Application of TaNAC1-7A protein and its encoding gene in improving wheat disease resistance

Abstract

This invention discloses the application of the TaNAC1-7A protein and its encoding gene in improving wheat disease resistance. The invention first involves overexpression of this protein in wild-type wheat Kronos. TaNAC1-7A, The construction was transformed TaNAC1-7A Wheat, then through the process of turning TaNAC1-7A Stripe rust inoculation experiments were conducted on wheat and wild-type wheat Kronos materials. Phenotypic analysis revealed overexpression of... TaNAC1-7A It can enhance wheat's resistance to stripe rust. TaNAC1-7A protein and its related biomaterials will play an important role in breeding stripe rust-resistant wheat varieties.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of TaNAC1-7A protein and its encoding gene in improving wheat disease resistance. Background Technology

[0002] Wheat is one of the world's most important food crops, consumed as a staple by 40% of the global population. During its growth, wheat yield and quality are frequently threatened by various fungal diseases, such as stripe rust, stem rust, powdery mildew, and Fusarium head blight. Among these, wheat stripe rust is one of the most destructive and common diseases, reported in 88% of wheat-producing regions worldwide. Stripe rust fungi are widely distributed in nature; once they invade wheat, they disrupt the photosynthetic function of leaves, leading to stagnation of grain filling, decreased thousand-grain weight, and reduced yield, resulting in significant economic losses and environmental damage, causing over US$4 billion in losses annually worldwide.

[0003] Practice has proven that breeding wheat varieties resistant to stripe rust is the most scientific, effective, and environmentally friendly way to control the disease. Due to the rapid variation among stripe rust races, new pathogen genotypes possess stronger infectivity and can infect previously resistant wheat varieties. Therefore, the discovery of new disease-resistant genes is crucial for stabilizing wheat yields. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to regulate plant disease resistance.

[0005] To address the aforementioned technical problems, this invention first provides a novel use for the TaNAC1-7A protein.

[0006] This invention provides the use of TaNAC1-7A protein in any of the following A1)-A3): A1) Regulate plant disease resistance; A2) Developing transgenic plants with enhanced disease resistance; A3) Plant breeding; The TaNAC1-7A protein is any one of the following (B1)-B4): B1) The amino acid sequence of the protein is shown in sequence 2; B2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2. B4) is a protein that has 80% or more of the same amino acid sequence as shown in Sequence 2 and has the same function.

[0007] In the protein described in B2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag includes, but is not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, GFP (green fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0008] In some embodiments, the fusion protein is a TaNAC1 protein with a Myc tag at the N-terminus, the amino acid sequence of which is shown in Sequence 3.

[0009] In the protein described in B3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is as follows: substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0010] In the protein described in B4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the identity of a pair of amino acid sequences, the identity value (%) can then be obtained. The identity includes amino acid sequences that have 80% or higher homology with the amino acid sequence shown in Sequence 2 of this invention, or 85% or higher, or 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher.

[0011] The proteins described in B1)-B4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0012] To address the aforementioned technical problems, this invention also provides new uses for biomaterials related to the TaNAC1-7A protein.

[0013] This invention provides the application of biomaterials related to the above-mentioned TaNAC1-7A protein in any of the following A1)-A3): A1) Regulate plant disease resistance; A2) Developing transgenic plants with enhanced disease resistance; A3) Plant breeding; The biological material is a nucleic acid molecule encoding the TaNAC1-7A protein or an expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule; In the above applications, the nucleic acid molecule is any one of the following: F1) The DNA molecule shown in sequence 1; The nucleotide sequence defined by F2) has 75% or more identity with F1) and is a DNA molecule encoding the TaNAC1-7A protein.

[0014] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0015] Those skilled in the art can readily mutate the nucleotide sequence encoding the TaNAC1-7A protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence encoding the TaNAC1-7A protein, provided they encode the TaNAC1-7A protein and have the same function, are derived from and are equivalent to the nucleotide sequence of this invention.

