Biotransformation strain E212 of mogroside V and its application

CN122563740APending Publication Date: 2026-08-14SHANGHAI UNIV OF T C M
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-17
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

[0007]针对现有技术中罗汉果稀有皂苷天然含量低、化学转化选择性差、生物转化体系缺乏高效功能菌株等问题,本发明的目的在于提供一种卷枝毛霉(Mucor circinelloides)菌株E212及其应用

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122563740A_ABST
    Figure CN122563740A_ABST
Patent Text Reader

Abstract

This invention discloses a biotransformation strain E212 of mogroside V and its application. This strain is classified and named *Mucor* (…). Mucor circinelloides Strain E212, with accession number GDMCC NO:67902, was screened from soil in the habitat of *Siraitia grosvenorii* and exhibits natural adaptability and selective hydrolysis ability for mogroside V. Using this strain or its fermentation broth / metabolites, mogroside V can be efficiently converted into high-value-added rare mogroside (mogroside IIIE). This biotransformation method features mild reaction conditions, good selectivity, and environmental friendliness, effectively overcoming the shortcomings of poor selectivity and easy destruction of product structure in chemical hydrolysis methods. It significantly improves the enrichment and purification efficiency of the target product and has good prospects for industrial application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and natural product development technology. Specifically, it relates to a strain of Mucor truncatula E212 derived from the soil of the Siraitia grosvenorii habitat and its biotransformation system, as well as the application of the Mucor truncatula E212 strain or its metabolites in the biotransformation of Siraitia grosvenorii saponin V to prepare rare Siraitia grosvenorii saponin (Siraitia grosvenorii saponin IIIE), providing technical support for the high-value utilization of Siraitia grosvenorii resources. Background Technology

[0002] Monk fruit (Siraitia grosvenorii) is the dried fruit of the Siraitia grosvenorii plant, belonging to the Cucurbitaceae family. It is one of my country's traditional medicinal and edible resources, long used for clearing heat and moistening the lungs, relieving sore throat and hoarseness, and promoting bowel movements. It has a wide range of applications in the food and traditional Chinese medicine fields. Modern research shows that monk fruit is rich in various active ingredients, including flavonoids, polysaccharides, and triterpenoid saponins, among which triterpenoid saponins are considered its main functional components. The chemical structural formula of monk fruit saponin V is shown in (I).

[0003] (I)

[0004] Monk fruit saponins, with mogroside as the parent nucleus, form various structural types through modifications of glucose groups with different numbers and linkages. Current research suggests that the number and linkage of glucose groups in the saponin molecule (such as β-1,2 or β-1,6 bonds) significantly influence its physicochemical properties and biological activities. Some monk fruit saponins with shorter sugar chains and lower relative molecular weights, such as monk fruit saponin IIIE, exhibit advantages in solubility, absorption, and biological activity, and have high application value in functional foods and pharmaceuticals. However, the content of these rare monk fruit saponins in natural monk fruit is extremely low, making direct extraction difficult and limiting their further development and utilization. Monk fruit saponin V, as one of the most abundant triterpenoid saponins in monk fruit, has relatively long glucose chains linked at both the C-3 and C-24 positions, accounting for more than half of the total monk fruit saponins, and is considered an important potential precursor for the preparation of rare monk fruit saponins. Therefore, using mogroside V as a raw material to prepare rare mogrosides through selective deglycosylation reaction has high economic benefits and promising prospects for industrial application.

[0005] Currently, the main methods for preparing rare monk fruit saponins include plant extraction, chemical transformation, and biotransformation. Plant extraction is a relatively mature process, but it is limited by the low content of rare saponins in the raw materials, often resulting in low extraction efficiency and high purification costs. Chemical transformation can break glycosidic bonds under acidic or alkaline conditions, but this method has harsh reaction conditions, poor selectivity, and is prone to over-hydrolysis or destruction of the parent nucleus structure, producing many byproducts and making it difficult to achieve targeted hydrolysis of specific glycosidic bonds, which is not conducive to the preparation of high-value-added rare saponins. In contrast, biotransformation utilizes microorganisms or enzymes to modify the structure of natural products, offering advantages such as mild reaction conditions and high selectivity, showing certain advantages in the structural transformation of triterpenoid saponins. Studies have reported that some fungi or bacteria can selectively hydrolyze or transform ginsenosides and other triterpenoid saponins to obtain rare saponin products with high application value.

