A white-fleshed Ganoderma lucidum strain L5470 and its cultivation method and application
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-05
- Publication Date
- 2026-08-14
AI Technical Summary
过度采摘不仅直接导致灵芝种群数量的减少,还会破坏其自然繁殖能力,进而引发资源枯竭的风险
[0027]营养功能上,菌株L5470营养成分优势鲜明,多糖含量达1.68%,较对照菌株的1.23%提升36.6%,而多糖作为灵芝调节免疫、抗肿瘤的核心活性成分,其高含量赋予菌株更高的药用价值;同时,该菌株脂肪含量仅0.8g/100g,较对照降低42.9%,更符合健康消费需求,且菌香味浓、苦味淡,兼顾药用与食用体验。
Smart Images

Figure CN122563744A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a white-fleshed Ganoderma lucidum strain L5470 and its cultivation method and application. Background Technology
[0002] Reishi mushrooms are fungi belonging to the phylum Basidiomycota, class Agaricomycetes, order Polyporales, family Ganodermataceae, and genus Ganoderma. They are widely distributed in my country, especially abundant in Yunnan, Hainan, Guangxi, and Sichuan provinces (autonomous regions). Yunnan Province, with its unique topography and geographical location, has diverse climate types and is known as the "Kingdom of Wild Mushrooms," making it the core distribution area of wild reishi resources in my country.
[0003] Ganoderma leucocontextum, belonging to the kingdom Fungi, phylum Basidiomycota, class Agaricomycetes, order Polyporals, family Ganodermataceae, and genus Ganoderma, is a large, edible and medicinal fungus that thrives in low- to medium-temperature environments. Its main characteristics include a white fleshy texture and high content of triterpenes and polysaccharides. Wild Ganoderma leucocontextum is mainly distributed in the high-altitude, cool regions of southwestern China, including Yunnan, Tibet, and Sichuan.
[0004] With increasing market demand, the harvesting volume of Ganoderma lucidum has been rising year by year, leading to a serious threat of over-harvesting to Ganoderma lucidum resources in some areas. Over-harvesting not only directly reduces the population of Ganoderma lucidum but also damages its natural reproductive capacity, thus triggering the risk of resource depletion. Therefore, finding a sustainable way to supply Ganoderma lucidum raw materials is particularly urgent. Thus, based on Yunnan's abundant wild Ganoderma lucidum resources, and using systematic selection breeding methods to breed late-maturing white-fleshed Ganoderma lucidum varieties suitable for cultivation in Yunnan, is crucial for the comprehensive development of Yunnan's Ganoderma lucidum industry and has significant implications for rural revitalization. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a white-fleshed Ganoderma lucidum strain L5470 and its cultivation method and application.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides a white-fleshed Ganoderma lucidum strain L5470, which was deposited on October 23, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 67155.
[0007] The second aspect of this invention provides a method for cultivating the white-fleshed Ganoderma lucidum strain L5470, comprising the following steps: Step A, Propagation of Mother Culture: Under aseptic conditions, take tissue blocks of Ganoderma lucidum strain L5470 and inoculate them onto the mother culture PDA medium. Incubate at 24℃ for 10-12 days to obtain mycelial blocks. The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 19-21 parts agar powder, 1.9-2.1 parts potassium dihydrogen phosphate, and 990-1010 parts water; Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture in a shaker at 22.5-23.5℃ for 8-10 days to obtain the seed liquid; The shake flask culture medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 1.9-2.1 parts soybean meal, 0.39-0.41 parts potassium dihydrogen phosphate, 0.19-0.21 parts calcium chloride, and 990-1010 parts water, with a pH of 7.5-8.5. Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 22.5-23.5℃ for 8-11 days to obtain liquid inoculum; The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2350-2450 parts glucose, 190-210 parts soybean meal, 115-125 parts potassium dihydrogen phosphate, 59-61 parts calcium chloride, 99000-101000 parts water, with a pH value of 7.5-8.5. Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a constant temperature incubator at 23℃; The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 73-75 parts hardwood sawdust, 3.8-5.2 parts cottonseed hulls, 17-19 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.9-1.1 parts lime powder; pH value 6-8, moisture content 55-65%; Step E, Soil Covering Cultivation and Harvesting: After the mycelium in the cultivation bags has fully grown, transport them to the commercial forest cultivation base and pile them on the ground in a shaded area to continue post-ripening for 5-7 days. Make ridges along the slope of the forest land, with a ridge width of 1-1.2m and a length depending on the forest land. The ditch depth is 30-35cm. Then, open the bags with small holes, tilt them at a 45° angle, and cover them with soil for planting. When the pale yellow growth ring on the edge of the cap disappears and spores are released, the fruiting bodies can be harvested.
[0008] Furthermore, in step D, the cells are incubated at a constant temperature for 34-40 days.
[0009] Furthermore, in step E, the commercial forests include walnut forests and Chinese pine forests.
[0010] Furthermore, in step E, five mushroom sticks are planted horizontally on the ridge.
[0011] Furthermore, in step E, commercial forests with a canopy closure of 7.5-8 do not require shading, forests with a canopy closure greater than 8 are not suitable for planting, and forests with a canopy closure less than 7.5 can control the light intensity at 1800-3200 Lux by building small arched sheds.
[0012] Furthermore, in step E, the light intensity is adjusted by covering the small arched shed with a 3-6 needle shade net.
[0013] Furthermore, in step E, if the weekly rainfall is greater than 30 mL, cover the small arched shed with a white plastic film to protect it from rain and keep it warm.
[0014] The third aspect of this invention provides the application of the mycelium, fruiting body or fermentation broth of the white-fleshed Ganoderma lucidum strain L5470 in the preparation of drugs with hepatoprotective, anti-inflammatory and anti-tumor effects.
[0015] The fourth aspect of this invention provides the use of the mycelium, fruiting body or fermentation broth of the white-fleshed Ganoderma lucidum strain L5470 in the preparation of drugs that enhance human immunity.
[0016] In this invention, the mushrooms begin to emerge when the rainy season arrives and the soil and air humidity rise simultaneously. When there is excessive rainfall, such as when the weekly rainfall exceeds 30 mL, a white plastic film is placed under the shade net of a small arched shed to protect against rain and keep warm. The fruiting bodies can be harvested when the pale yellow growth ring on the edge of the cap disappears and spores are released.
[0017] White-fleshed Ganoderma lucidum strain L5470 was collected by the breeding group from wild white-fleshed Ganoderma lucidum resources near decaying dead wood in Majie Town, Nanhua County, Chuxiong Prefecture, Yunnan Province, China, at an altitude of 1850m. This variety was selected and bred using selective breeding methods through strain isolation, trait purification, primary screening, secondary screening, intermediate trials, demonstration cultivation, and widespread planting. It is a strain with a short growth cycle and stable traits. When the fruiting body of white-fleshed Ganoderma lucidum strain L5470 is not fully mature, the cap is mostly nearly round and yellowish-brown. When fully mature, the cap is mostly round, with a high glossy lacquer finish, reddish-brown, with obvious ring patterns and radial longitudinal ridges. The stipe is flat or nearly cylindrical, with a smooth surface and a strong lacquer-like luster. It is orange-yellow to light yellowish-brown when young, turning dark reddish-brown when mature. The flesh is thick and snow-white. Demonstration results from four locations over two years (2024-2025) showed that the white-fleshed Ganoderma lucidum strain L5470 had an average cap length of 12.25 cm and a cap width of 10.87 cm; the flesh was white with an average thickness of 2.15 cm and a relatively soft texture; the stipe was reddish-brown with an average length of 5.43 cm and an average diameter of 2.03 cm, darker in color than the cap; the average fresh weight of a single mushroom was 69.53 g, the average dry weight was 23.98 g, the biological conversion rate was 12.64%, and the average cultivation period was 109 days. The total content of 16 amino acids was 12.1 g / 100 g, protein was 17.0 g / 100 g, fat was 0.8 g / 100 g, polysaccharides were 1.68%, and triterpenes and sterols were 2.84%. This variety is characterized by its high-gloss, lacquer-like fruiting body, thick flesh, high yield, stable cultivation traits, and high polysaccharide content, making it suitable for substrate cultivation and promotion in high-altitude areas of Yunnan.
[0018] Difference between Ganoderma lucidum strain L5470 and Ganoderma lucidum strain L4439 (CK): The fruiting bodies of the white-fleshed Ganoderma lucidum strain L5470 are mostly nearly round when immature, and mostly round when fully mature, with a high glossy, lacquer-like appearance. The caps are yellowish-brown to reddish-brown when young, gradually fading from the center to the periphery, turning reddish-brown when mature, and the white growth ring at the edge disappears. They have distinct annular markings and radial longitudinal ridges; the stipe is stout, flat or nearly cylindrical, with a smooth surface and a strong lacquer-like sheen, ranging from orange-yellow to light yellowish-brown when young, turning reddish-brown when mature; the flesh is thick and snow-white. The average cap length is 12.25 cm, the average cap width is 10.87 cm, the average flesh thickness is 2.15 cm, and the texture is relatively soft; the stipe is dark reddish-brown, with an average length of 5.43 cm, darker than the cap, and an average diameter of 2.03 cm. The average fresh weight of a single mushroom is 69.53 g, the average dry weight is 23.98 g, the biological conversion rate is 12.64%, and the average cultivation period is 109 days. It has a strong mushroom aroma, high polysaccharide content, rich nutrients, and mild bitterness. The total content of 16 amino acids is 12.10g / 100g, protein is 17.0g / 100g, fat content is 0.8g / 100g, polysaccharide content is 1.68%, and triterpenes and sterols are 2.84%.