[0016] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein composed of the amino acid sequence shown in Sequence 2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0017] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0018] In the above applications, the expression cassette refers to DNA capable of expressing the TaNAC1-7A protein in host cells, and this DNA may include, but is not limited to, promoters. TaNAC1-7A The promoter of transcription may also include a terminator. TaNAC1-7A Transcription terminators. Further, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcSE9 terminator, and carmine and octopine synthase terminator.

[0019] In the above applications, the vector refers to a vector that can carry the above nucleic acid molecules into the host cell for amplification and expression. The vector can be a cloning vector or an expression vector, including but not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage, etc.), granules (i.e., Cos plasmids), Ti plasmids, and viral vectors (such as retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, etc.).

[0020] The recombinant vector refers to a recombinant DNA molecule constructed by in vitro ligation of the aforementioned nucleic acid molecule with the vector. Existing plant expression vectors can be used to construct recombinant DNA molecules containing the aforementioned recombinant DNA. TaNAC1-7ARecombinant vectors for gene expression cassettes. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. The plant expression vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor, such as Agrobacterium crown gall tumor inducing (Ti) plasmid genes (e.g., carmine synthase genes). Nos The untranslated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) have similar functions. When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (e.g., those encoding enzymes that produce color changes). GUS Genes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes that confer resistance to the antibiotic hygromycin hph Genes, and the genes that confer resistance to methotrexate dhfr Genes that confer resistance to glyphosate EPSPS Genes such as herbicide-resistant marker genes or mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.

[0021] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi. Specifically, the bacteria can be Agrobacterium, such as Agrobacterium EHA105.

[0022] The recombinant microorganisms refer to those obtained by manipulating and modifying the genes of a target microorganism, resulting in a functional change. For example, recombinant microorganisms obtained after introducing the aforementioned recombinant vector into the target microorganism. The term "recombinant microorganism" can be understood not only to a specific recombinant microorganism but also to the offspring of such cells. Due to natural, accidental, or intentional mutations and / or alterations, the offspring may not necessarily be completely identical to the original parent cell, but are still included within the scope of recombinant microorganisms.

[0023] In the above applications, regulating plant disease resistance means enhancing plant disease resistance. This enhancement is manifested in the fact that plant disease resistance increases when the content and / or activity of TaNAC1-7A protein in the plant increases.

[0024] Furthermore, the improvement of plant disease resistance refers to improving plant resistance to stripe rust.

[0025] Furthermore, the improvement of plant stripe rust resistance is specifically manifested in: when the plant's... TaNAC1-7A When gene expression levels are increased, the incidence of disease in plants after inoculation with stripe rust fungus is reduced.

[0026] In the above applications, the purpose of plant breeding is to cultivate disease-resistant plant varieties (such as stripe rust-resistant plant varieties).

[0027] To address the aforementioned technical problems, the present invention ultimately provides a method for cultivating transgenic plants with enhanced disease resistance.

[0028] The method for cultivating transgenic plants with enhanced disease resistance provided by the present invention includes the following steps: increasing the content and / or activity of the above-mentioned TaNAC1-7A protein in the target plant to obtain a transgenic plant; the transgenic plant has higher disease resistance than the target plant.

[0029] In the above method, the disease resistance refers to stripe rust resistance.

[0030] Furthermore, the higher disease resistance of the transgenic plant compared to the target plant is manifested in the fact that the transgenic plant exhibits less disease incidence after inoculation with stripe rust fungus compared to the target plant.

[0031] Furthermore, the stripe rust pathogen is stripe rust pathogen CYR32.

[0032] In the above method, the method for increasing the content and / or activity of the TaNAC1-7A protein in the target plant is to overexpress the TaNAC1-7A protein in the target plant.

[0033] Furthermore, the overexpression method involves introducing the gene encoding the TaNAC1-7A protein into the target plant.

[0034] Furthermore, the nucleotide sequence of the gene encoding the TaNAC1-7A protein is shown in Sequence 1.

[0035] In any of the above applications or methods, the transgenic plant is understood to include not only the transgenic plant... TaNAC1-7A The first generation of transgenic plants obtained by transforming a recipient plant with a gene, including its progeny. For transgenic plants, the gene can be propagated within the species or transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus tissue, whole plants, and cells.

[0036] In any of the above applications or methods, the stripe rust may be stripe rust caused by the stripe rust fungus CYR32.