[0006] However, research on the targeted biotransformation of mogroside V remains limited, particularly regarding the lack of mature reports on functional microorganisms or related biocatalytic systems capable of efficiently and selectively hydrolyzing the target glycosidic bonds in mogroside V to generate specific rare mogrosides. Furthermore, microbial resources derived from the ecological environment of mogroside and naturally adapted to mogrosides have not been systematically developed. Therefore, developing a biotransformation technology capable of efficiently and selectively converting mogroside V to prepare rare mogrosides remains of significant research value and practical application importance. Summary of the Invention

[0007] To address the problems of low natural content of rare mogrosides from monk fruit, poor selectivity in chemical transformation, and lack of highly efficient functional strains in biotransformation systems in existing technologies, the present invention aims to provide a *Mucor circinelloides* strain E212 and its applications. This strain E212 enables a biotransformation method for the selective hydrolysis of mogroside V, achieving efficient preparation of rare mogrosides (mogroside IIIE), thereby reducing production costs, improving transformation efficiency, and meeting the needs of industrial applications.

[0008] This invention utilizes a systematic screening of naturally adaptable functional microbial strains from the soil of *Siraitia grosvenorii* habitats to construct a biotransformation system centered on these strains, their fermentation broth, or metabolites. This system enables the selective hydrolytic transformation of mogroitin V into rare mogroitin IIIE. The biotransformation system features mild reaction conditions, high selectivity, and strong substrate adaptability, making it suitable for mogroitin V raw materials of varying sources and purities, and possesses excellent potential for industrial scale-up.

[0009] The objective of this invention can be achieved through the following technical solutions:

[0010] In a first aspect, the present invention seeks protection for a Mucor circinelloides strain E212 with the biotransformation ability of mogroside V, wherein the Mucor circinelloides strain E212 has the accession number GDMCC NO:67902 and was deposited on March 9, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0011] Secondly, the present invention seeks protection for the use of the above-mentioned Mucor strain E212 in the following (a1) or (a2):

[0012] (a1) Application in the preparation of rare mogrosides from mogroside V through biotransformation;

[0013] (a2) Application in the preparation of microbial preparations for the biotransformation of mogroside V to prepare rare mogrosides.

[0014] Furthermore, the application in (a1) includes at least one of the following methods:

[0015] (b1) The above-mentioned Mucor strain E212 was used for fermentation culture, and the fermentation broth was directly used as a biotransformation system to convert mogroside V into rare mogroside.

[0016] (b2) After fermenting the above-mentioned Mucor strain E212, the fermentation supernatant was collected and used to biotransform mogroside V.

[0017] (b3) The *Mucor* strain E212 was directly added to the reaction system containing mogroside V to carry out a biotransformation reaction.

[0018] Thirdly, the present invention claims protection for a biotransformation system comprising two components, (c1) and (c2):

[0019] (c1) The above-mentioned Mucor strain E212;

[0020] (c2) Monk fruit saponin V substrate.

[0021] Fourthly, this invention seeks protection for the application of the above-described biotransformation system in the preparation of rare mogrosides.

[0022] Fifthly, this invention claims protection for a method for preparing rare mogrosides by biotransformation of mogroside V, wherein the rare mogrosides are prepared using the above-mentioned biotransformation system, and the reaction conditions include: a reaction temperature of 20~40℃, a reaction pH of 4.0~8.0, a biotransformation time of 2~10 days, and a feed concentration of mogroside V of 0.5~15 g / L (preferably 1.25~15 g / L).

