yolk active peptides is shown in Table 4. After one separation, the amino acid with the largest proportion in the active component JYP-5 remained Ile (20.28%), and its proportion increased compared to JYP. The second most abundant amino acid changed from Lys to Pro (18.08%), with Lys accounting for 10.87%, ranking third. After a second separation, the top three amino acids in the active component JYP5-3 were the same as those in JYP-5: Ile (20.82%) > Pro (15.81%) > Lys (9.52%).

[0079] Table 3. Molecular weight distribution of active peptides in egg yolk

[0080] Table 4. Amino acid composition of egg yolk active peptides

[0081] Example 7 Identification of active peptides in egg yolk The active peptides of the highly active fraction JYP-5-3 isolated in Example 5 were identified using LC-MS / MS. The raw mass spectrometry data were processed using Xcalibur software, and chicken yolk protein sequences (version 2025, containing 18370 entries) for the Gallus gallus species were searched in the Uniprot database using PEAKS Studio 10.6 software. The mass spectrometry identifications were compared with the database results to screen peptides with high abundance and amino acid composition characteristics consistent with those of Examples 4, 5, and 6.

[0082] Figure 11 Total ion chromatogram (TIC) of JYP-5-3 component. Figure 12The first-order mass spectra of the JYP-5-3 fraction with retention times of 6.02–10.47 min, 11.00–16.50 min, 20.02–30.97 min, and 20.02–59.99 min are shown. Using Uniprot chicken vitellin as a database, the mass spectrometry identification was compared with the database. The results showed that the highly active JYP-5-3 peptides mainly originated from vitellin, including vitellinogen 1 and 2, apolipoprotein B, and LDL receptor protein (Table 5). All identified peptides were sorted by abundance, and the highest abundance peptides were selected for preliminary screening. Simultaneously, based on the properties of the highly active components obtained from the two separations, and with the assistance of PeptideCutter - PeptideCharacterisation Software, eight peptides with the highest potential for promoting chondrocyte differentiation and resistance to digestion were screened, as shown in Table 5. Among them, the DMHVIPLP peptide is the simulated digestion product of the most abundant undecapeptide NKDMHVIPLPL. This sequence appears frequently in other identified peptides, so we also synthesized and evaluated its function. Figure 13 The secondary mass spectra of these eight peptides are shown. They were then synthesized using solid-phase synthesis by a relevant peptide synthesis company to assess their bioactivity and explore the molecular regulatory mechanisms of osteogenic peptides.

[0083] Table 5 shows some peptide sequences identified and screened from the JYP-5-3 fragment.

[0084] Note: 1: Abundance represents the relative content of the peptide; 2: Indicates the sequence position of the first amino acid of the peptide in the protein source, where peptides numbered 1 and 3 have multiple protein sources.

[0085] Example 8: Determination of the activity of egg yolk active peptides in promoting chondrocyte proliferation, differentiation and mineralization. 1. The eight oligopeptide sequences identified in Example 7, namely EST, FAP, YSP, HIPY, MHPV, LGPQ, NAHVPV and DMHVIPLP, were synthesized by solid-phase chemical synthesis and were in the form of transacetate with a purity of ≥98%.

[0086] 2. The in vitro chondrocyte proliferation and differentiation activities of the eight synthetic peptides were determined. Cell viability at concentrations of 50, 100, 200, and 400 μM was detected using the MTT assay, and the activity of ALP, a cell differentiation biomarker, at concentrations of 25, 50, 100, 200, and 400 μM was detected using an ALISA kit. The specific experimental procedures were the same as in Example 1.

[0087] like Figure 14As shown, within the concentration range of 50-400 μM, the six peptides EST, FAP, YSP, MHPV, NAHVPV, and DMHVIPLP had no significant effect on cell viability (P>0.05), meaning they did not exhibit proliferative activity. The tetrapeptide HIPY significantly promoted cell viability compared to the control group at concentrations of 50-400 μM (P<0.05a), with the highest viability at 200 μM (110.12%). The tetrapeptide LGPQ significantly promoted cell viability compared to the control group at concentrations of 50-200 μM (P<0.05), with the highest viability at 200 μM (120.39%).