[0037] In any of the above applications or methods, the plant may be a monocotyledonous plant or a dicotyledonous plant.

[0038] Furthermore, the monocotyledonous plant may be a grass family (Poaceae).

[0039] Furthermore, the grasses mentioned may be plants of the genus Triticum.

[0040] Furthermore, the wheat species mentioned may be wheat.

[0041] In some implementations, the wheat is wild-type wheat, Kronos.

[0042] This invention first overexpresses wild-type wheat Kronos TaNAC1-7A, The construction was transformed TaNAC1-7A Wheat, then through the process of turning TaNAC1-7A Stripe rust inoculation experiments were conducted on wheat and wild-type wheat Kronos materials. Phenotypic analysis revealed that... TaNAC1-7A Overexpression of TaNAC1-7A protein can enhance wheat resistance to stripe rust. TaNAC1-7A protein and related biomaterials will play an important role in breeding stripe rust-resistant wheat varieties. Attached Figure Description

[0043] Figure 1 For the transfer TaNAC1-7A Wheat and wild-type wheat Kronos TaNAC1 The relative expression level of genes.

[0044] Figure 2 For overexpression TaNAC1-7A The effect on resistance to wheat stripe rust. A is... TaNAC1-7A The gene structure. B is a variant. TaNAC1-7A Phenotypes of wheat and wild-type wheat (Kronos) 14 days after inoculation with stripe rust fungus. C represents the phenotype after stripe rust inoculation. TaNAC1-7A Relative gene expression levels. (See figure)p The value indicates the significance level. D indicates that TaNAC1 protein can activate the expression of disease course-related (PR) genes. Detailed Implementation

[0045] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0046] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0047] The tetraploid durum wheat (Kronos) in the following examples is described in the literature "Chang CY, et al. (2013). Suppression of ZEAXANTHIN EPOXIDASE 1 restricts stripe rust growth inwheat. Plant Commun. 2023 Sep 11;4(5):100608."

[0048] The stripe rust fungus CRY32 described in the following examples is described in the literature "Yan, Y., et al. (2023). Phosphorylation of KAT-2B by WKS1 / Yr36 redirects the lipid flux to jasmonates to enhance resistance against wheat stripe rust. Journal of Genetics and Genomics 50: 872-882."

[0049] The pAbAi vector and pGADT7(AD) vector in the following examples are described in the literature "Gao Y, An K, Guo W, Chen Y, Zhang R, Zhang X, Chang S, Rossi V, Jin F, Cao X, Xin M, Peng H, Hu Z, Guo W, Du J, Ni Z, Sun Q, Yao Y. The endosperm-specific transcription factor TaNAC019 regulates glutenin and starch accumulation and its eliteallele improves wheat grain quality. Plant Cell. (2021) 33(3):603-622."

[0050] The amino acid sequence of the TaNAC1-7A protein in the following examples is shown in Sequence 2 of the sequence listing, and its encoding gene sequence is shown in Sequence 1 of the sequence listing.

[0051] Example 1, Transfer TaNAC1-7A Construction of wheat and detection of its disease resistance I. Transfer TaNAC1-7A wheat construction 1. Recombinant vector pGWB18-Ubi:: TaNAC1-7A Construction Using the Gateway method to sequence 1 TaNAC1-7A The gene was ligated into the pDONR207 vector (Invitrogen, CAT#:11791020) to obtain the recombinant vector pDONR207-TaNAC1-7A, which was then sequenced for verification. Sequencing results showed that: TaNAC1-7A The gene has no point mutations.

[0052] The recombinant vector pDONR207-TaNAC1-7A, the pGWB18 vector (NCBI: AB289781.1), and the recombinase (ThermoFisher Scientific, Cat. No. 11791020) were mixed and reacted overnight at 22°C to produce the sequence shown in Sequence 1. TaNAC1-7A Gene recombination was performed between attR1 (AAACAAGTTTGTACAAAAAA) and attR2 (TTTCTTGTACAAAGTGG) of the pGWB18 vector to obtain the recombinant vector pGWB18-Ubi:: TaNAC1-7A Recombinant vector pGWB18-Ubi:: TaNAC1-7AThe TaNAC1 protein with an N-terminal Myc tag is expressed. The amino acid sequence of the TaNAC1 protein with an N-terminal Myc tag is shown in Sequence 3.

