CsXCP2 variants engineered for citrus disease resistance and their application in citrus resistance to Huanglongbing (HLB).

Abstract

This invention discloses an engineered CsXCP2 variant of the citrus disease resistance protein CsXCP2 and its application in citrus resistance to Huanglongbing (HLB). The amino acid sequence of the CsXCP2 variant is shown in SEQ ID NO. 9. The binding ability of CsXCP2-mut2 to the effector SDE10 is significantly weakened. This variant retains moderate substrate processing activity and can still mediate the hydrolytic cleavage of downstream target protein CsPR1 and the degradation of the HLB pathogenic protein SahA in the presence of SDE10. Overexpression of CsXCP2-mut2 can significantly increase PLCP activity and salicylic acid content in citrus and effectively reduce the titer of HLB in citrus. The CsXCP2-mut2 of this invention can escape the recognition and inhibition of the effector SDE10 while retaining moderate immune function, which can significantly enhance the resistance of sweet orange to HLB and has important breeding application value.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an engineered CsXCP2 variant of the citrus disease resistance protein CsXCP2 and its application in citrus resistance to Huanglongbing (HLB). Background Technology

[0002] Citrus is one of the world's most important economic crops. In recent years, my country's citrus industry has developed rapidly, currently accounting for about one-third of the world's output and ranking first in the world in terms of industry scale. Citrus Huanglongbing (HLB), caused by the fungus Huanglongbing, is the most devastating bacterial disease affecting the global citrus industry, posing a serious threat to the green and sustainable development of the global citrus industry. Huanglongbing is a phloem-restricted Gram-negative bacterium belonging to the phylum Proteobacteria, α- Class Alpha proteobacteria, Order Rhizobiales, Family Rhizobiaceae, Genus Bacillus phloem Candidatus Citrus fruits infected with Huanglongbing (HLB) exhibit abnormal color change (commonly known as "red-nosed fruit"), are deformed, and have poor flavor; root development is poor, leading to rotting in severe cases; plant growth is significantly inhibited, yield decreases, and ultimately, the tree dies. Currently, there is no effective treatment for HLB. Disease control mainly relies on chemical pesticides to control the vector, the citrus psyllid, and the felling of diseased trees. This approach is not only costly and puts significant pressure on the ecological environment, but also makes complete eradication difficult.

[0003] In the long process of co-evolution, the Asian species of Huanglongbing fungus ( Candidatus Liberibacterasiaticus C Las) has developed a highly complex and sophisticated pathogenic mechanism. During the infection process, CLas can secrete various effector factors into host cells, weakening the plant's immune system by targeting or inhibiting key host defense proteins, thus creating favorable conditions for systemic infection and colonization. In recent years, artificial intelligence (AI)-assisted protein design has been used to precisely modify the structure of core host defense proteins, specifically blocking the toxicity of pathogen effector factors while preserving or enhancing the host's own immune activation activity. This is a cutting-edge strategy for breeding broad-spectrum, durable disease-resistant citrus varieties. For example, AI-designed pectin methylesterase inhibitors can inhibit pathogen activity, while modified cold shock protein receptor variants can confer broad-spectrum resistance to multiple pathogens. Papain-like cysteine ​​proteases (PLCPs) are an important class of plant immune proteases that have been repeatedly targeted by pathogen effector factors in various plants, thus becoming important candidate targets in disease resistance molecular design and resistance engineering. Previous studies have shown that... C The key pathogenic factor SDE10 secreted by Las can inhibit the activity of CsXCP2, a member of the PLCP family, thereby disrupting the salicylic acid-mediated defense response and ultimately promoting... C Las infection of host plants. Therefore, developing CsXCP2 variants that can evade SDE10 recognition while maintaining their normal biological functions is of great significance for improving citrus resistance to Huanglongbing (HLB) and promoting its comprehensive control. However, a precise design method that can simultaneously maintain CsXCP2 protein activity and weaken its SDE10 binding ability is currently lacking. Therefore, how to use AI-assisted protein design technology to target and modify CsXCP2 to obtain protein variants that possess both normal immune function and the ability to inhibit effector factors remains a pressing technical problem to be solved in this field. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide an engineered CsXCP2 variant of the citrus disease resistance protein CsXCP2 and its application in citrus resistance to Huanglongbing (HLB). The CsXCP2-mut2 variant of this invention breaks the targeting inhibition of the HLB effector SDE10 in terms of spatial structure, while retaining moderate immune activity. In the presence of the effector SDE10, this variant can still mediate the cleavage of the downstream target protein CsPR1 and the degradation of the HLB pathogenic protein SahA, triggering and promoting the systemic accumulation of salicylic acid (SA) in the host plant, significantly improving the plant's resistance to citrus HLB.