[0019] The fruiting body of Ganoderma lucidum strain L4439 (CK) is mostly kidney-shaped when immature, and mostly kidney-shaped when fully mature, with a few being oval to round. It has a high, lacquer-like sheen. The cap is pale yellow, light yellowish-brown to yellowish-brown when young, gradually fading from the center to the periphery. When mature, the cap turns yellowish-brown, and the white growth ring at the edge disappears. It has distinct concentric rings and radial longitudinal ridges. The stipe is flat or nearly cylindrical, smooth, and has a strong lacquer-like sheen. It is orange-yellow to light yellowish-brown when young, turning yellowish-brown when mature. The flesh is relatively thin and white. The average cap length is 11.18 cm, and the average cap width is 9.45 cm. The flesh is white, with an average thickness of 2.06 cm, and a relatively soft texture. The stipe is reddish-brown, with an average length of 5.07 cm, darker than the cap, and an average diameter of 1.55 cm. The average fresh weight of a single mushroom is 60.05g, the average dry weight is 19.33g, the biological conversion rate is 10.92%, and the average cultivation period is 96 days. It has a strong mushroom aroma, high polysaccharide content, rich nutrients, and a mild bitter taste. The total content of 16 amino acids is 14.0g / 100g, protein is 17.9g / 100g, fat is 1.4g / 100g, polysaccharides are 1.23%, and triterpenes and sterols are 3.62%.
[0020] Compared to the white-fleshed Ganoderma lucidum strain L4439 (CK), the white-fleshed Ganoderma lucidum strain L5470 exhibits better overall fruiting performance, a shorter cycle, unique mushroom shape, and a longer stipe. In contrast, the bag-grown fruiting bodies of the white-fleshed Ganoderma lucidum strain L4439 (CK) mostly have kidney-shaped caps, short stipes, and thinner caps. Therefore, the white-fleshed Ganoderma lucidum strain L5470 can be promoted and applied as a late-maturing new variety of white-fleshed Ganoderma lucidum, suitable for greenhouse cultivation and understory biomimetic cultivation.
[0021] After years of multi-location trials, the white-fleshed Ganoderma lucidum strain L5470 has demonstrated characteristics such as a glossy, lacquer-like fruiting body, thick flesh, high yield, stable cultivation traits, and high polysaccharide content, making it suitable for substrate cultivation and promotion in high-altitude areas of Yunnan. Strain L5470 is a medium-to-low temperature Ganoderma lucidum, with an optimal growth temperature of 20-26℃. It is recommended for cultivation in greenhouses and under forest cover at altitudes of 1600-2600m in Yunnan.
[0022] This invention relates to a *Ganoderma* strain L5470 containing high levels of *Ganoderma lucidum* polysaccharides and triterpenoids. The polysaccharide and triterpenoid content was determined using the methods outlined in the 2020 edition of the *Pharmacopoeia of the People's Republic of China*. The polysaccharide content was 1.68%, and the triterpenoid and sterol content was 2.84%. *Ganoderma lucidum* polysaccharides exhibit a wide range of pharmacological activities, including lowering blood sugar and lipids, antithrombosis, antioxidation, free radical scavenging, anti-aging, anti-radiation, anti-tumor effects, promoting blood circulation, regulating immunity, regulating nucleic acid and protein metabolism, promoting DNA synthesis, and promoting the proliferation of human umbilical cord blood LAK cells. *Ganoderma lucidum* triterpenoids possess anti-inflammatory, analgesic, sedative, anti-aging, tumor cell cytotoxic, and anti-hypoxic effects.
[0023] Compared with existing technologies, the white-fleshed Ganoderma lucidum strain L5470 of this invention has significant and comprehensive beneficial effects, and its core advantages span multiple dimensions such as genetic characteristics, agronomic traits, stress resistance, nutritional functions and industrial adaptability.
[0024] In terms of genetic specificity, through the joint identification of four genes (ITS, nrLSU, TEF1-α, and RBP2) and verification by SSR molecular markers, strain L5470 and the known white-fleshed Ganoderma strain L4439, although belonging to the same species Ganoderma leucocontextum, have clear genomic micro-differences. The size of its SSR primer amplification fragment is significantly different from that of the control strain. It is an independent new strain obtained through natural selection and artificial domestication, with a unique and stable genetic background.
[0025] In terms of agronomic traits, strain L5470 is particularly outstanding. The fruiting body has a unique morphology. When not fully mature, the cap is mostly nearly round and yellowish-brown. When fully mature, it is round and has a high gloss like lacquer. The reddish-brown cap is paired with obvious rings and radial longitudinal ridges. The stipe is stout and flat or nearly cylindrical. The surface is smooth and has a strong gloss like lacquer. When mature, it turns dark reddish-brown. The snow-white flesh has an average thickness of 2.15 cm, which is significantly thicker than the control strain. After two years of demonstration cultivation in four locations from 2024 to 2025, the average cap length was 12.25 cm, the width was 10.87 cm, the stipe length was 5.43 cm, the diameter was 2.03 cm, the average fresh weight of a single mushroom was 69.53 g, the dry weight was 23.98 g, the biological conversion rate reached 12.64%, which was 15.8%, 24.0%, and 15.7% higher than the control strain, respectively. The fruiting rate exceeded 90%, the cultivation characteristics were stable, the overall fruiting effect was better than the control, the mushroom shape was regular and there were no obvious branches, and the marketability was better.
[0026] In terms of stress resistance, strain L5470 exhibits stronger environmental adaptability and contamination resistance. Under low temperature conditions (10℃, 15℃), the mycelial germination rate and growth rate are faster than the control, and the growth performance is better in high temperature environments (30℃). The mycelial growth temperature range is wider (optimal 22-24℃), and it has better high and low temperature resistance. The inhibition rate against Penicillium is as high as 72.2%, which is significantly higher than the 47.6% of the control strain. The contamination rate is low during seed production and cultivation, the feeding speed is fast, it is not easily infected by contaminants, and the incidence of diseases and pests is low, providing a stable guarantee for large-scale cultivation.
[0027] In terms of nutritional function, strain L5470 has obvious advantages in nutritional components. The polysaccharide content reaches 1.68%, which is 36.6% higher than the control strain's 1.23%. As the core active ingredient of Ganoderma lucidum for regulating immunity and anti-tumor, the high content of polysaccharides gives the strain higher medicinal value. At the same time, the fat content of this strain is only 0.8g / 100g, which is 42.9% lower than the control, making it more in line with the needs of healthy consumption. In addition, it has a strong mushroom aroma and a mild bitter taste, taking into account both medicinal and edible experience.
[0028] In terms of industrial adaptability, strain L5470 is specifically adapted to the cool climate of Yunnan at high altitudes of 1600-2600m, making it suitable for greenhouse and under-forest biomimetic cultivation. Its cultivation formula is simple, raw materials are readily available, and the cultivation cycle is 109 days, balancing yield and quality. Moreover, its mycelium is robust and grows rapidly, which can reduce the cost of prevention and control and the difficulty of management during the cultivation process. It can effectively alleviate the problem of resource depletion caused by over-harvesting of wild Ganoderma lucidum resources, provide high-quality new varieties for the Ganoderma lucidum industry in Yunnan, and help rural revitalization and industrial upgrading. It has broad application prospects and market value in the fields of anti-tumor and immune-enhancing drug research and development and functional food processing. Attached Figure Description
[0029] Figure 1 Photographs of pure mycelial cultures; Figure 2 Phylogenetic tree of Ganoderma lucidum strain L5470; Figure 3 Gel image of SSR molecular markers for Ganoderma lucidum strain L5470; where Mark is a 50bp DNA marker; Figure 4 Images of the antagonism test; Note: In the plates, the left side is Ganoderma lucidum strain L5470, and the right side is Ganoderma lucidum strain L4439 (CK). Figure 5 Figures showing mycelial growth rates under different carbon source conditions; Figure 6 Graphs showing mycelial growth rates under different nitrogen source conditions; Figure 7 Graphs showing mycelial growth rates under different inorganic salt conditions; Figure 8 Graphs showing mycelial growth rates under different temperature conditions; Figure 9 Figures showing mycelial growth rates under different pH conditions; Figure 10 Photo of fruiting after initial screening of white-fleshed Ganoderma lucidum strain L5470 in a small-scale trial; Figure 11 Photos of fruiting from a small-scale secondary screening of white-fleshed Ganoderma lucidum strain L5470; Figure 12 Photo of fruiting from intermediate trial cultivation of Ganoderma lucidum strain L5470 (white-fleshed Ganoderma lucidum); Figure 13 Images show the demonstration cultivation effects of Ganoderma lucidum strain L5470 and strain L4439 (CK); where A is a demonstration cultivation image of Ganoderma lucidum strain L5470, B is a demonstration cultivation image of Ganoderma lucidum strain L5470, C is a demonstration cultivation image of Ganoderma lucidum strain L4439 (CK), and D is a demonstration cultivation image of Ganoderma lucidum strain L4439 (CK). Figure 14 Images show the results of antagonistic culture between Ganoderma lucidum and Penicillium. A represents the culture of Ganoderma lucidum strain L5470 alone; B represents the culture of Ganoderma lucidum strain L4439 (CK) alone; C represents the culture of Penicillium alone; D and E represent the antagonistic culture of Ganoderma lucidum strain L5470 and Penicillium, with D being a front view of the culture medium and E being a back view; F and G represent the antagonistic culture of Ganoderma lucidum strain L4439 (CK) and Penicillium, with F being a front view of the culture medium and G being a back view. Figure 15 Morphological diagram of Ganoderma lucidum strain L5470; where a. basidiosperm, b. dorsal side of cap, c. cross-section of cap, d. pore surface, e. cortical cells, f. mycelial skeleton, g. reproductive hyphae, h. clamp connections, il: basidiospores, scale bar: (e, f, h, i: 20µm; g: 10µm; jl: 5µm).