[0053] 2. Obtaining recombinant bacteria The recombinant vector pGWB18-Ubi:: TaNAC1-7A The bacteria were transferred into Agrobacterium EHA105 (Weidi Biotechnology, CAT#:AC1010) to obtain the recombinant strain pGWB18-Ubi:: TaNAC1-7A / EHA105.

[0054] 3. Turn TaNAC1-7A wheat harvest Wild-type wheat Kronos, in good growth condition, was selected as the recipient. Genetic transformation was performed via embryo removal using Agrobacterium pGWB18-Ubi:: TaNAC1-7A After infection and differentiation, / EHA105 was screened to obtain transgenic cells. TaNAC1-7A Wheat strains.

[0055] 4. TaNAC1 Expression level detection Detection and transfer TaNAC1-7A wheat lines and wild-type wheat Kronos TaNAC1 Relative expression level. The specific steps are as follows: 1) RNA extraction For wheat plants at the same growth stage, cut 0.1g of wheat leaves from the same location, crush them in liquid nitrogen, add 1mL of RNAiso plus (Takara, Cat No. 9108), mix by inversion, and incubate on ice for 5 min; then add 200µL of chloroform:isopropanol = 24:1 (v / v), mix by inversion, incubate on ice for 5 min, and centrifuge at 12000g for 15 min at 4℃; transfer the top layer to a new 2.0mL centrifuge tube, add 200µL of chloroform, and mix by inversion; transfer the top layer to a new 2.0mL centrifuge tube, avoiding the middle layer; add an equal volume of isopropanol, mix, incubate on ice for 10 min, and centrifuge at 12000g for 10 min at 4℃, the RNA precipitate will be at the bottom; discard the supernatant, keep the precipitate, wash the precipitate with 1mL of 75% ethanol, centrifuge at 8000g for 10 min at 4℃, repeat the washing twice; after drying the precipitate at room temperature, use RNA-free... Dissolve the RNA precipitate with H2O (20-30µL).

[0056] 2) Reverse transcription Add the reagents shown in Table 1 to 200 μL centrifuge tubes in sequence. Centrifuge briefly to collect all components to the bottom of the tube, mix well, incubate at 42°C for 2 min, cool on ice, and then add the components shown in Table 2.

[0057] Table 1

[0058] Table 2

[0059] All components were collected to the bottom of the tube and mixed thoroughly. The reaction was then carried out under the following conditions: 37°C for 15 min; 85°C for 5 s; cooled on ice. The resulting cDNA was stored at -20°C for later use.

[0060] 3) qRT-PCR Real-time quantitative PCR (qRT-PCR) was performed using cDNA as a template, with wheat as the template. TaActin The gene was used as an internal reference gene, and the results of real-time quantitative PCR were analyzed using a comparison threshold method, where C (relative expression level) = 2. -△CT △Ct = Target gene Ct value - Internal reference gene Ct value (Ct value is the cycle number at a specific fluorescence threshold), using a two-tailed isovariance model. t The testing method was used for verification. The primer sequences are as follows: qRT-PCR-F: CCCAAGGCCACCATCTGAAGAAGT; qRT-PCR-R: AAGCTCATCGATCCCCTGAGG.

[0061] The reaction system for real-time PCR is shown in Table 3.

[0062] Table 3

[0063] The procedure for quantitative real-time PCR is as follows: pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 15 s, annealing at 60℃ for 15 s, extension and reading at 72℃ for 20 s.

[0064] Quantitative real-time PCR was performed using a CFX96™ Real-Time System (BIO-RAD) PCR instrument, with each sample replicated three times.

[0065] The results are as follows Figure 1 As shown, the results indicate that compared to wild-type wheat Kronos, the converted wheat variety... TaNAC-7A wheat lines #2 and #12 TaNAC1 The relative expression level increased significantly. (Selected transfections) TaNAC-7A Wheat lines #2 and #12 were used in the following disease resistance analysis experiments.