[0005] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a variant of the citrus disease resistance protein CsXCP2, named CsXCP2-mut2, whose amino acid sequence is shown in SEQ ID NO.9.

[0006] The present invention also provides a gene encoding the above-mentioned variant CsXCP2-mut2. CsXCP2-mut2 The gene CsXCP2-mut2 The nucleotide sequence is shown in SEQ ID NO.8.

[0007] The present invention also provides a gene containing the above-mentioned gene. CsXCP2-mut2 The recombinant expression vector is a plant expression vector.

[0008] The present invention also provides a genetically engineered bacterium containing the above-described expression vector.

[0009] The following are applications of improving the resistance of sweet orange plants to citrus Huanglongbing (HLB), among which, (1) The above-mentioned genes CsXCP2-mut2 ; (2) The aforementioned expression carriers; (3) The above-mentioned genetically engineered bacteria.

[0010] The present invention also provides a method for improving the resistance of sweet orange plants to citrus Huanglongbing, comprising the steps of introducing the above-mentioned expression vector or the above-mentioned genetically engineered bacteria into sweet orange plant cells or transforming them into sweet orange plants for overexpression.

[0011] The application of one of the following in the breeding of citrus Huanglongbing-resistant plant varieties, among which, (1) The above-mentioned genes CsXCP2-mut2 ; (2) The aforementioned expression carriers; (3) The above-mentioned genetically engineered bacteria.

[0012] The present invention also provides a method for cultivating plants resistant to citrus Huanglongbing (HLB), comprising introducing and expressing the following (1) or (2): (1) The above-mentioned genes CsXCP2-mut2 ; (2) The above-mentioned citrus fruits CsXCP2 overexpression vector pCAMBIA1300 CsXCP2-mut2 (Compared to wild type) CsXCP2 It can better resist Huanglongbing bacteria.

[0013] Furthermore, the plant is a sweet orange; the method specifically involves: using the gene encoding the CsXCP2 variant... CsXCP2-mut2The transgenic sweet orange plants with stable expression of the variant gene were obtained by introducing the gene into plants under the regulation of an exogenous promoter and through genetic transformation.

[0014] This invention also provides a sweet orange plant variety resistant to citrus Huanglongbing (HLB), wherein the plant variety contains the aforementioned gene. CsXCP2-mut2 .

[0015] The beneficial effects of this invention are: The three-dimensional structure of the complex between the Huanglongbing (HLB) effector SDE10 and the host protein CsXCP2 was predicted using AlphaFold2, and key amino acid residues (including the catalytic triplet) that may mediate their interaction were screened. Subsequently, single-amino acid substitution variants (C158A, H294A, N314A), two-site variants (H294A / N314A, mut2), and three-site variants (C158A / H294A / N314A, mut3) were designed and created. Structural confidence analysis showed that single-site mutations in CsXCP2 had a relatively small impact on binding to SDE10, while the CsXCP2-mut2 and CsXCP2-mut3 variants significantly reduced the interaction with SDE10 (a composite score greater than or equal to 0.75 was considered high confidence). In vitro pull-down experiments further confirmed that the binding ability of CsXCP2-mut2 to SDE10 was significantly weakened. Figure 1 ).

[0016] Further investigation was conducted to determine the ability of various CsXCP2 variants to cleave the downstream substrate CsPR1 and degrade the pathogenic protein SahA from Huanglongbing (HLB). The results showed that CsXCP2-C158A resulted in the complete loss of both activities; while CsXCP2-mut2 retained moderate substrate processing activity. The catalytic activity of wild-type CsXCP2 was significantly inhibited upon the addition of the effector SDE10; conversely, the activity of CsXCP2-mut2 was not significantly affected, indicating that this variant can maintain its enzyme activity in the presence of SDE10. Figure 2 ).