[0030] The white-fleshed Ganoderma strain L5470 of this invention was deposited on October 23, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, China, accession number GDMCC No: 67155, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, Institute of Microbiology. Detailed Implementation
[0031] The present invention will now be described in further detail with reference to the embodiments.
[0032] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase. White Ganoderma lucidum L4439 was provided by the Tibet Academy of Agricultural and Animal Husbandry Sciences.
[0033] Example 1
[0034] A white-fleshed Ganoderma lucidum strain L5470, characterized in that it was deposited on October 23, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 67155.
[0035] The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 includes the following steps: Step A, Propagation of Mother Culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L5470 were inoculated onto the mother culture PDA medium and cultured at 24℃ for 11 days to obtain mycelial blocks. The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 20 parts agar powder, 2 parts potassium dihydrogen phosphate, and 1000 parts water. Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture them in a shaker at 23°C for 9 days to obtain the seed liquid; The shake flask culture medium includes the following raw materials by weight: 200 parts potato, 20 parts glucose, 2 parts soybean meal, 0.4 parts potassium dihydrogen phosphate, 0.2 parts calcium chloride, 1000 parts water, and pH 8. Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 23℃ for 10 days to obtain liquid inoculum; The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2400 parts glucose, 200 parts soybean meal, 120 parts potassium dihydrogen phosphate, 60 parts calcium chloride, 100,000 parts water, with a pH value of 8. Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a constant temperature incubator at 23℃; The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 74 parts hardwood sawdust, 4 parts cottonseed hulls, 18 parts wheat bran, 2 parts soybean meal, 1 part gypsum powder, and 1 part lime powder; pH value 7, moisture content 55-65%; Step E, Soil Covering Cultivation and Harvesting: After the mycelium in the cultivation bags has fully grown, transport them to the commercial forest cultivation base and pile them on the ground in a shaded area to continue post-ripening for 6 days. Make ridges along the slope of the forest land, with a ridge width of 1.1m and a furrow depth of 32cm. Then, open the bags with small holes and stand them upright at a 45° angle to cover them with soil for planting. When the pale yellow growth ring on the edge of the cap disappears and spores are released, the fruiting bodies can be harvested.
[0036] Example 2
[0037] A white-fleshed Ganoderma lucidum strain L5470, characterized in that it was deposited on October 23, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 67155.
[0038] The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 includes the following steps: Step A, Propagation of Mother Culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L5470 were inoculated onto the mother culture PDA medium and cultured at 24℃ for 10 days to obtain mycelial blocks. The mother culture PDA medium comprises the following ingredients by weight: 200 parts potato, 19 parts glucose, 19 parts agar powder, 1.9 parts potassium dihydrogen phosphate, and 990 parts water. Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture in a shaker at 22.5℃ for 8 days to obtain the seed liquid; The shake flask culture medium comprises the following ingredients by weight: 200 parts potato, 19 parts glucose, 1.9 parts soybean meal, 0.39 parts potassium dihydrogen phosphate, 0.19 parts calcium chloride, 990 parts water, with a pH of 7.5. Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 22.5℃ for 8 days to obtain liquid inoculum; The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2350 parts glucose, 190 parts soybean meal, 115 parts potassium dihydrogen phosphate, 59 parts calcium chloride, 99000 parts water, and a pH value of 7.5. Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a constant temperature incubator at 23℃; The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 73 parts hardwood sawdust, 3.8 parts cottonseed hulls, 17 parts wheat bran, 1.9 parts soybean meal, 0.9 parts gypsum powder, and 0.9 parts lime powder; pH value 6, moisture content 55-65%; Step E, Soil Covering Cultivation and Harvesting: After the mycelium in the cultivation bags has fully grown, transport them to the commercial forest cultivation base and pile them on the ground in a shaded area to continue post-ripening for 5 days. Make ridges along the slope of the forest land, with a ridge width of 1m and a furrow depth of 30cm. Then, open the bags with small holes and stand them upright at a 45° angle to cover them with soil for planting. When the pale yellow growth ring on the edge of the cap disappears and spores are released, the fruiting bodies can be harvested.
[0039] In step D, the cells are incubated at a constant temperature for 3 days.
[0040] In step E, the commercial forests include walnut forests and Chinese pine forests.
[0041] In step E, five mushroom sticks are planted horizontally on the ridge.
[0042] In step E, commercial forests with a canopy closure of 7.5-8 do not require shading, forests with a canopy closure greater than 8 are not suitable for planting, and forests with a canopy closure less than 7.5 can control the light intensity at 1800-3200 Lux by building small arched sheds.
[0043] In step E, the light intensity is adjusted by covering the small arched shed with a 3-needle shade net.
[0044] In step E, if the weekly rainfall is greater than 30 mL, cover the small arched shed with a white plastic film to protect it from rain and keep it warm.
[0045] Example 3
[0046] A white-fleshed Ganoderma lucidum strain L5470, characterized in that it was deposited on October 23, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 67155.
[0047] The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 includes the following steps: Step A, Propagation of Mother Culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L5470 were inoculated onto the mother culture PDA medium and cultured at 24℃ for 12 days to obtain mycelial blocks. The mother culture PDA medium comprises the following ingredients by weight: 200 parts potato, 21 parts glucose, 21 parts agar powder, 2.1 parts potassium dihydrogen phosphate, and 1010 parts water; Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture them in a shaker at 23.5℃ for 10 days to obtain the seed liquid; The shake flask culture medium comprises the following ingredients by weight: 200 parts potato, 21 parts glucose, 2.1 parts soybean meal, 0.41 parts potassium dihydrogen phosphate, 0.21 parts calcium chloride, 1010 parts water, with a pH of 8.5. Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 23.5℃ for 11 days to obtain liquid inoculum; The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2450 parts glucose, 210 parts soybean meal, 125 parts potassium dihydrogen phosphate, 61 parts calcium chloride, 101000 parts water, with a pH value of 8.5. Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a constant temperature incubator at 23℃; The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 75 parts hardwood sawdust, 5.2 parts cottonseed hulls, 19 parts wheat bran, 2.1 parts soybean meal, 1.1 parts gypsum powder, and 1.1 parts lime powder; pH value 8, moisture content 55-65%; Step E, Soil Covering Cultivation and Harvesting: After the mycelium in the cultivation bags has fully grown, transport them to the commercial forest cultivation base and pile them on the ground in a shaded area to continue post-ripening for 7 days. Make ridges along the slope of the forest land, with a ridge width of 1.2m and a furrow depth of 35cm. Then, open the bags with small holes and stand them upright at a 45° angle to cover them with soil for planting. When the pale yellow growth ring on the edge of the cap disappears and spores are released, the fruiting bodies can be harvested.
[0048] In step D, the cells are incubated at a constant temperature for 40 days.
[0049] In step E, the commercial forests include walnut forests and Chinese pine forests.
[0050] In step E, five mushroom sticks are planted horizontally on the ridge.
[0051] In step E, commercial forests with a canopy closure of 7.5-8 do not require shading, forests with a canopy closure greater than 8 are not suitable for planting, and forests with a canopy closure less than 7.5 can control the light intensity at 1800-3200 Lux by building small arched sheds.
[0052] In step E, the light intensity is adjusted by covering the small arched shed with a 6-pin shade net.
[0053] In step E, if the weekly rainfall is greater than 30 mL, cover the small arched shed with a white plastic film to protect it from rain and keep it warm.
[0054] Example 4
[0055] A white-fleshed Ganoderma lucidum strain L5470, characterized in that it was deposited on October 23, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, China, with accession number GDMCC No: 67155.
[0056] The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 includes the following steps: Step A, Propagation of Mother Culture: Under aseptic conditions, tissue blocks of Ganoderma lucidum strain L5470 were inoculated onto the mother culture PDA medium and cultured at 24℃ for 11 days to obtain mycelial blocks. The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 20 parts agar powder, 2 parts potassium dihydrogen phosphate, and 1000 parts water. Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture them in a shaker at 23°C for 9 days to obtain the seed liquid; The shake flask culture medium includes the following raw materials by weight: 200 parts potato, 20 parts glucose, 2 parts soybean meal, 0.4 parts potassium dihydrogen phosphate, 0.2 parts calcium chloride, 1000 parts water, and pH 8. Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 23℃ for 10 days to obtain liquid inoculum; The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2400 parts glucose, 200 parts soybean meal, 120 parts potassium dihydrogen phosphate, 60 parts calcium chloride, 100,000 parts water, with a pH value of 8. Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a constant temperature incubator at 23℃; The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 74 parts hardwood sawdust, 5 parts cottonseed hulls, 18 parts wheat bran, 2 parts soybean meal, 1 part gypsum powder, and 1 part lime powder; pH value 7, moisture content 55-65%; Step E, Soil Covering Cultivation and Harvesting: After the mycelium in the cultivation bags has fully grown, transport them to the commercial forest cultivation base and pile them on the ground in a shaded area to continue post-ripening for 6 days. Make ridges along the slope of the forest land, with a ridge width of 1.1m and a furrow depth of 32cm. Then, open the bags with small holes and stand them upright at a 45° angle to cover them with soil for planting. When the pale yellow growth ring on the edge of the cap disappears and spores are released, the fruiting bodies can be harvested.