[0066] II. Transfer TaNAC-7A Disease resistance testing of wheat lines Detection and transfer TaNAC-7AThe stripe rust resistance of wheat lines #2 and #12 to wild-type wheat Kronos was investigated. The specific testing procedures were described in the literature “Wang, S., et al. (2019). YR36 / WKS1-mediated phosphorylation of PsbO, an extrinsic member of photosystem II, inhibits photosynthesis and confers stripe rust resistance in wheat. Molecular plant 12(12): 1639-1650.” Specifically, wheat seeds were placed in a petri dish and hydroponically cultured at 4℃ to ensure uniform germination. The germinated seeds were then cultured in a light incubator with a photoperiod of 16 hours light / 8 hours darkness at 20℃. Once the wheat seedlings reached the two-leaf-one-heart stage, they were inoculated with stripe rust fungus CRY32 spores. The specific inoculation steps are as follows: First, suspend fresh stripe rust fungus CRY32 spores on the surface of tap water. Then, use a pin to evenly spread the stripe rust fungus spores onto the wheat leaves to be inoculated, being careful not to apply too much, and spray with water mist to keep the soil moist. After all materials have been inoculated, place the materials in a humidity chamber and treat them in the dark at 16℃ for 24 hours. Then, remove the materials and continue to cultivate them under the conditions of 16℃ ambient temperature and a photoperiod of 16 hours light / 8 hours dark. After about 14 days, observe the disease status of the leaves and record the phenotype according to the 9-level grading standard in the literature "Zhang Gensheng, Study on the Biological Characteristics and Sexual Genetic Variation of a New Strand of Yr5 Pathogenic Wheat Stripe Rust Fungus, Northwest A&F University". Grades 0-6 are non-virulent, and grades 7-9 are virulent (Line and Qayoum 1992; Chen and Kang 2017).

[0067] The results are as follows Figure 2 As shown in Figure B. The results showed that dense clusters of stripe rust spores (grades 7-9) were visible at the inoculation sites of wild-type wheat (Kronos) leaves, while those of the transformed wheat... TaNAC-7A Wheat lines showed numerous chlorotic and necrotic spots at the inoculation site on leaves, with very few uredinia (grades 0-3). Compared to wild-type wheat Kronos, the transgenic wheat... TaNAC-7A Wheat strains are less susceptible to stripe rust.

[0068] The above studies indicate that overexpression TaNAC1-7A Genes can enhance resistance to wheat stripe rust.

[0069] Example 2 TaNAC1-7A Gene expression induced by stripe rust fungus Testing the effects of inoculation of the susceptible wheat variety Vuka with CYR32 stripe rust race at different time points (2 days, 7 days, and 11 days).TaNAC1-7A Gene expression levels were measured, with uninoculated stripe rust (day 0) serving as a control (CK).

[0070] The results are as follows Figure 2 As shown in Figure C, the results indicate that compared to uninoculated (day 0), the susceptible variety Vuka inoculated with stripe rust fungus CYR32 showed a significantly lower incidence of infection. TaNAC1-7A The gene expression level showed a significant upward trend, indicating that TaNAC1-7A The gene is induced to express by stripe rust fungus and is involved in the process of wheat responding to stripe rust infection.

[0071] Example 3: TaNAC1 protein can activate the expression of disease course-related (PR) genes. The effect of TaNAC1 protein on the expression of disease progression-related (PR) genes was detected using the Matchmaker® Gold Yeast One-Hybrid Library Screening System kit (TaKaRa, Japan). The experimental methods were performed according to the Matchmaker® Gold Yeast One-Hybrid Library Screening System kit (TaKaRa, Japan) instructions. The specific steps included: 1. Construction of recombinant plasmids Using wild-type wheat Kronos genomic DNA as a template, PCR amplification was performed using PR1a-Y1H-F (ATTGAAAAGCTTGAATTCGAGCTCTCCAACGCATGACTTTGCAC) and PR1a-Y1H-R (CAGAGCACATGCCTCGAGGTCGACCGTATAGCTTGAGTATAGAGGG) to obtain... PR1a Promoter. PR1a The promoter was ligated to the pAbAi vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novizan, China) to obtain the PR1a-pAbAi recombinant plasmid.