[0023] Preferably, the reaction conditions include: a reaction temperature of 20~30℃, a reaction pH of 4.0~7.0, a biotransformation time of 4~7 days, and a feed concentration of mogroside V of monk fruit of 1.25~10 g / L.

[0024] As a specific implementation method, the reaction conditions include: the reaction temperature is preferably 25 ℃, the reaction pH is preferably 6.0, the biotransformation time is preferably 7 days, and the concentration of the substrate mogroside V in the reaction system is preferably 2.5 ~ 5 g / L.

[0025] Sixthly, the present invention seeks protection for the use of mogroside IIIE prepared by biotransformation of mogroside V using the above-mentioned Mucor strain E212 in the preparation of food, pharmaceutical or pharmaceutical intermediates.

[0026] Furthermore, the aforementioned food, pharmaceutical, or medical intermediates serve as raw materials for the preparation of sweetener precursors, functional ingredients, or active pharmaceutical ingredients.

[0027] In the technical solution of this invention, the rare monk fruit saponin is monk fruit saponin IIIE;

[0028] This invention screens a strain of *Mucor circinelloides*, strain E212. This strain E212 was isolated and screened from the soil of *Siraitia grosvenorii* habitat and exhibits natural adaptability and selective hydrolysis ability for mogroside V, making it a functional strain of fungal origin. Using strain E212, a method is developed to transform mogroside V to prepare rare mogroside (mogroside IIIE). The mogroside V can be industrial-grade or food-grade.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] This invention achieves the targeted biotransformation of mogroside V from monk fruit by screening the E212 strain of Mucor rotundifolia derived from the soil of monk fruit habitat, thus avoiding the problems of poor selectivity and severe structural damage in chemical hydrolysis.

[0031] The described Mucor strain E212 exhibits natural adaptability to mogroside V, high conversion efficiency, and mild reaction conditions, which is beneficial for the enrichment and purification of the target rare mogroside (mogroside IIIE).

[0032] This invention provides the application of *Mucor* strain E212 and its fermentation broth or metabolites in the conversion of mogroside V. This method uses abundant and stable mogroside V as a raw material, providing a feasible technical route for the large-scale, green production of rare mogrosides (mogroside IIIE). This biotransformation system exhibits good versatility, stability, selectivity, and promising prospects for industrial application. Attached Figure Description

[0033] Figure 1 Analysis of fermentation products for screening strain E212.

[0034] Figure 2 Phylogenetic tree analysis for strain E212.

[0035] Figure 3 The results show the optimization of biotransformation conditions for mogroside V from strain E212; where A represents the effect of pH on product yield, B represents the effect of temperature on product yield, and C represents the effect of substrate concentration on product yield.

[0036] Figure 4 The image shows the TOF / MS2 spectrum of the fermentation products of strain E212.

[0037] Information on the preservation of biological materials

[0038] Mucor circinelloides strain E212, with accession number GDMCC NO:67902, was deposited on March 9, 2026, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510075, China. Detailed Implementation

[0039] The following embodiments are provided to illustrate the present invention, making its technical content clearer and easier to understand. The present invention can be embodied through different embodiments. The following are exemplary descriptions. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the present invention.

[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; and the materials and reagents used are commercially available unless otherwise specified.