[0057] In step D, the cells are incubated at a constant temperature for 38 days.
[0058] In step E, the commercial forests include walnut forests and Chinese pine forests.
[0059] In step E, five mushroom sticks are planted horizontally on the ridge.
[0060] In step E, commercial forests with a canopy closure of 7.5-8 do not require shading, forests with a canopy closure greater than 8 are not suitable for planting, and forests with a canopy closure less than 7.5 can control the light intensity at 1800-3200 Lux by building small arched sheds.
[0061] In step E, the light intensity is adjusted by covering the small arched shed with a 5-needle shade net.
[0062] In step E, if the weekly rainfall is greater than 30 mL, cover the small arched shed with a white plastic film to protect it from rain and keep it warm.
[0063] Application Examples I. Source of the white-fleshed Ganoderma lucidum strain L5470 On October 18, 2019, the breeding team collected the white-fleshed Ganoderma lucidum strain L5470 from a decaying broad-leaved tree at an altitude of 1850 meters in Majie Town, Nanhua County, Chuxiong Prefecture, Yunnan Province, and obtained a pure strain through tissue isolation and purification.
[0064] II. Isolation, purification, and identification of Ganoderma lucidum strain L5470 (white-fleshed) 1. Separation and purification (tissue separation) Small pieces of wild Ganoderma lucidum internal tissue were cut near an alcohol lamp and placed on PDA medium to germinate. After purification, pure strains were obtained. Under the same culture conditions, the growth rate, thickness, and density of mycelial growth were compared. Strains with weak mycelial growth were eliminated, and effective strains with the best mycelial growth and capable of producing fruiting bodies were selected. Figure 1 The resulting Ganoderma lucidum, L5470, was named Yunling No. 7. A pure culture photograph of its mycelium is shown below. Figure 1 As shown.
[0065] 2. Molecular identification A suitable amount of pure cultured mycelium was scraped and ground with liquid nitrogen (or a grinder). Total DNA was extracted using a plant genomic DNA extraction kit (Shanghai Sangon Biotech Co., Ltd.). RNA polymerase chain reaction (PCR) was used to amplify the sequence. The PCR reaction system (25 μL) included: 12.5 μL of 2×T5 Super PCR Mix, 1 μL each of 100 μM forward and reverse primers, 1 μL of DNA template, and 9.5 μL of sterile ddH2O.
[0066] Table 1 Primers and base composition used for PCR amplification
[0067] Note: Bases include a, t, c, and g. Other letters in the primer represent degenerate bases.
[0068] The ITS PCR cycle was as follows: initial denaturation at 94°C for 5 min; repeated 35 cycles of 94°C for 30 s, 53°C for 30 s, and 72°C for 50 s; and a final extension at 72°C for 10 min.
[0069] The PCR cycle for nrLSU was as follows: initial denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min.
[0070] The PCR cycle for TEF1-α was as follows: initial denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, denaturation at 55℃ for 30 s, denaturation at 72℃ for 50 s; extension at 72℃ for 10 min, repeated for 35 cycles.
[0071] The PCR cycle for RPB2 was as follows: initial denaturation at 94°C for 5 min; 94°C for 30 s, 50°C for 30 s, 72°C for 50 s, repeated for 35 cycles; extension at 72°C for 10 min. The amplified product was stored at 4°C.
[0072] (1) Accurately weigh 1g of agarose using an electronic balance and dissolve it in 100mL of TBE (Tris-Borate-EDTA buffer). Heat the solution in a microwave oven on medium heat for 2.0min until it becomes clear and transparent. When the temperature reaches 65℃, add 1μL of nucleic acid dye and shake well. Pour the solution into a silica gel plate and allow it to cool. Place the plate in an electrophoresis pool and use a pipette to spot the sample. The sample volume is 5μL. The electrophoresis voltage is 16V, the current is 90A, and the time is 15min. After electrophoresis in 1.0×TBE buffer, observe, photograph, and record the results using an ultraviolet gel imaging system. Detect the concentration of extracted DNA. Send positive products to Shanghai Sangon Biotech for sequencing.
[0073] The ITS sequence is: agtcctacctgatttgaggtcagaggtcataaagctgtcttcaagcgaagacggttagaagctcgccaaacgcttcacggtcgcggcgtagacattatcacaccgagagccgatccgcaaggaatcaagctaatgcatttaagaggagccgaccgaagagggccgacaagcctccaagtccaagcctacaaaccgcaaaagcttgtaggttgaagatttcatgacactcaaacaggcatgctcctcggaataccaaggagcgcaaggtgcgttcaaagattcgatgattcactgaattctgcaattcacattacttatcgcatttcgctgcgttcttcatcgatgcgagagccaagagatccgttgctgaaagttgtatatagatgcgttacatcgcaatacacattctaatactttatagagtttgtgataaacgcaggcacagacgcgcttcacgaagccccgcaaggagcacgcttcgcagatctgaaacccacagtaagtgcacaggtgtagagtggatgagcagggcgtgcacgtgcctcggaaggccagctacaacccagtca (SEQ ID NO.9) The nrLSU sequence is: ttcgcccctatacccaaatttgacgatcgatttgcacgtcagaatcgctacgagcctccaccagagtttcctctggcttcaccctattcaggcatagttcaccatctttcgggtcccaacatacatgctctaccgcggatccttcagagaacgtcaggtccgggcgtcgatgccctccacgacagaggtctcaactttcactttcattacgcgctcgggttttccacccaaacactcgcagatatgttagactccttggtccgtgtttcaagacgggtcgtttaaagccattatgccagcatcctaagcgcgaaagtgggcgaacccctgccttgcggcgcgctgcgttcctcgatcccaaccgccgtatgcgactagagtctataacacacccggaggtgccacattactccagcccttttccgacggtcaaaatcgatgctgacccgtcatccggaaagtgcaccaagcgaaagcaaggctgagttccggacgacgcgactgacttcaagcgtttccctttcagcaatttcacgtactgtttaactctctttccaaagtgcttttcatctttccctcacggtacttgttcgctatcggtctctcgccaatatttagctttagatggaattcaccacccattttgagctgcattcccaaacaactcgactctttgagagcgcatcacaaagcactggtagtccgtgtcaaagacgggattctcaccctctatgacgctctgttccaagagacttatacacggtccagcgcggaaagcacttctccagactacaactcggacggccgaagaccgccagattttaaatttgagcttttcccgcttcactcgcagttactaggggaatcct (SEQ ID NO.10) The TEF1-α sequence is: acatgatccggtacctccggctgactgcgctatcctcatcatcgccgctggtaccggtgagttcgaggctggtatctccaaggatggccagacccgcgagcacgcccttcttgccttcaccctcggtgtcaggcagctcatcgtcgccgtcaacaagatggacaccaccaaggttcgtcgtcgcgtgaatcaacatacgcgcttgctctgaatcgagttcgcagtggtccgaagaccgtttcaacgaaatcatcaaggagacgtccaccttcatcaagaaggtcggttacaacccgaaggcggttgcgttcgtccccatctctggctggcacggcgacaacatgttggaggagtccagcaagtgagtgtgtgcgctatactgtctgatgactcgtcaccctgacccttatattttagcatgacctggtacaagggttggacgaaggagaccaaggctggtgttgtcaaggggaagacccttttggacgctattgatgctattgagccccccgtccgtccctccgacaagcccctccgtctccctctccaggatgtac (SEQ ID NO.11) The RBP2 sequence is: tcgcttatgtcttgcatatccgtcggcaccctctctgcacccgtcatcgaattcttggaggagtggggcctggagtctctggaggagaatgctcatgcctcaacaccttgcaccaaggtcttcgtgaatggcgtttggatgggcgtccatcgagatcctgtgaagctcgtcagcacgctcaggaagctccgtcgcaaagatgacatcaactgcgaagtatccgtcgtccgtgacattcgagaacgcgagctccgtctctacacggatgctggtcgcgtctgccgaccgctcttcatcgtcgagaaccagcagctccttatccagaagaaacacatcgagagcttggtccgtaccaaggaagacccgacgttgtcctacaactgggacagcctcctcaaggacggtgtcatcgagctgctagatgccgaggaagaggagacggttatgatatgcatgacaccggaggatttggagaattcgaggctccaggctgccggtatcgacccccatgcggacgaggagatcgacccctcagctcgattgaaggcgccgacctccgcgcatacgtggacgcactgcgagattcacccgagtatgatcttgggtgtctgtgccagtatcattccgttccccgatcacaatcaggtgagctcaggttatgaaggcttcagtcgaagtactaacgtgcgtctagtcgcctcgtaa (SEQ ID NO.12) (2) The four multi-gene sequences of the mycelium of Ganoderma leucocontextum strain L5470 were spliced in both forward and reverse directions and compared with the NCBI database. The results showed that the ITS sequence of Ganoderma leucocontextum strain L5470 had a 100.00% similarity with the sequence of Ganoderma leucocontextum YNLZ03 (MZ331732); the nrLSU sequence had a 99.77% similarity with the sequence of Ganoderma leucocontextum H4 (PP467490); the TEF1-α sequence had a 99.81% similarity with the sequence of Ganoderma leucocontextum 15601 (KU572495); and the RBP2 sequence had a 100.00% similarity with the sequence of Ganoderma leucocontextum 15601 (MG36756). Based on the general criteria for macrofungus species identification (gene similarity ≥97% is considered the same species), the species classification of Ganoderma lucidum strain L5470 can be determined as Ganoderma lucidum. It should be noted that although strain L5470 of this invention and strains such as Ganoderma lucidum YNLZ03 and 15601 with homologous sequences in the comparison library belong to the same species, they are different isolates. The differences between strains stem from different geographical environments and ecological niches of natural isolation, as well as genomic micro-differences accumulated during long-term evolution; while strain L5470 of this invention is a novel strain with independent biological characteristics obtained through specific habitat screening, and its culture characteristics, metabolite profile, etc., are specific to distinguish it from other known homologous strains.