[0088] like Figure 15 As shown, among the eight synthesized peptides, four peptides exhibited ALP-promoting activity: HIPY, LGPQ, MHPV, and NAHVPV, indicating that they have a certain chondrocyte differentiation-promoting effect. Specifically, the tetrapeptide HIPY showed the highest relative ALP activity at a concentration of 200 μM (119.37%); the tetrapeptide LGPQ showed the highest relative ALP activity at a concentration of 25 μM (133.30%); the hexapeptide NAHVPV showed the highest relative ALP activity at a concentration of 100 μM (138.76%); and the tetrapeptide MHPV showed the highest relative ALP activity at a concentration of 100 μM (115.52%).

[0089] It is evident that the four oligopeptides (HIPY, LGPQ, MHPV and NAHVPV) promote chondrocyte differentiation, among which two tetrapeptides (HIPY and LGPQ) have both proliferative and differentiation-promoting activities.

[0090] 3. The effect of bioactive peptides on Runx2 protein expression in ATDC5 cells was determined. The specific determination method was the same as in Example 1.

[0091] The effects of four bioactive peptides at different concentrations (25-100 or 50-200 μM) on the expression of the nuclear transcription factor Runx2 protein in chondrocyte differentiation were examined, with the expression level of the control group representing 100%. The results showed that ( Figure 16These four oligopeptides (HIPY, LGPQ, MHPV and NHAVPV) all enhanced Runx2 protein expression at different concentrations. The tetrapeptide HIPY significantly promoted Runx2 protein expression at concentrations of 50, 100, and 200 μM, with a highly significant effect at 200 μM (P<0.01), increasing expression by 41.1%. The tetrapeptide LGPQ significantly promoted Runx2 protein expression at concentrations of 25, 50, and 100 μM, with significant effects at 25 μM and 50 μM (P<0.05), increasing expression by 39.4% and 39.3%, respectively. The hexapeptide NAHVPV significantly promoted Runx2 protein expression at concentrations of 25, 50, and 100 μM, with an increase of 67.4% at 25 μM (P<0.05), 58.6% at 50 μM (P<0.05), and a highly significant effect at 100 μM (P<0.01), increasing expression by 66.2%. The tetrapeptide MHPV significantly promoted Runx2 protein expression at concentrations of 50, 100, and 200 μM. At a concentration of μM, Runx2 protein expression was increased by 20.5% and 34.8%, respectively, with a significant increase of 38.4% at a concentration of 200 μM (P<0.05).

[0092] 4. The in vitro chondrocyte mineralization activity of three active peptides, HIPY, LGPQ, and NAHVPV, was determined. The specific experimental steps were the same as in Example 1.

[0093] The results are as follows Figure 17 As shown, 14 days after chondrocyte differentiation, three bioactive peptides (HIPY, LGPQ, and NAHVPV) significantly promoted chondrocyte mineralization. The tetrapeptide HIPY promoted mineralization at concentrations of 50, 100, and 200 μM, with the largest mineralized area observed at 200 μM. The tetrapeptide LGPQ showed significant mineralization effects at concentrations of 25 and 50 μM, with the best effect at 50 μM. The hexapeptide NAHVPV promoted mineralization at concentrations of 25, 50, and 100 μM, with the optimal mineralization effect at 100 μM.

[0094] Furthermore, after 21 days of differentiation, peptide HIPY showed increased mineralization area at all three concentrations, with the best effect observed at 200 μM; peptide LGPQ showed the best effect at 25 μM and 50 μM concentrations; and peptide NAHVPV showed mineralization-promoting effects at 25, 50, and 100 μM concentrations. On day 21, the mineralization area at the 50 μM concentration was larger and redder than before, while the mineralization effect remained significant at the 100 μM concentration.