[0041] Example 1

[0042] Soil samples from the habitat of *Siraitia grosvenorii* were collected by the research group in the main planting areas of *Siraitia grosvenorii* in Guilin. After sampling, the samples were transported to the laboratory at low temperature and stored at 4 ℃ for later use. 5 g of soil sample was weighed and added to 50 mL of sterile water. The mixture was shaken at 28 ℃ and 180 r / min for 30 min to fully disperse the microbial cells. After serial dilution, an appropriate amount of the diluted solution was spread onto PDA solid medium plates and incubated at 28 ℃. Colony morphology was observed, and colonies of different morphologies were repeatedly streaked for purification until the color and morphological distribution of the grown colonies were consistent. The purified strains were then inoculated into a solid medium for strain selection using *Siraitia grosvenorii* saponin V as the sole carbon source. The solid culture medium for screening the strains consisted of: 5.0 g crude mogroside V, 2.0 g KH₂PO₄, 5.0 g NH₄NO₃, 0.5 g NaCl, 0.4 g MgSO₄·7H₂O, 0.04 g ZnSO₄·7H₂O, and 18 g agar, diluted to 1 L with double-distilled water and sterilized at 121 °C for 20 min. Based on the growth of the strains, functional strains capable of utilizing mogroside V were preliminarily screened to provide candidate strains for subsequent transformation activity verification.

[0043] Example 2

[0044] Freshly cultured bacterial cells were scraped from the solid bacterial strain selection medium and resuspended in sterile water to prepare a bacterial suspension. To ensure the reproducibility of the experiment, all bacterial cells used were derived from fresh colonies under the same culture conditions. Approximately 80 mg of bacterial cells were scraped and added to 8 mL of sterile water to prepare the bacterial suspension. This ensured that the concentration of the bacterial suspension remained relatively stable across batches. Therefore, those skilled in the art can prepare the bacterial suspension in the same manner and repeat the experiment at an inoculum size of 1% (v / v).

[0045] The purified bacterial suspension was inoculated at a rate of 1% (v / v) into a liquid screening medium with mogroside V (5 g / L) as the sole carbon source. The liquid screening medium consisted of: 5.0 g crude mogroside V, 2.0 g KH₂PO₄, 5.0 g NH₄NO₃, 0.5 g NaCl, 0.4 g MgSO₄·7H₂O, and 0.04 g ZnSO₄·7H₂O. Double-distilled water was added to a final volume of 1 L, and the medium was sterilized at 121 °C for 20 min. Aerobic fermentation was then carried out at 28 °C and 180 r / min for 7 days. After fermentation, a sample of the fermentation broth was collected and centrifuged at 6000 r / min for 10 min to obtain the supernatant. The supernatant was analyzed by TLC, with the developing solvent consisting of n-butanol, ethanol, and water (volume ratio 8:3:0.5), and the colorimetric reagent being a 10% (v / v) sulfuric acid-ethanol solution containing 2% (w / v) vanillin. Further HPLC analysis was used to identify the hydrolysis products of mogroside V produced by the strain, and strains with the ability to transform mogroside V were screened for subsequent studies.

[0046] Example 3

[0047] HPLC analysis: The liquid chromatography instrument was an Agilent 1260 HPLC system; the column was a ZORBAX Eclipse Plus C18 (4.6 mm × 250 mm, 5 μm); the mobile phase was ultrapure water-acetonitrile; the linear gradient elution program was: 0–20 min, 23% (v / v) acetonitrile; 0–25 min, 23%–33% (v / v) acetonitrile; 25–35 min, 33%–45% (v / v) acetonitrile; 35–40 min, 45%–80% (v / v) acetonitrile; 40–45 min, 80%–90% (v / v) acetonitrile; the column temperature was 30 ℃; the flow rate was 1.0 mL / min; the injection volume was 10 μL; and the detection was performed at 205 nm UV wavelength. HPLC was used to analyze the linearity and range of the chromatogram. A standard curve was constructed using the mass concentration (X, mg / mL) of the control solution as the X-axis and the peak area (Y, AU*s) as the Y-axis for subsequent quantitative analysis of the transformation products. Preparation of the reference solution: Accurately weigh mogroside V and mogroside IIIE reference standards into volumetric flasks, dissolve them in methanol, and dilute to volume with shaking to obtain the reference solution.