[0074] (3) Phylogenetic analysis of Ganoderma lucidum strain L5470 with white flesh A combined dataset of ITS, TEF1-α, and RPB2 sequences was analyzed using maximum likelihood (ML) and Bayesian inference (BI) methods. Maximum likelihood analysis was performed on the CIPRES scientific gateway using RAxML-HPC2, involving 100 maximum likelihood searches; all model parameters were estimated procedurally. Maximum likelihood guide values (ML-BS) were obtained through 1000 fast guide replications. A maximum likelihood guide value (ML) equal to or greater than 70% is given above each node.
[0075] Bayesian analysis was performed using MrBayes v3.2, and the best-fit model for sequence evolution was estimated using MrModeltest 2.3. Posterior probabilities (PPs) were evaluated using Markov Chain Monte Carlo (MCMC) sampling. Six Markov chains were run simultaneously for 10,000,000 generations, with sampling every 500 generations to obtain 2000 trees. The first 5000 trees representing the aging phase were discarded, and the remaining 1500 trees were used to compute the posterior probabilities in the majority rule consensus tree (the critical value for topological convergence diagnosis was 0.01). Phylogenetic tree visualization was performed using FigTree 1.4.0, and tree editing was done using Adobe Illustrator CS5. The sequences obtained in this study are stored in GenBank (http: / / www.ncbi.nlm.nih.gov).
[0076] Based on the results of BLAST alignment of four gene fragments (ITS, nrLSU, TEF1-α, RPB2) on NCBI data, four gene fragment sequences from 24 species of Ganoderma lucidum were downloaded from GenBank. After alignment using Maft and assembly using SequenceMatrix, a phylogenetic tree was constructed based on the combined gene sequences of the above four fragments, with Tomophagus colossus as the outgroup. Figure 2 As shown, the phylogenetic analysis results showed that strain L5470 was Ganoderma leucocontextum and control strain L4439 (CK) was Ganoderma leucocontextum, with a support rate of 94%.
[0077] III. SSR Molecular Markers 1. DNA extraction The tested white-fleshed Ganoderma lucidum strain L5470 was transferred to potato dextrose agar solid medium and cultured at 24°C for 15 days before mycelia were collected. Genomic DNA was extracted from the mycelia using the DE711-50 kit from Jinsha Biotechnology, and the purity and concentration of the DNA were detected by agarose gel electrophoresis and biospectrophotometry.
[0078] 2. Genome sequencing The extracted and purified genomic DNA was used to construct a library, and bidirectional sequencing was performed using a sequencing platform. Bioinformatics analysis was conducted on the genome sequence of the white-fleshed Ganoderma lucidum strain L5470 to systematically search for SSR loci.
[0079] 3. Development of SSR primers based on genome sequencing results Based on the genome data of Ganoderma lucidum, four pairs of SSR primers (primer 1, primer 2, primer 3, primer 4) were used to distinguish Ganoderma lucidum strain L5470 from Ganoderma lucidum strain L4439 (CK). Detailed primer information is shown in Table 2.
[0080] Table 2 SSR marker primer information
[0081] 4. PCR amplification SSR-labeled PCR amplification was performed on the extracted DNA using SSR molecular markers: The PCR amplification system consisted of a total volume of 25 μL, including: 12.5 μL of 2×San Taq PCR Mix (with black dye); 1 μL each of 100 μM forward and reverse primers; and 1 μL of template DNA. PCR reaction conditions were: 95℃ for 2 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 30 s, for 38 cycles; and 72℃ for 5 min. To ensure accurate identification, three replicate experiments were performed. The *Ganoderma lucidum* strain L4439 (CK) was used under the above conditions, repeated three times.
[0082] 5. Electrophoresis Electrophoresis was performed using polyacrylamide gel, followed by silver staining to reveal bands: 48 mL of 1×TBE solution; 12 mL of Acr-Bis (19:1); 1 mL of 10% APS solution; 100 μL of 10% TEMED; pour the gel immediately after preparation, removing air bubbles. After the gel solidifies, perform electrophoresis; the sample volume is 2 μL per well, and the electrophoresis conditions are 270V constant voltage for 1 h. After electrophoresis, wash the gel twice with distilled water; add 400 mL of 10% silver nitrate solution and shake on a shaker for 8 min; after silver staining, wash twice with water; add sodium hydroxide and formaldehyde for color development (6 g NaOH, 400 mL distilled water, 2 mL formaldehyde solution).
[0083] Table 3. Comparison of amplified fragment sizes of primers in Ganoderma lucidum strain L5470 and strain L4439 (CK).
[0084] As shown in Table 3, the SSR primers SSR-01, SSR-02, SSR-03, and SSR-04 can distinguish between the white-fleshed Ganoderma lucidum strain L5470 and the white-fleshed Ganoderma lucidum strain L4439 (CK). The amplified specific fragment sizes of Ganoderma lucidum strain L5470 are (110, 94), (133, 140), 96, and 136 bp, respectively, while the fragment sizes of Ganoderma lucidum strain L4439 (CK) are 106, (135, 120), 99, and (136, 118) bp, respectively. This indicates that the two strains have genetic differences.
[0085] IV. Antagonism Test Antagonism experiments were conducted using the isolated Ganoderma lucidum strain L5470 and the control strain L4439 (CK). Both strains were inoculated into the same PDA medium using a 0.5 cm diameter punch and cultured for 13 days. The morphology at the junction of the mycelial growth of the two strains was then observed. The results showed that the pure strains L5470 and CK exhibited strong antagonistic reactions and lacked affinity, forming concave antagonistic lines, such as... Figure 4 As shown.
[0086] V. Cultivation Method of White-fleshed Ganoderma L5470 5.1 Preparation of microbial strains 5.1.1 Propagation of the mother plant 1. Culture medium formula: by weight, 200 parts potato, 19-21 parts glucose, 19-21 parts agar powder, 1.9-2.1 parts potassium dihydrogen phosphate, and 990-1010 parts water.
[0087] 2. Culture medium preparation: Peel and cut potatoes into pieces, boil them in water for 30 minutes, filter the liquid through 4 layers of gauze, add glucose, agar powder and potassium dihydrogen phosphate to the liquid, stir until completely dissolved, add water to the specified weight parts, dispense into containers and autoclave at 121℃ for 20 minutes, cool and solidify before use.
[0088] 3. Inoculation and culture: Under aseptic conditions, take the internal tissue block of wild white Ganoderma lucidum L5470 fruiting body and inoculate it into the center of the mother culture PDA medium; place it in a constant temperature incubator at 24℃ and culture it in the dark for 10-12 days. When the mycelium has grown all over the medium and formed a uniform mycelial block, it is the mother culture.
[0089] 5.1.2 Liquid shake flask culture 1. Culture medium formula: by weight, 200 parts potato, 19-21 parts glucose, 1.9-2.1 parts soybean meal, 0.39-0.41 parts potassium dihydrogen phosphate, 0.19-0.21 parts calcium chloride, and 990-1010 parts water, adjust the pH to 7.5-8.5.
[0090] 2. Culture medium preparation: Boil potatoes, filter and collect the filtrate, add the remaining raw materials and stir to dissolve, adjust the pH and dispense into Erlenmeyer flasks (200 mL per flask), autoclave at 121℃ for 20 minutes, and cool to below 25℃ for later use.
[0091] 3. Inoculation and culture: Use a sterile punch to take cultured mycelial blocks (0.5cm in diameter) and inoculate 10-20 blocks into each Erlenmeyer flask; place the Erlenmeyer flasks on a shaker at 22.5-23.5℃ and 260 r / min for 8-10 days to obtain a uniform seed culture.
[0092] 5.1.3 Fermentation culture in a liquid fermenter 1. Culture medium formula: by weight, 600 parts soluble starch, 2350-2450 parts glucose, 190-210 parts soybean meal, 115-125 parts potassium dihydrogen phosphate, 59-61 parts calcium chloride, and 99000-101000 parts water, adjust the pH to 7.5-8.5.
[0093] 2. Culture medium preparation: Add all raw materials to the fermenter, stir until completely dissolved, adjust the pH, autoclave at 121℃ for 30 minutes, and cool to 22.5-23.5℃ for later use.
[0094] 3. Inoculation and cultivation: Inoculate the seed liquid obtained in step B into the fermenter at an inoculation rate of 5% of the fermentation liquid volume, maintain the temperature at 22.5-23.5℃, stir at 260 r / min, and cultivate for 8-11 days to obtain liquid inoculum.
[0095] 5.1.4 Preparation of Cultivation Varieties 1. Cultivation substrate formula: by weight, 73-75 parts hardwood sawdust, 3.8-5.2 parts cottonseed hulls, 17-19 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.9-1.1 parts lime powder; adjust the pH value to 6-8 and the moisture content to 55-65% (it should be able to form a ball when squeezed in the hand, and water should seep through the fingers without dripping).