[0095] Example 9: Molecular Mechanism of Action of Tetrapeptide HIPY 1. Activation of the BMP / Smad signaling pathway Take ATDC5 cells in the logarithmic growth phase, and then... 4 The cells were seeded into 12-well plates and cultured for 24 h after reaching 100% confluence. The old culture medium was discarded, and the cells were replaced with differentiation medium containing the tetrapeptide HIPY. The culture was then discarded, and RIPA lysis buffer containing 1% protease inhibitor and 1% phosphatase inhibitor was added to lyse the cells. The cells and lysis buffer were transferred to 1.5 mL centrifuge tubes using a scraper and lysed on ice for 20 min. The cells were then centrifuged at 12000 rpm for 10 min, and the supernatant was collected. Protein concentration was then determined using the BCA method.

[0096] Equal amounts of protein were separated by SDS-PAGE electrophoresis and then transferred to a PVDF membrane using a wet transfer method. After blocking at room temperature for 2 h, primary antibodies p-Smad1 / 5 (1:1000) and β-actin (1:3000) were added and incubated overnight at 4 °C. After washing off the primary antibodies, the membrane was incubated with HRP-labeled secondary antibody for 1.5 h. The membrane was then developed by ECL chemiluminescence imaging, and protein band signals were acquired using an imaging system. Subsequently, the membrane was regenerated using antibody stripping buffer and then incubated with the corresponding total protein primary antibodies, including Smad1 / 5 (1:1000) and Runx2 (1:1000), overnight at 4 °C. After incubation with HRP-labeled secondary antibody for 1 h, ECL development was performed, and images were acquired. ImageJ software was used for grayscale analysis of the protein bands, and β-actin was used as an internal control for normalization.

[0097] The effects of tetrapeptide HIPY on the BMP / Smad signaling pathway are as follows: Figure 18 As shown in Figure A, the BMP / Smad signaling pathway promotes the expression of osteogenic-related transcription factors such as Runx2 by regulating Smad1 / 5 / 8 phosphorylation, playing a positive regulatory role in chondrocyte maturation and intrachondral ossification. Activity validation has demonstrated that HIPY promotes Runx2 protein expression. Compared with the control group, HIPY activated the phosphorylation of p-smad1 / 5 protein at concentrations of 50, 100, and 200 μM: increasing protein expression by 21.31% at 50 μM, 37.01% at 100 μM, and 41.31% at 200 μM, indicating that the HIPY peptide may promote longitudinal bone growth through the BMP / Smad pathway.

[0098] 2. BMP receptor inhibition experiment ATDC5 cells were cultured to 90% confluence and then incubated for 1 h with differentiation medium containing 500 nM LDN-193189 (a BMPR1A receptor inhibitor) to inhibit BMPR1A receptor activity. Subsequently, HIPY peptides were added to final concentrations of 100 μM and 200 μM, respectively, and cultured for another 24 h. After culture, total cell protein was extracted, and protein concentration was determined using the BCA method. The expression levels of p-Smad1 / 5, Smad1 / 5, Runx2, and β-actin proteins were detected using the same method. Cell viability and ALP activity were also assessed in each treatment group.

[0099] like Figure 18 As shown in the BE results, the activation of the BMP / Smad signaling pathway by the tetrapeptide HIPY was blocked after the addition of the inhibitor, and the expression of p-Smad (Ser463 / 465) and Runx2 proteins were significantly decreased (P<0.01 or P<0.05), suggesting that the HIPY peptide acts on the BMP receptor protein (BMPR1A) and increases the expression level of Runx2 by activating the BMP / Smad signaling pathway. Furthermore, the cell proliferation-promoting activity of the tetrapeptide HIPY disappeared after the addition of the receptor inhibitor LDN, indicating that the BMP / Smad pathway is involved in the regulation of cell proliferation by peptides, and that the cell proliferation-promoting activity of the tetrapeptide HIPY is related to the activation of the BMP / Smad pathway. Regarding ALP activity, the addition of the LDN inhibitor decreased ALP activity by 11.18%. The tetrapeptide HIPY significantly promoted ALP expression at concentrations of 100 and 200 μM (11.82% and 26.59%, respectively). When cells were treated simultaneously with the inhibitor and the HIPY peptide, ALP activity showed no significant difference compared to the control group. These results further suggest that the BMP / Smad pathway is likely the only signaling pathway mediating the chondrogenic effect of HIPY.