[0048] Mass spectrometry analysis was performed using an AB Sciex TripleTOF 5600+ mass spectrometer in negative ion scanning mode. TOFMS-Product Ion-IDA mode was used to acquire mass spectrometry data, with the scan range set to 100–1500 m / z. Nebulizer gas (GS1) and nebulizer gas (GS2) were both set to 344.738 kPa (50 psi), and curtain gas (CUR) was set to 241.317 kPa (35 psi). The ion source temperature (TEM) was maintained at 550 °C, and the ion source voltage (IS) was set to 4500 V. During the first scan, the declustering voltage (DP) was set to 100 V, and the focusing voltage (CE) was set to 10 V; during the second scan, the declustering voltage (DP) was set to 100 V, and the focusing voltage (CE) was set to 40 V.

[0049] Example 4

[0050] This study used soil samples from the habitat of *Siraitia grosvenorii* (monk fruit) as bacterial samples and isolated multiple morphologically diverse microorganisms on PDA medium. Different strains exhibited diversity in colony color, texture, and edge morphology, indicating a rich and complex microbial community in the *Siraitia grosvenorii* habitat soil. Strain E212 colonies were white and cottony, with rapid hyphal growth. To screen strains with saponin hydrolysis capabilities, the isolated strains were inoculated into solid and liquid screening media using *Siraitia grosvenorii* saponin V (MV) as the sole carbon source, and their fermentation products were detected. HPLC analysis showed that the MV peak did not change significantly in the first 3 days of fermentation, but decreased significantly from days 4 to 7, while the product peak gradually increased, indicating that transformation mainly occurred in the later stages of fermentation. After 7 days of fermentation, preliminary TLC screening results showed that several strains could significantly weaken the MV spots and generate new spots, suggesting that they possess preliminary triterpenoid saponin hydrolysis capabilities.

[0051] Example 5

[0052] Strains exhibiting hydrolytic ability of mogroside V (MV) in the initial screening were further quantitatively analyzed by HPLC, and the structure of the transformation products was confirmed by ESI-MS / MS secondary mass spectrometry. The results showed that the main peak area of ​​MV in the fermentation broth of several strains decreased significantly, while a new peak with a retention time consistent with the standard mogroside IIIE (MIIIE) appeared, indicating that the strains can selectively hydrolyze MV and generate corresponding rare mogroside products.

[0053] For strain E212 (e.g.) Figure 1As shown in the HPLC chromatogram, a new peak appears at a retention time of approximately 26 min. Comparison with the standard confirms that the conversion product is mogroside IIIE. This indicates that strain E212 has the ability to efficiently convert MV to mogroside IIIE. The TOF / MS2 chromatogram of the fermentation product from strain E212 is shown below. Figure 4 As shown.

[0054] Wherein, product yield (%) = (Cp×Ms) / (Cs×Mp) ×100%, Cp: concentration of mogroside IIIE (mg / mL), Mp: molecular weight of the product, Cs: concentration of initial substrate mogroside V (mg / mL) in the reaction system, and Ms: molecular weight of the substrate. All biotransformation experiments were performed in triplicate, and the data are expressed as mean ± standard deviation (SD).

[0055] The transformation process of mogroside V into mogroside IIIE under the action of microorganisms is shown below:

[0056]

[0057] The transformation capabilities varied among different strains, with some strains exhibiting higher product peak areas, indicating strong saponin transformation potential. Compared to existing reports of transforming bacteria from limited sources, this invention screened multiple functional strains with significant MV hydrolysis capabilities from the soil of the *Siraitia grosvenorii* habitat, demonstrating the high application value of this habitat microbial resource in the biotransformation of rare *Siraitia grosvenorii* saponins. Among the screened strains, strain E212 demonstrated high MV degradation efficiency and target product generation capacity in both primary and secondary screening, and was therefore selected as the representative strain for subsequent molecular identification and product structure confirmation.