[0017] Furthermore, Agrobacterium-mediated infection was utilized. C Las's SDE10 transgenic citrus stem segments were induced to produce transgenic citrus hairy roots that stably expressed the CsXCP2-mut2 variant. CsXCP2-mut2 -OE), with wild-type CsXCP2 ( CsXCP2-OE) was used as a control. Results showed that overexpression of wild-type CsXCP2 (CsXCP2-WT) in the wild-type (WT) background significantly increased PLCP activity and SA content, but overexpression of CsXCP2-WT in the SDE10 expression background had no effect; however, overexpression of CsXCP2-mut2 in both WT and SDE10 transgenic backgrounds significantly increased PLCP activity and SA content. Meanwhile, C Las bacterial count analysis revealed that overexpression of CsXCP2-mut2 under the SDE10 transgenic background significantly reduced [the bacterial count]. C Las titer, while CsXCP2-WT has no such effect ( Figure 3 These data show that CsXCP2-mut2 can evade SDE10 recognition and retain some immune function, thereby increasing the immunity of citrus fruits. C The resistance to Las confirms its excellent value in engineered disease-resistant applications. Attached Figure Description

[0018] Figure 1 The figure shows the interaction results between different variants of CsXCP2 and the effector SDE10.

[0019] Where A is a simulation diagram of the complex interaction interface based on AlphaFold2 prediction; B is the interaction prediction confidence score table; C is a schematic diagram of the domains and sites of CsXCP2 wild-type and its variants; D is a diagram showing the results of the in vitro pull-down interaction.

[0020] Figure 2 The figure shows the effect of the CsXCP2 variant on the catalytic activity of the substrate and the effect of SDE10 on the activity of CsXCP2-mut2.

[0021] In the figure, A and B are the cleavage activities of each variant on the substrate CsPR1 and the degradation activities of SahA, respectively. Figures C and D show the effects of SDE10 on the inhibition of CsPR1 cleavage activity and SahA degradation activity mediated by the bivariate mut2.

[0022] Figure 3 For overexpression CsXCP2-mut2 Enhance citrus C Las resistance diagram.

[0023] Among them, A is a photograph of hairy root genetic transformation under the background of SDE10 transgenic background; B is a Western blot analysis plot; C is a graph showing the determination of PLCP activity in transgenic citrus; Figures D and E show the changes in relative expression levels and SA content of each transgenic sweet orange line under transient expression, respectively. F is a graph showing the determination of endogenous SA content in a stable transgenic system; G represents a stable transgenic system. C Las titer detection graph. Detailed Implementation

[0024] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0025] Example 1: Citrus Huanglongbing Resistance Gene CsXCP2 get With sweet oranges CsXCP2 Primer pairs designed using genes as templates CsXCP2- The F / R ratio was obtained by PCR amplification, and the primer sequences are as follows: CsXCP2 -F: 5'-ATGGCTCTTTCTTCACAGTTTAAG-3', as shown in SEQ ID NO.2. CsXCP2 -R: 5'-TCACTTCTTTTTAATGGGATAAGAAGC-3', as shown in SEQ ID NO.3; The PCR reaction system is as follows (total volume 20 μl): The reaction program was as follows: 95℃, 3 min; 95℃, 15 s; 55℃, 15 s; 72℃, 30 s; 72℃, 5 min; 35 cycles; PCR product gel detection and recovery: PCR products were detected by agarose gel electrophoresis.

[0026] Sweet orange CsXCP2 The gene is the citrus Huanglongbing resistance gene. CsXCP2 The encoding nucleotide sequence is shown in SEQ ID NO.1.

[0027] Example 2: Design and modification of CsXCP2 based on structural prediction To inhibit the binding of the effector factor SDE10 to the host's core immune target CsXCP2, this study employed structural biology-guided protein engineering to target and modify CsXCP2. Using AlphaFold2, we predicted the three-dimensional interaction interface of the SDE10-CsXCP2 complex, identifying key amino acid residues mediating the binding of the two proteins. The three-dimensional simulation diagram of the complex interaction interface is shown below. Figure 1As shown in Figure A. Based on the above information, this study employed a site-directed mutagenesis strategy to create single-amino acid substitution variants (CsXCP2-C158A, CsXCP2-H294A, CsXCP2-N314A), two-site variants (H294A / N314A, CsXCP2-mut2), and three-site variants (C158A / H294A / N314A, CsXCP2-mut3). The distribution of the catalytic domains and mutation sites in the wild-type CsXCP2 and each variant is shown in Figure A. Figure 1 As shown in Figure C. The binding ability of different CsXCP2 variants to SDE10 was assessed using the complex prediction confidence composite score (IPTM*0.8+PTM*0.2≥0.75). The analysis showed that single-amino acid site mutations in CsXCP2 had limited effect on disrupting the binding, while the binding scores of the two-site variant CsXCP2-mut2 and the three-site variant CsXCP2-mut3 to SDE10 were significantly reduced. Figure 1 B).