[0100] In summary, the egg yolk peptide JYP described in this invention not only exhibits good activity in promoting chondrocyte differentiation and mineralization, but also promotes longitudinal bone growth in adolescent rats, increases bone strength and bone density, improves bone tissue microstructure, and increases serum insulin-like growth factor-1 (IGF-1) levels and bone alkaline phosphatase concentration in a dose-dependent manner. Furthermore, four active peptides contained in JYP were identified, with amino acid sequences of HIPY, LGPQ, MHPV, and NAHVPV, derived from egg yolk apolipoprotein and vitellinogen. Among them, the tetrapeptide HIPY promotes chondrocyte differentiation and mineralization by acting on BMP receptor protein, activating the BMP / Smad signaling pathway, enhancing p-Smad1 / 5 protein phosphorylation, and upregulating Runx2 protein expression. This invention provides an egg yolk peptide derived from non-yolk high-phosphorus protein that promotes longitudinal bone growth, along with its enzymatic preparation method, and clarifies the amino acid sequence of the active egg yolk peptide. This can serve as a high-end functional food ingredient for promoting longitudinal bone growth in adolescents, providing a reference for the high-value utilization of egg yolk components.

[0101] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention, or modify them into equivalent embodiments, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention, without departing from the content of the technical solutions of the present invention, shall still fall within the scope of protection of the present invention.

Claims

1. An egg yolk peptide that promotes longitudinal bone growth, characterized in that, The egg yolk peptide contains active peptide components that promote chondrocyte differentiation, including but not limited to HIPY, LGPQ, MHPV and NAHVPV; The preparation method includes the following steps: Step 1: Sift the defatted egg yolk powder and mix it with water. Sonicate the mixture to dissolve it completely, obtaining a mixed solution. Step 2: Adjust the pH of the mixture to 7.0-7.5, add 1.8-2.1% (by weight of defatted egg yolk powder) of trypsin for enzymatic hydrolysis, at a temperature of 36-38℃ for 2.5-3.5 hours; Step 3: Adjust the pH to 9.5-10, add 1.4%-1.6% of the defatted egg yolk powder by weight of alkaline protease for enzymatic hydrolysis, the hydrolysis temperature is 50-55℃, and the hydrolysis time is 2-3 hours; Step 4: Directly add 1.6%-2.0% of the weight of defatted egg yolk powder with keratinase, keep the enzymatic hydrolysis temperature constant, and continue enzymatic hydrolysis for 1-2 hours to obtain the enzymatic hydrolysate; Step 5: Heat the enzyme hydrolysate to above 90℃ for 10-20 min to inactivate the enzyme, remove the precipitate, and obtain the supernatant; Step 6: Concentrate the supernatant and freeze-dry it to obtain egg yolk peptides that promote longitudinal bone growth.

2. The egg yolk peptide with the function of promoting longitudinal bone growth according to claim 1, characterized in that, The mass of water mentioned in step 1 is 9-10 times the mass of the defatted egg yolk powder.

3. A composition comprising the yolk peptide of claim 1 that promotes longitudinal bone growth.

4. The use of the composition of the egg yolk peptide of claim 1 that promotes longitudinal bone growth or the composition of the egg yolk peptide of claim 3 that promotes longitudinal bone growth in the preparation of a product that promotes longitudinal bone growth.

5. The application according to claim 4, characterized in that, The products that promote longitudinal bone growth are dietary supplements, functional foods, health foods, and pharmaceuticals that help support the growth and development of the femur and tibia by promoting chondrocyte differentiation.

6. An active peptide derived from egg yolk that promotes chondrocyte differentiation, characterized in that, The active peptides are HIPY, LGPQ, MHPV, and NAHVPV.

7. The method for preparing the chondrocyte differentiation-promoting bioactive peptide derived from egg yolk according to claim 6, characterized in that, This includes, but is not limited to, enzymatic hydrolysis, microbial fermentation, and solid-phase chemical synthesis.

8. The use of the chondrocyte differentiation-promoting bioactive peptide derived from egg yolk according to claim 6 in the preparation of a pharmaceutical product that promotes longitudinal bone growth.

9. The application according to claim 8, characterized in that, The active peptide is one or more of HIPY, LGPQ, MHPV and NAHVPV.

Images