[0072] The TaNAC1 CDS sequence was ligated into the pGADT7(AD) vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Novizan, China) to obtain the NAC-AD recombinant plasmid.

[0073] 2. Transformation of yeast with recombinant plasmids PR1a-pAbAi recombinant plasmid for BstBI restriction enzyme digestion was used for linearization, and the digestion product was purified. 100 ng of the digestion product, 10 μL of carrier DNA (YT0003, Coolerbot, China), 50 μL of Y1HGold yeast competent cells, and 500 μL of PEG / LiAc were gently mixed; incubated at 30°C for 30 min (rotating 6-8 times every 15 min); incubated in a 42°C water bath for 15 min (rotating 6-8 times every 7.5 min); centrifuged at 5000 rpm for 40 s; the supernatant was discarded, and the cells were resuspended in 400 μL of ddH2O; centrifuged at 5000 rpm for 40 s, and the supernatant was discarded; the cells were resuspended in 50 μL of ddH2O, plated on SD / -Ura plates, and incubated at 30°C for 3 days. The NAC-AD recombinant plasmid was transformed into yeast competent cells containing the PR1a-pAbAi recombinant plasmid via PEG / LiAc media. The cells were then plated on SD / -Leu solid medium and incubated at 30°C for 3-5 days, during which yeast growth was observed. The transformed yeast cells were then diluted with sterile physiological saline to obtain OD... 600nm For concentrations of 0.02, 0.002, and 0.0002, pipette 10 μL onto SD / -Ura solid medium containing different concentrations (600 ng / mL, 800 ng / mL) of Aureobasidin A (AbA, yeast toxin-aureobasidin A), incubate at 28°C for 3-5 days, and take photos.

[0074] The results are as follows Figure 2 As shown in Figure D, the results indicate that TaNAC1 protein can activate the expression of disease course-related (PR) genes.

[0075] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of TaNAC1-7A protein in any of the following (A1)-A3): A1) Regulate plant disease resistance; A2) Developing transgenic plants with enhanced disease resistance; A3) Plant breeding; The TaNAC1-7A protein is any one of the following (B1)-B4): B1) The amino acid sequence of the protein is shown in sequence 2; B2) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in Sequence 2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2. B4) is a protein that has 80% or more of the same amino acid sequence as shown in Sequence 2 and has the same function.

2. Use of biomaterials related to the TaNAC1-7A protein of claim 1 in any of the following A1)-A3): A1) Regulate plant disease resistance; A2) Developing transgenic plants with enhanced disease resistance; A3) Plant breeding; The biological material is a nucleic acid molecule encoding the TaNAC1-7A protein or an expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule.

3. The application according to claim 2, characterized in that: The nucleic acid molecule is any one of the following: F1) The DNA molecule shown in sequence 1; The nucleotide sequence defined by F2) has 75% or more identity with F1) and is a DNA molecule encoding the TaNAC1-7A protein.

4. The application according to any one of claims 1-3, characterized in that: The regulation of plant disease resistance aims to improve plant disease resistance.

5. The application according to any one of claims 1-4, characterized in that: The disease resistance mentioned refers to resistance to stripe rust.

6. A method for cultivating transgenic plants with enhanced disease resistance, comprising the following steps: increasing the content and / or activity of the TaNAC1-7A protein as described in claim 1 in the target plant to obtain the transgenic plant; wherein the transgenic plant has higher disease resistance than the target plant.

7. The method according to claim 6, characterized in that: The disease resistance mentioned refers to resistance to stripe rust.

8. The method according to claim 6 or 7, characterized in that: The method for increasing the content and / or activity of TaNAC1-7A protein in the target plant is to overexpress TaNAC1-7A protein in the target plant.

9. The method according to any one of claims 6-8, characterized in that: The overexpression method involves introducing the gene encoding the TaNAC1-7A protein into the target plant; Alternatively, the nucleotide sequence of the gene encoding the TaNAC1-7A protein is shown in Sequence 1.

10. The application according to any one of claims 1-5 or the method according to any one of claims 6-9, characterized in that: The plant is a monocotyledonous plant or a dicotyledonous plant.

Images