[0096] 2. Bagging and sterilization: Evenly fill the cultivation substrate into 17cm×35cm×0.05cm polyethylene cultivation bags, with a filling height of 20cm. Make a hole (1.5cm in diameter) in the center of the substrate surface, and cover with a ring. Sterilize at 121℃ for 2.5 hours or at 100℃ for 8 hours under normal pressure. Cool to below 25℃ for later use.
[0097] 3. Inoculation and culture: Under aseptic conditions, inject the liquid inoculum into the holes of the cultivation bag at an inoculation rate of 10 mL per bag; place the inoculated cultivation bag in a 23℃ incubation room for 34-40 days in the dark until the mycelium has fully grown on the bag, which is the culture medium.
[0098] 5.2 Cultivation Management 5.2.1 Site Selection and Preparation 1. Site requirements: Select a standardized commercial forest (such as walnut forest, Chinese pine forest, etc.) at an altitude of 1600-2600m, with convenient transportation, no pollution sources, gentle slope, loose and fertile soil, and good drainage.
[0099] 2. Site preparation: Clear weeds and dead branches from the woodland, and make ridges along the slope. The ridges should be 1-1.2m wide and the length depends on the size of the woodland. The furrows should be 30-35cm deep. Apply quicklime (50kg per mu) to the ridge surface for disinfection, and then level the surface after sun exposure for 3 days.
[0100] 3. Shading facilities: No shading is needed when the canopy closure is 7.5-8; when the canopy closure is <7.5, a simple small arched shed with a height of 1.5m should be built and covered with a 3-6 needle shade net to control the light intensity at 1800-3200 Lux; forest land with a canopy closure >8 is not suitable for planting.
[0101] 5.2.2 Transplanting and Cultivation 1. Post-ripening of cultivation bags: Transport the cultivation bags covered with mycelium to the cultivation base, pile them in a shaded area, and continue to ripen for 5-7 days to promote the physiological maturation of mycelium.
[0102] 2. Planting procedure: Dig holes horizontally on the ridge surface, with a hole spacing of 20cm, and plant 5 mushroom sticks per ridge; make small holes with a diameter of 1-2cm on the shoulder of the mushroom stick in the cultivation bag, place it upright at a 45° angle into the hole, cover with 2-3cm of soil, and compact the soil.
[0103] 5.2.3 Field Management 1. Humidity management: After transplanting, maintain soil moisture at 25-30% and relative air humidity at 80-90%; spray water once in the morning and once in the evening on sunny days, and reduce spraying on cloudy days to avoid waterlogging; after the rainy season, adjust the spraying frequency according to humidity changes.
[0104] 2. Temperature management: Maintain the cultivation environment temperature at 20-26℃. When the temperature is below 15℃, cover with plastic film to keep warm. When the temperature is above 30℃, increase ventilation to cool down. The optimal temperature for fruiting body growth is 22.5-23.5℃.
[0105] 3. Rainy season protection: When the weekly rainfall exceeds 30ml, cover the small arched shed with a white plastic film under the shade net to keep it dry and warm. Leave a 30cm ventilation opening at the edge of the film and remove the film for ventilation after the rain.
[0106] 4. Ventilation management: Ventilate twice a day for 30 minutes each time to maintain air circulation, reduce CO2 concentration, and promote normal development of fruiting bodies.
[0107] 5.3 Harvesting of fruiting bodies 1. Harvesting time: Harvest when the pale yellow growth ring on the edge of the cap has completely disappeared, the surface of the cap has a high glossy lacquer appearance, and a small number of spores are observed to be shooting out.
[0108] 2. Harvesting method: Use a sterile, sharp blade to cut the stipe 1cm from the base to harvest, avoiding damage to the cap and tubes; after harvesting, remove any remaining stipes and impurities from the ridge surface, replenish the soil to the original thickness, maintain a humidity of 80%, promote secondary growth, and harvest 2-3 batches continuously.
[0109] 3. Post-harvest processing: Remove mud and sand from the harvested fruiting bodies, spread them out to dry or dry them at a low temperature (35-60℃, keep them ventilated) until the moisture content is below 12%, then seal and store them in a dry, cool place to prevent insect infestation and mold.
[0110] 5.4 Key Cultivation Points 1. Maintain aseptic operation throughout the seed production process, ensure thorough sterilization of the culture medium, and minimize sources of contamination during inoculation and colonization.
[0111] 2. Strictly control environmental conditions such as light, temperature, and humidity, especially drainage and rain protection measures during the rainy season, as these directly affect the quality and yield of the sesame seeds.
[0112] 3. The pH and moisture content of the cultivation substrate need to be precisely adjusted to ensure suitable conditions for mycelial growth and fruiting body development.
[0113] 4. Promptly remove contaminated cultivation bags and diseased or weak fruiting bodies to prevent the spread of pests and diseases.
[0114] VI. Solid Culture Characteristics Following the PDA medium formula: 200g potato, 20g glucose, 20g agar, and 1000mL water, the PDA medium was prepared and mixed thoroughly, then sterilized at 121℃ and 0.103MPa for 30min. The mixture was then poured into 90mm petri dishes to prepare plates. The preserved white-fleshed Ganoderma lucidum strain L5470 was activated and then transferred to the petri dishes. Once the mycelium had fully colonized the petri dishes, it was ready for use.
[0115] Mycelial blocks of the white-fleshed Ganoderma lucidum strain L5470 were inoculated into the center of various conditioned mediums using a 0.5 cm diameter punch. Except for the temperature gradient experiment, all other single-factor conditions were incubated in a 26℃ constant temperature incubator, with five replicates for each treatment. Colony diameter was measured every 24 hours using the streak method. Mycelial morphology and growth potential were observed and recorded. Data were compared using the Duncan method in SPSS 20.0 software to determine statistical significance (P < 0.05). Finally, the data were statistically analyzed using Excel 2021 and SPSS 20.0.
[0116] The formula for mycelial growth rate (V) is: Growth rate (V) = In the formula: R: Colony radius (mm); T: Number of days of cultivation (d); 5: The diameter of the inoculated bacterial block is 5mm.
[0117] Basic culture medium: 20g glucose, 2g yeast extract, 0.2g potassium dihydrogen phosphate, 16g agar, 1L distilled water.
[0118] 6.1 Single-factor screening experiment for carbon sources Using a basal culture medium without added glucose as a blank control, five carbon sources were set up as treatment groups: glucose, maltose, lactose, sucrose, and fructose, all at a concentration of 20 g / L.
[0119] The effects of different carbon sources on mycelial growth rate are shown in the following results. Figure 5 .
[0120] Depend on Figure 5 It was found that the mycelial growth rate was fastest when glucose was used as the carbon source, at (9.49±0.26) mm / d, which was not significantly different from maltose and fructose, but showed significant differences from all other carbon sources. The mycelial growth rate was slowest when no carbon source was added, at (3.26±0.51) mm / d, which was not significantly different from lactose. When lactose was used as the carbon source, the growth rate was the slowest compared to other carbon sources, at (4.23±2.26) mm / d, and showed significant differences from all other carbon sources (P<0.05).
[0121] 6.2 Single-factor screening experiment for nitrogen sources Using a basal culture medium without added yeast powder as a blank control, five nitrogen sources were set up as treatment groups: peptone, soybean meal, urea, yeast powder, and ammonium sulfate, all with a concentration of 2 g / L.
[0122] The effects of different nitrogen sources on mycelial growth rate are shown in the following results. Figure 6 .
[0123] Depend on Figure 6 It was found that the mycelial growth rate was fastest when soybean meal was used as the nitrogen source, at (5.24±0.27) mm / d, which was significantly different from the urea and no nitrogen source treatment groups, but not significantly different from other nitrogen sources. When urea was used as the nitrogen source, the mycelium did not grow, and there were significant differences compared with other nitrogen sources (P<0.05).
[0124] 6.3 Inorganic Salt Single-Factor Screening Experiment Using a basal medium without potassium dihydrogen phosphate as a blank control, five inorganic salts were added to the PDA basal medium: potassium dihydrogen phosphate, magnesium sulfate, calcium chloride, sodium carbonate, and zinc sulfate as treatment groups, with a concentration of 2 / L for each group.
[0125] The effects of different inorganic salts on mycelial growth rate are shown in the results. Figure 7 .
[0126] Depend on Figure 7 It was found that the growth rate was fastest when calcium chloride was used as the inorganic salt, at (9.40±0.27) mm / d, which was significantly different from other treatment groups. The mycelial growth rate was slowest when zinc sulfate was used as the inorganic salt, at (4.46±0.21) mm / d, which was significantly different from other treatment groups (P<0.05).
[0127] 6.4 Temperature Single-Factor Screening Experiment Mycelial blocks of the white-fleshed Ganoderma lucidum strain L5470 were inoculated into the basal culture medium, and the culture dishes were placed in constant temperature incubators at 20℃, 22℃, 24℃, 26℃, 28℃, and 30℃, respectively.
[0128] The effects of different temperatures on mycelial growth rate are shown in the following results. Figure 8 .
[0129] Depend on Figure 8 It can be seen that as the temperature gradually increases, the mycelial growth rate first increases and then decreases. At 24℃, the mycelia are the whitest and densest, with the fastest growth rate of (6.74±0.63) mm / d, which is significantly different from that at 28℃ and 30℃. At 30℃, the mycelial growth rate is the slowest, at (0.82±0.36) mm / d, which is significantly different from that of other temperature treatment groups.
[0130] 6.5 pH Single-Factor Screening Test The initial pH of the basal culture medium was adjusted using 1.0 mol / L hydrochloric acid and 1.0 mol / L sodium hydroxide solution, and six initial pH gradients were set: 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0.