[0028] In vitro pull-down results showed that, compared with the strong interaction signal exhibited by CsXCP2-WT, the binding ability of the dual variant CsXCP2-mut2 to the effector factor SDE10 was significantly weakened. Figure 1 D). This result confirms at the biochemical and molecular levels that the aforementioned engineering modifications successfully weakened the binding between SDE10 and CsXCP2.

[0029] Example 3: Obtaining the CsXCP2-mut2 sequence With sweet oranges CsXCP2 Primer pairs designed using genes as templates CsXCP2- mut2 - The F / R ratio was obtained by PCR amplification, and the primer sequences are as follows: CsXCP2-mut2-F1: 5'-ATGGCTCTTTCTTCACAGTTTAAG-3', as shown in SEQ ID NO.4, CsXCP2-mut2-R1: 5'-CATGATCGCTTCACAATTATGTAATCCAGGCCTCTGGT AGATCCATATCCAACGGCTGCCACTCCTCGGTC-3', as shown in SEQ ID NO.5; CsXCP2-mut2-F2: 5'- GACCGAGGAGTGGCAGCCGTTGGATATGGATCTACCA GAGGCCTGGATTACATAATTGTGAAGCGATCATG-3', as shown in SEQ ID NO. 6, CsXCP2-mut2-R2: 5'-TCACTTCTTTTTAATGGGATAAGAAGC-3', as shown in SEQ ID NO.7; The PCR reaction system is as follows (total volume 20 μl): The reaction program was as follows: 95℃, 3 min; 95℃, 15 s; 55℃, 15 s; 72℃, 30 s; 72℃, 5 min; 35 cycles; PCR product gel detection and recovery: PCR products were detected by agarose gel electrophoresis.

[0030] Sweet orange CsXCP2-mut2 The gene is the citrus Huanglongbing resistance gene. CsXCP2-mut2 The encoded nucleotide sequence is shown in SEQ ID NO.8.

[0031] The corresponding CsXCP2 variant is named CsXCP2-mut2, and its protein amino acid sequence is shown in SEQ ID NO.9.

[0032] Example 4: Determination of substrate processing activity of different CsXCP2 variants This embodiment systematically evaluated the ability of various CsXCP2 variants to cleave the plant endogenous protein CsPR1 and degrade the pathogenic protein SahA. This was achieved through testing on *Nicotiana benthamiana* (…). Nicotiana benthamiana The CsXCP2 variants expressed in China were compared with CsPR1 or SahA. Western blot (WB) analysis was used to detect changes in the abundance of CsPR1 cleavage products and SahA proteins. Analysis showed that CsXCP2-C158A resulted in a complete loss of its substrate processing activity; in contrast, the targeted two-amino acid variant CsXCP2-mut2, designed in this study, maintained moderate substrate processing activity and continued to mediate the hydrolytic cleavage of CsPR1 and the degradation of the pathogenic protein SahA. Figure 2 A and 2B). The processing activity of CsXCP2-mut2 on the substrate was detected in the presence of the effector factor SDE10. The Western blot results are as follows: Figure 2 C and Figure 2 As shown in D. The results showed that the activity of CsXCP2-WT was significantly inhibited in the presence of SDE10; conversely, the CsPR1 cleavage and SahA degradation bands mediated by the variant CsXCP2-mut2 were not significantly interfered with, breaking the targeted inhibition of the disease-fighting protein CsXCP2 by SDE10.