[0058] Example 6

[0059] Strains were collected from PDA plates, and fungal genomic DNA was extracted using the CTAB method. The specific procedure was as follows: mycelia were thoroughly ground in 800 μL of CTAB lysis buffer, incubated at 65 °C for 30 min, then an equal volume of chloroform / isoamyl alcohol (24:1) was added, and the mixture was centrifuged at 12000 r / min for 5 min. The supernatant was collected. 0.6–0.8 volumes of isopropanol were added to precipitate the DNA, and the mixture was centrifuged at 12000 r / min for 10 min. The precipitate was washed with 70% (v / v) ethanol, dried, and dissolved in 50 μL of TE buffer for later use. DNA extracted from the strain was amplified using the universal primer pairs ITS1F (TCCGTAGGTGAACCTGCGG) / ITS4R (TCCTCCGCTTATTGATATGC). The PCR reaction mixture consisted of: 10 ng template, 10 μL 5×Buffer, 2 μL dNTPs (2.5 mM), 0.5 μL FastPfu Polymerase, 1 μL primer F (5 μM), 1 μL primer R (5 μM), and H2O to a final volume of 50 μL. The PCR program was: 95 °C pre-denaturation for 5 min, 95 °C denaturation for 30 s, 55 °C annealing for 45 s, 72 °C extension for 1 min, 30 cycles, and a final extension at 72 °C for 10 min. The amplified DNA product was subjected to 1% agarose gel electrophoresis, and the purified DNA was then sequenced. The amplified sequences were input into the NCBI database for BLAST alignment (http: / / www.ncbi.nlm.nih.gov / BLAST). Strains with the highest sequence similarity to the strain were selected. Multiple sequences were aligned using MEGA software, and a phylogenetic tree was constructed based on evolutionary distance. A phylogenetic tree (e.g., ) was constructed by amplifying, sequencing, and aligning the ITS sequence of strain E212. Figure 2 (As shown). The results showed that strain E212 and Mucorcircinelloides clustered together, belonging to the same evolutionary clade, and were identified as belonging to the genus Mucor sp.

[0060] Example 7

[0061] To clarify the taxonomic position and phylogenetic relationship of the screened strains, molecular identification was performed on E212. PCR amplification of the ITS region of E212 was performed using the universal primer pair ITS1F (TCCGTAGGTGAACCTGCGG) / ITS4R (TCCTCCGCTTATTGATATGC). The amplified products were validated by electrophoresis and then sequenced, followed by BLAST alignment in the NCBI database. The results showed that the ITS sequence of strain E212 had over 98% similarity to its corresponding reference strain, indicating that the sequencing results were reliable and suitable for species identification. BLAST results showed that strain E212 had the highest identity with *Mucor circinelloides* (GenBank accession number: MT365974.1).

[0062] To ensure the availability and reproducibility of the strains described in this invention, the functional strains involved in this invention have been deposited at the Guangdong Microbial Culture Collection Center (GDMCC). The deposit information is as follows:

[0063] Mucor circinelloides strain E212 was deposited on March 9, 2026, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), with accession number GDMCC NO:67902. The deposit address is Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, 510075, China.

[0064] Example 8

[0065] The effects of pH, temperature, and different substrate concentrations on biotransformation yield were investigated using single-factor experiments. Activated bacterial strains were inoculated into PDB medium and cultured at 28 ℃ with shaking at 180 r / min for 24 h. The resulting bacterial culture was used as a seed culture and added to the fermentation system (liquid strain screening medium) at a 1% (v / v) inoculation rate. The activated bacteria were cultured at different pH values ​​(4.0, 5.0, 6.0, 7.0, and 8.0) at 180 r / min and 28 ℃ for 7 days to examine their effect on transformation efficiency. Samples were periodically taken, filtered, and analyzed by HPLC. The optimal pH range was determined based on the changes in the yield of mogroside IIIE.

[0066] Based on the optimal pH conditions, the mixture was cultured at 20 ℃, 25 ℃, 30 ℃, 35 ℃, and 40 ℃ with shaking at 180 r / min for 7 days. After the culture, the changes in the contents of mogroside IIA and mogroside IIIE in the culture medium were determined by HPLC, and the product yield was calculated to evaluate the effect of temperature on the conversion reaction, thereby determining the optimal fermentation temperature.