[0131] The effects of different pH conditions on mycelial growth rate are shown in the figure. Figure 9 .
[0132] Depend on Figure 9 It can be seen that the growth rate was fastest at pH 8, which was (6.71±0.82) mm / d, and there was a significant difference between the treatment groups at pH 5, 7 and 9, but no significant difference between the treatment groups at other pH. The growth rate was slowest at pH 7, which was (4.40±0.85) mm / d, and there was a significant difference between the treatment group at pH 8 and no significant difference between the treatment groups at other pH.
[0133] Ultimately, the inventors determined the optimal formula and conditions as follows: the carbon source is glucose, the nitrogen source is soybean meal, the inorganic salt is calcium chloride, the temperature is 24℃, and the pH is 8.
[0134] VII. Preliminary Screening (Small-scale Test) 1. Number of strains tested Reishi mushrooms were cultivated using a substrate-based soil covering method. Following the requirements of GB / T 21125-2007 (Edible Fungus Variety Selection Standard), the initial screening experiment was designed with 12 bags per group and 3 replicates. Each bag contained 550g of dry substrate, requiring a total of 6.6kg of dry substrate per group. Liquid inoculation was used, with 10mL inoculated per bag, and the bags were covered with soil after making small incisions at the bag opening.
[0135] 2. Results and Analysis The initial screening characteristics and yield of the white-fleshed Ganoderma lucidum strain L5470 in a small-scale trial are shown below. Figure 10 And Table 4.
[0136] Table 4. Statistics on yield and traits of Ganoderma lucidum strain L5470 in small-scale preliminary screening.
[0137] Note: Five bags were randomly selected from each group. The average weight of the fruiting bodies in a single bag was measured. Five fruiting bodies were randomly selected to calculate the average value of the fruiting body characteristics.
[0138] From Table 4 and Figure 10 It can be seen that the fruiting condition of the small-scale preliminary screening test group of white-fleshed Ganoderma lucidum strain L5470 was good. The yield test results showed that the average fresh weight of group 1 was 62.38g / bag, group 2 was 63.44g / bag, group 3 was 68.52g / bag, and the average yield of the three groups was 64.78g / bag. The experimental results were good, with an average fruiting rate of 66.67%. The fruiting was relatively uniform, and the caps were mostly fan-shaped to semi-circular, with a high glossy lacquer finish, reddish-brown surface, obvious ring patterns and radial longitudinal ridges; the stipes were flat or nearly cylindrical, with a smooth surface, a strong lacquer-like gloss, and a deep reddish-brown color; the flesh was thick and snow-white. The average transverse diameter is 10.83 cm and the average width is 9.48 cm. The stipe is long, nearly cylindrical, dark reddish-brown, and lateral, with an average length of 7.06 cm and a diameter of 1.90 cm. The average fresh weight of a single fruiting body is 64.78 g, the average dry weight of a single fruiting body is 21.22 g, and the biological efficiency is 11.78%.
[0139] 8. Small-scale rescreening 1. Number of trials Ganoderma lucidum was cultivated using substrate substitutes. In accordance with the requirements of GB / T 21125-2007 Technical Specifications for the Breeding of Edible Fungi, the small-scale re-screening test design was as follows: each group had 30 cultivation bags, each group had 300 mL of liquid spawn inoculation, and each group had 16.5 kg of dry substrate per bag. The test was repeated in 3 groups. For the white-fleshed Ganoderma lucidum strain L5470, the liquid spawn inoculation was 900 mL and the dry substrate per bag was 49.5 kg.
[0140] 2. Results and Analysis The small-scale re-screening characteristics and yield of the white-fleshed Ganoderma lucidum strain L5470 are shown in the figure. Figure 11 See Table 5.
[0141] Table 5. Statistics on yield and traits of Ganoderma lucidum strain L5470 in small-scale secondary screening.
[0142] Note: 10 bags were randomly selected from each group. The average weight of the fruiting bodies in a single bag was measured. The average value of 20 fruiting bodies was calculated by randomly selecting fruiting bodies.
[0143] From Table 5 and Figure 11 It can be seen that the fruiting condition of the white-fleshed Ganoderma lucidum strain L5470 in the small-scale re-screening test was good. The yield results showed that the average fresh weight of group 1 was 65.28 g / bag, group 2 was 68.72 g / bag, and group 3 was 62.34 g / bag, with an average yield of 65.45 g / bag for all three groups. The experimental results were good, with an average fruiting rate of 83.33%. The caps were fan-shaped to semi-circular, with a high glossy lacquer finish, reddish-brown in color, and had obvious annular rings and radial longitudinal ridges. The stipes were flat or nearly cylindrical, with a smooth surface, a strong lacquer-like gloss, and a deep reddish-brown color. The flesh was thick and snow-white. The average transverse diameter of the cap was 11.65 cm, and the average width was 9.06 cm. The average length of the stipe was 6.36 cm, and the diameter was 1.91 cm. The average fresh weight of a single fruiting body was 65.45 g, the average dry weight was 22.79 g, and the biological efficiency was 11.90%. The fruiting rate and yield have steadily increased compared with the initial screening in the small-scale test.
[0144] IX. Pilot Test 1. Number of trials The Ganoderma lucidum was cultivated using a substrate substitute. In accordance with the requirements of GB / T 21125-2007 Technical Specifications for the Breeding of Edible Fungi, the intermediate trial was designed with 1200 bags per group, 12L of liquid spawn per group, and 660kg of dry substrate per bag. The experiment was repeated three times. Therefore, the intermediate trial used 36L of liquid spawn of the white-fleshed Ganoderma lucidum strain L5470 and 1980kg of dry substrate per bag.
[0145] 2. Results and Analysis Intermediate test results for the fruiting characteristics and yield of the white-fleshed Ganoderma lucidum strain L5470 are shown below. Figure 12 See Table 6.
[0146] Table 6. Statistics on fruiting yield and traits of Ganoderma lucidum strain L5470 in intermediate trials (M±SD)
[0147] Note: M±SD represents mean ± standard deviation. Yield was measured using random sampling (three points), with 50 bags at each sampling point. Yield was determined by the average weight of the fruiting body per bag, and the average value of 30 randomly selected fruiting bodies was calculated for fruiting body characteristics.
[0148] From Table 6 and Figure 12 It can be seen that the fruiting condition of the intermediate experimental group of Ganoderma lucidum strain L5470 with white flesh was good. The yield measurement results showed that the average fresh weight of group 1 was 68.32g / bag, group 2 was 71.55g / bag, group 3 was 72.19g / bag, and the average yield of the three groups was 70.69g / bag. The experimental results were good, the fruiting was relatively uniform, and when the fruiting bodies were not fully mature, the caps were mostly nearly round and yellowish-brown. When fully mature, the caps were mostly round, with a high glossy lacquer finish, reddish-brown, with obvious ring patterns and radial longitudinal ridges; the stipes were flat or nearly cylindrical, with a smooth surface, a strong lacquer-like gloss, and a deep reddish-brown color; the flesh was thick and white. The average transverse diameter is 12.46 cm, the average width is 9.18 cm, and the average flesh thickness is 2.20 cm; the average stipe length is 5.63 cm and the diameter is 1.97 cm; the average fresh weight of a single fruiting body is 70.69 g, the average dry weight is 24.84 g, and the biological efficiency is 12.85%. From initial screening and secondary screening to intermediate trials, due to increasingly mature artificial domestication and cultivation management techniques, the yield has steadily increased, with a fruiting rate greater than 90%. The white-fleshed Ganoderma lucidum strain L5470 exhibits good stability, high fruiting rate, and unique characteristics.
[0149] 10. Demonstration Cultivation (Investigation and Analysis of Uniformity and Stability) 1. Demonstration Experiment Design The white-fleshed Ganoderma lucidum strain L5470 was used for substrate bag cultivation. Following the requirements of GB / T 21125-2007 Technical Specifications for Edible Fungi Variety Breeding, the demonstration cultivation experiment was designed with 10,000 bags per group (three replicates per site, approximately 3,600 bags per replicate). Each bag contained 550g of dry substrate, and liquid inoculation was used at 10mL per bag, resulting in an inoculation volume of 36.0L per group and 1980kg of dry substrate per group. White-fleshed Ganoderma lucidum strain L4439 served as a control. The same batch of strain and cultivation bags were used at each site to ensure consistent strain quantity and demonstration cultivation management techniques.
[0150] 2. Selection of demonstration sites Songming County, Panlong District, Wuding County, Chuxiong Prefecture, and Xundian County, Kunming City, Yunnan Province.
[0151] 3. Seasonal selection Depending on natural conditions and the growth characteristics of Ganoderma lucidum, seed production (bags) begins from mid-December to early March of the following year. The cultivation season for white-fleshed Ganoderma lucidum is from early April each year, and the harvesting season is from late July to mid-September. Ganoderma lucidum can be cultivated using natural (environmental) temperatures.
[0152] 4. Venue Selection Cultivation sites are mostly greenhouses, choosing sunny, sheltered, dry, hygienic locations close to water sources. For semi-wild Ganoderma lucidum cultivation, sites are mostly standardized woodlands, preferably in easily accessible, pollution-free areas with dense forests, gentle slopes, high humidity, and deep soil.
[0153] 5. Observation and Measurement Items Different groups at the demonstration site conducted separate surveys and data collection. The main observations focused on the key characteristics of the tested strains, and yield was recorded. Yields were also tallied after harvest. Simultaneously, a qualified testing company was commissioned to determine the content of major nutrients.