[0033] Example 5 Citrus CsXCP2-mut2 Overexpression vector pCAMBIA1300- CsXCP2-mut2 Build Using the sweet oranges of Example 3 CsXCP2-mut2 Primer pairs designed using genes as templates CsXCP2-mut2 The citrus fruit was obtained by PCR amplification using -C-FLAG-1300-F / R, and expressed via homologous recombination linked to the pCAMBIA1300 vector, driven by the 35S promoter. Electrophoresis and sequencing analysis confirmed the successful yield of the citrus fruit. CsXCP2 The overexpression vector was named pCAMBIA1300 CsXCP2-mut2 The specific experimental steps are as follows: 1. Citrus CsXCP2-mut2 Gene amplification According to sweet oranges CsXCP2-mut2 Primers were designed based on the CDS sequence of the gene for PCR amplification. The primer sequences are as follows: PCR amplification primers: CsXCP2-mut2 -C-FLAG-1300-F: 5'- GACACGCGGGCCCATGGCTCTTTCTTCACAGTTTAAG-3', as shown in SEQ ID NO.10, CsXCP2-mut2 -C-FLAG-1300-R: 5'-CCCATTAAAAAGAAGGATTACAAGGACGACGATGACAAGTGAGAGCTC GAATTTC-3', as shown in SEQ ID NO.11; The PCR reaction system is as follows (total volume 20 μl): The reaction program was as follows: 95℃, 3 min; 95℃, 15 s; 55℃, 15 s; 72℃, 30 s; 72℃, 5 min; 35 cycles; 2. PCR product detection and recovery: PCR products were detected by agarose gel electrophoresis. The target fragment was recovered using the BIOMIGA gel recovery kit. 3. The pCAMBIA1300 vector, digested with ApaI and SacI, and the annealing product were ligated using homologous recombinase and transformed into competent E. coli cells. Plasmids were extracted to obtain... CsXCP2-mut2 Gene overexpression vector pCAMBIA1300 CsXCP2-mut2 .

[0034] 4. Product transformation: Transform the product into DH5α competent cells, following the guidelines for molecular cloning experiments.

[0035] 5. Sequencing and Identification: After PCR identification of positive clones, sequencing analysis is performed. Plasmids are extracted from successfully sequenced single-clone strains, which are then identified as citrus strains. CsXCP2-mut2 overexpression vector CAMBIA1300 CsXCP2-mut2 .

[0036] Example 6 Overexpression CsXCP2-mut2 Improve the effects of citrus C Las resistance This embodiment evaluates the results by constructing stable transgenic lines. CsXCP2-mut2 Variants in infection C Resistance to reconstructed host citrus in the SDE10 transgenic background of Las C Las's abilities.

[0037] 1. Induction of stable transgenic citrus lines mediated by Agrobacterium rhizogenes The plant overexpression vector (such as pCAMBIA1300-) will be used. CsXCP2-mut2 The recombinant plasmid was transformed into Agrobacterium rhizogenes ( Agrobacterium rhizogenes The strain was MSU440. (Infected with...) C Las created a stable transgenic citrus material based on SDE10 transgenic citrus. CsXCP2-mut2 The specific steps for creating a genetically modified strain are as follows: Agrobacterium rhizogenes was cultured at 28°C until OD500 was reached. 600 =0.6; Add exogenous acetosyringone (AS) to the resuspended solution to a final concentration of 20 mg / L, and activate it by standing at 28°C for 1 h; completely immerse the prepared citrus material in the activated Agrobacterium suspension, and vacuum treat it at 28°C for 20 min; after infection, transfer the stem segments to sandy medium, culture them in the dark for 7 days at 28°C, and then culture them under normal light conditions (8 / 16 h) for about 1 month to induce hairy roots.

[0038] To confirm successful transformation of the target gene, proteins were extracted from the hairy roots of transgenic sweet orange and detected by Western blotting using a FLAG antibody. The results showed that the target gene was successfully expressed in the hairy roots of citrus. Figure 3 B). In order to detect CsXCP2-mut2 The effect of PLCP protease activity was investigated by extracting apoplast juice from transgenic sweet orange leaves and labeling the PLCP activity in the apoplasts with the DCG-04 probe, followed by Western blotting analysis using a streptavidin-HRP antibody. The results showed that in transgenic sweet orange plants, CsXCP2 and CsXCP2-mut2 Both can significantly enhance PLCP activity; under the SDE10 transgenic background, overexpression CsXCP2-WT It had no significant effect on increasing PLCP activity, but overexpression CsXCP2-mut2 In the positive lines, PLCP activity was significantly enhanced ( Figure 3 C). In order to evaluate CsXCP2-mut2 The effects on citrus immunity were investigated by collecting transient transgenic samples (…). Figure 3 D) and stable transgenic systems ( Figure 3 B) Citrus tissue samples. The SA content was determined by high performance liquid chromatography-mass spectrometry (HPLC-MS). CsXCP2-WT It significantly increased SA content in the control group, but lost this activity in the SDE10 transgenic background. CsXCP2 - mut2 Both of these backgrounds can significantly increase SA content ( Figure 3 E and 3F).