[0067] Finally, under the determined optimal temperature and pH conditions, the effects of different substrate concentrations (1.25 g / L, 2.5 g / L, 5 g / L, 10 g / L, 15 g / L) on the conversion efficiency were investigated to evaluate the role of substrate concentration in the conversion process of mogrosides.

[0068] Optimization results of strain E212 (e.g.) Figure 3 (as shown)

[0069] pH effect: This strain has a wide pH tolerance range, with the highest product yield (approximately 83.0%) at pH 6.0, and maintains high activity between pH 5.0 and 7.0 (e.g., ...). Figure 3 (As shown in A in the diagram).

[0070] Temperature effect: The optimal conversion temperature is 25 ℃. The yield remains high even at 30 ℃, but the conversion activity is significantly inhibited when the temperature rises to 40 ℃ (e.g., ...). Figure 3 (As shown in B in the diagram).

[0071] Effect of substrate concentration: Within the substrate concentration range of 2.5 g / L to 5.0 g / L, the conversion yield of MIIIE remained at its highest level (approximately 83.0%), demonstrating good substrate tolerance; when the concentration exceeded 5 g / L, the conversion efficiency was inhibited and decreased (e.g., Figure 3 (as shown in C).

[0072] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A strain of *Mucor circinelloides*, E212, possessing the biotransformation ability of mogroside V, characterized in that... The Mucor circinelloides strain E212 has the accession number GDMCCNO:67902.

2. The use of the *Mucor* strain E212 according to claim 1 in either (a1) or (a2): (a1) Application in the preparation of rare mogrosides from mogroside V through biotransformation; (a2) Application in the preparation of microbial preparations for the biotransformation of mogroside V to prepare rare mogrosides.

3. The application according to claim 2, characterized in that, The application in (a1) includes at least one of the following methods: (b1) The above-mentioned Mucor strain E212 was used for fermentation culture, and the fermentation broth was directly used as a biotransformation system to convert mogroside V into rare mogroside. (b2) After fermenting the above-mentioned Mucor strain E212, the fermentation supernatant was collected and used to biotransform mogroside V. (b3) The *Mucor* strain E212 was directly added to the reaction system containing mogroside V to carry out a biotransformation reaction.

4. The application according to claim 2, characterized in that, The rare monk fruit saponin is monk fruit saponin IIIE.

5. A biotransformation system, characterized in that, It contains the following two components: (c1) and (c2): (c1) The Mucor strain E212 as described in claim 1; (c2) Monk fruit saponin V substrate.

6. The application of the biotransformation system according to claim 5 in the preparation of rare monk fruit saponins.

7. The application according to claim 6, characterized in that, The rare monk fruit saponin mentioned is monk fruit saponin IIIE.

8. A method for preparing rare mogrosides by biotransformation of mogroside V, characterized in that, Rare mogrosides are prepared using the biotransformation system described in claim 5, wherein the rare mogrosides are mogroside IIIE; the reaction conditions include: a reaction temperature of 20-40℃, a reaction pH of 4.0-8.0, a biotransformation time of 2-10 days, and a feed concentration of mogroside V of 0.5-15 g / L; preferably, the reaction conditions include: a reaction temperature of 20-30℃, a reaction pH of 4.0-7.0, a biotransformation time of 4-7 days, and a feed concentration of mogroside V of 1.25-10 g / L.

9. The application of mogroside IIIE prepared by biotransformation of mogroside V using the Mucor strain E212 of claim 1 in the preparation of food, pharmaceutical or pharmaceutical intermediates.

10. The application according to claim 9, characterized in that, The aforementioned food, pharmaceutical, or medical intermediates serve as raw materials for the preparation of sweetener precursors, functional ingredients, or active pharmaceutical ingredients.