[0039] To further verify CsXCP2 -mut2 pairs C The effect of Las resistance was investigated by taking 0.10 g of tissue samples from different transgenic citrus positive lines, extracting total DNA using the CTAB method, and then using Taqman qPCR with primer / probe combinations to detect Huanglongbing pathogens. C Las copy number.

[0040] The primers used are as follows: HLB-probe: 5'-AGACGGGTGAGTAACGCG-3', as shown in SEQ ID NO.12. COX-probe: 5'-ATCCAGATGCTTACGCTGG-3', as shown in SEQ ID NO.13; HLB-F: 5'-TCGAGCGCGTATGCGAATACG-3', as shown in SEQ ID NO.14. HLB-R: 5'-GCGTTATCCCGTAGAAAAAGGTAG-3', as shown in SEQ ID NO.15; COX-F: 5'-GTATGCCACGTCGCATTCCAGA-3', as shown in SEQ ID NO.16. COX-R: 5'-GCCAAAACTGCTAAGGGCATTC-3', as shown in SEQ ID NO.17.

[0041] The bacterial load of Huanglongbing bacteria was detected using qPCR, and the detection primers were from... CThe 16S rRNA gene of Las was used as an internal reference gene, specifically the mitochondrial gene of citrus: cytochrome oxidase (COX). COX was used to test the comparability of DNA quality and initial DNA concentration. qPCR quantitative analysis showed that... CsXCP2 It can significantly reduce the level in the control group. C Las content, but not in the SDE10 transgenic background. It is worth noting that... CsXCP2 -mut2 can be significantly reduced in both contexts. C Las titer ( Figure 3 G). Data indicate that this variant can resist the suppression of plant immunity by SDE10, thereby improving the citrus's resistance to... C The resistance to Las demonstrates excellent prospects for engineered disease-resistant applications.

[0042] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A variant of the citrus disease resistance protein CsXCP2, characterized in that: The variant is named CsXCP2-mut2, and its amino acid sequence is shown in SEQ ID NO.

9.

2. A gene encoding the variant CsXCP2-mut2 of claim 1. CsXCP2-mut2 Its features are: The gene CsXCP2-mut2 The nucleotide sequence is shown in SEQ ID NO.

8.

3. A gene containing the gene of claim 2 CsXCP2-mut2 The recombinant expression vector is characterized by: The recombinant expression vector is a plant expression vector.

4. Genetically engineered bacteria containing the expression vector of claim 3.

5. The application of one of the following in improving the resistance of sweet orange plants to citrus Huanglongbing (HLB), among which, (1) The gene according to claim 2 CsXCP2-mut2 ; (2) The expression vector according to claim 3; (3) The genetically engineered bacteria according to claim 4.

6. A method for improving the resistance of sweet orange plants to citrus Huanglongbing (HLB), characterized in that: The method includes the step of introducing the expression vector of claim 3 or the genetically engineered bacteria of claim 4 into sweet orange plant cells or transforming them into sweet orange plants for overexpression.

7. The application of one of the following in the breeding of citrus Huanglongbing-resistant plant varieties, among which, (1) The gene according to claim 2 CsXCP2-mut2 ; (2) The expression vector according to claim 3; (3) The genetically engineered bacteria according to claim 4.

8. A method for cultivating plants resistant to citrus Huanglongbing (HLB), characterized in that, This includes introducing and expressing the following into plants: (1) or (2) (1) The gene according to claim 2 CsXCP2-mut2 ; (2) The citrus fruit according to claim 3 CsXCP2 overexpression vector pCAMBIA1300 CsXCP2-mut2 .

9. The method according to claim 8, characterized in that: The plant in question is a sweet orange.

10. A sweet orange variety resistant to citrus Huanglongbing (HLB), characterized by: The sweet orange variety contains the gene described in claim 2. CsXCP2-mut2 .

Images