[0154] 6. Results and Analysis 6.1 Ganoderma lucidum cultivation cycle The cultivation cycles of the two white-fleshed Ganoderma lucidum varieties are shown in Table 7. The average growth cycles of the two white-fleshed Ganoderma lucidum varieties are 109 days and 96 days, respectively.
[0155] Table 7. First Cultivation Cycle of Two White-Fleshed Ganoderma Lucidum Varieties
[0156] 6.2 Ganoderma lucidum yield and biological conversion rate Table 8 shows the yield and biological conversion rate of the two white-fleshed Ganoderma lucidum varieties. White-fleshed Ganoderma lucidum strain L5470 exhibited higher yield and biological conversion rate in multiple pilot trials and years. In cultivation trials across four pilot sites, the average yield of strain L5470 reached 69.53 g / bag, with a biological conversion rate as high as 12.64%. In contrast, the average yield of strain L4439 (CK) was only 60.05 g / bag, with a biological conversion rate of only 10.92%. Specifically, in Panlong District, Kunming City, the average yield of strain L5470 in 2024 and 2025 was 71.73 g / bag, with an average biological conversion rate of 13.05%, both significantly higher than the data for strain L4439 (CK) during the same period. Furthermore, the yield of the white-fleshed Ganoderma lucidum strain L5470 reached 73.68 g / bag in Wuding County, Chuxiong Prefecture in 2025, with a biological conversion rate of 13.40%, further demonstrating its yield advantage. The yield and biological conversion rate of the white-fleshed Ganoderma lucidum strain L4439 (CK) were generally lower, especially in Xundian County, Kunming City, where its average seed yield was 55.83 g / bag and the biological conversion rate was 10.15%. Overall, the white-fleshed Ganoderma lucidum strain L5470 outperformed the white-fleshed Ganoderma lucidum strain L4439 (CK) in both yield and biological conversion rate, and its performance remained stable across different pilot projects and years.
[0157] Table 8. First-crop yield and biological conversion rate of two Ganoderma lucidum varieties
[0158] Note: M±SD represents the mean ± standard deviation. Different lowercase letters in the same column indicate significant differences (p<0.05). 30 bags were randomly selected from each group, and the average fresh weight and dry weight of each bag were measured.
[0159] 6.3 Main agronomic traits of Ganoderma lucidum Table 9 shows that the two tested varieties differed in key agronomic traits. The white-fleshed Ganoderma lucidum strain L5470 outperformed the white-fleshed Ganoderma lucidum strain L4439 (CK) under the same conditions in all test sites. The average cap length of white-fleshed Ganoderma lucidum strain L5470 in the four test sites during 2024-2025 was 12.25 cm, the average cap width was 10.87 cm, and the average stipe length was 5.43 cm; while the average cap length of white-fleshed Ganoderma lucidum strain L4439 (CK) in the same four test sites during 2024-2025 was 11.18 cm, the average cap width was 9.45 cm, and the average stipe length was 5.07 cm.
[0160] Table 9. Main agronomic traits of the first crop of two white-fleshed Ganoderma lucidum varieties
[0161] Note: M±SD represents mean ± standard deviation. Different lowercase letters in the same column indicate significant differences (p<0.05). 30 bags were randomly selected from each group, and the average values of various agronomic traits of each bag were measured.
[0162] Demonstration results from four locations over two years (2024-2025) showed that, compared to the control strain L4439 (CK), the white-fleshed Ganoderma lucidum strain L5470 exhibits unique fruiting body characteristics, larger caps, longer stipes, higher cultivation stability, and higher fruiting rate. When the fruiting body is not fully mature, the caps are mostly nearly round and yellowish-brown; when fully mature, the caps are mostly round, with a high-gloss, lacquer-like appearance, reddish-brown, and have distinct ring patterns and radial longitudinal ridges. The stipes are flat or nearly cylindrical, with a smooth surface, a strong lacquer-like sheen, and a deep reddish-brown color. The flesh is thick and white. The average cap length is 12.25 cm and the average cap width is 10.87 cm; the flesh is white, with an average thickness of 2.15 cm and a relatively soft texture; the stipe is dark reddish-brown, with an average length of 5.43 cm, darker than the cap, and an average diameter of 2.03 cm. The average fresh weight of a single mushroom is 69.53 g, the average dry weight is 23.98 g, the biological conversion rate is 12.64%, and the average cultivation period is 109 days. The fruiting body of the white-fleshed Ganoderma lucidum strain L4439 (CK) is yellowish-brown, with caps mostly fan-shaped or kidney-shaped, and a few round, with a high-gloss, lacquer-like appearance. The stipe is irregularly cylindrical, dark brown, and the flesh is white. Compared to the white-fleshed Ganoderma lucidum strain L4439 (CK), the white-fleshed Ganoderma lucidum strain L5470 exhibits better overall fruiting performance, a longer fruiting cycle, a unique mushroom shape, and a longer stipe. In contrast, the fruiting bodies of the bag-grown white-fleshed Ganoderma lucidum strain L4439 (CK) mostly have kidney-shaped or fan-shaped caps, shorter stipes, and thinner caps. Therefore, the white-fleshed Ganoderma lucidum strain L5470 can be promoted and applied as a new Ganoderma lucidum variety, suitable for greenhouse cultivation and understory biomimetic cultivation.
[0163] The strain L5470 of Ganoderma lucidum with white flesh produces a spawn with robust mycelium, rapid mycelial growth, low contamination, and strong resistance to contamination. The fruiting bodies are reddish-brown and stable in characteristics. The mushrooms are large, with almost no branching, thick flesh, and white flesh. They have a strong aroma, high polysaccharide content, rich nutrients, and mild bitterness. Compared with the control, the agronomic traits are significantly different, indicating high application value and good market prospects.
[0164] Specificity: The appearance of Ganoderma lucidum strain L5470 and strain L4439 (CK) differs significantly. Both have snow-white flesh and a slightly bitter taste. When the cap of strain L5470 is not fully mature, it is mostly nearly round and yellowish-brown; when fully mature, the cap is mostly round, with a glossy, reddish-brown appearance. The cap of strain L4439 (CK) is yellowish-brown and mostly kidney-shaped or fan-shaped. The stipe of strain L5470 is thicker, while that of strain L4439 (CK) is thinner. Strain L5470 is rich in nutrients, with a significantly higher polysaccharide content than strain L4439 (CK). Both strains are suitable for cultivation at altitudes of 1600-2600m.
[0165] Uniformity: Through two years of cultivation demonstration observation, the white-fleshed Ganoderma lucidum strain L5470 exhibits uniformity.
[0166] Stability: The white-fleshed Ganoderma lucidum strain L5470 exhibits consistency and is, in principle, stable.
[0167] 10. High-temperature and low-temperature resistance identification and Penicillium resistance identification Determination of mycelial growth rate at high and low temperatures: White-fleshed Ganoderma lucidum strains L5470 and L4439 (CK) grown on PDA plates were perforated with a 0.5 cm punch and placed on new PDA plates for a temperature gradient growth experiment. Eleven culture temperatures were set: 5℃, 10℃, 15℃, 20℃, 22℃, 24℃, 26℃, 28℃, 30℃, 32℃, and 35℃. Each temperature was replicated three times, and the growth rate was measured after 3 days of culture.
[0168] Growth rate = R: Colony diameter (mm) T: Incubation time (d) Penicillium resistance detection method: First, holes were punched in a 0.5 cm diameter hole in a plate containing *Ganoderma lucidum* strain L5470, *Ganoderma lucidum* strain L4439 (CK), and *Penicillium*. The plates were then placed on new PDA plates, with the *Ganoderma lucidum* strain on one side and *Penicillium* inoculated on the other. Each resistance experiment was performed in triplicate, and the inhibition rate was calculated.
[0169]
[0170] In the formula: R CK Radius of normally growing contaminating bacteria (cm) R1: Radius of bacterial growth in the two-point confrontation experiment (cm).
[0171] Table 10. Mycelial growth rate of Ganoderma lucidum strains L5470 and L4439 (CK) (unit: mm / d)
[0172] Results of the low-temperature resistance test: As shown in Table 10, after culturing for 13 days at temperatures of 5℃, 10℃, 15℃, 20℃, 22℃, and 24℃, the mycelial growth rates of Ganoderma lucidum strains L5470 and L4439 (CK) were generally consistent, with no significant difference. At 5℃ for 13 days, neither strain germinated. At 10℃ for 13 days, both mycelial germination and growth were relatively slow. As the temperature gradually increased, the mycelial growth rates of both strains gradually increased, showing a consistent growth pattern with minimal difference. Strain L5470 grew faster than strain L4439 (CK) at both 10℃ and 15℃. Therefore, comparatively, strain L5470 germinated more easily under low-temperature conditions, exhibited faster mycelial growth, and demonstrated stronger low-temperature resistance.
[0173] Table 11. Mycelial growth rate of Ganoderma lucidum strains L5470 and L4439 (CK) (unit: mm / d)
[0174] Results of high-temperature resistance test: As shown in Table 11, after culturing for 13 days at temperatures of 26℃, 28℃, 30℃, 32℃, and 35℃, the mycelial growth rate of Ganoderma lucidum strain L5470 was consistent with that of Ganoderma lucidum strain L4439 (CK). With increasing temperature, the mycelial growth slowed down significantly and even stopped. At temperatures of 26℃ to 30℃, there was no significant difference in mycelial growth between Ganoderma lucidum strain L5470 and Ganoderma lucidum strain L4439 (CK), but the mycelia of Ganoderma lucidum strain L5470 were denser and whiter than those of Ganoderma lucidum strain L4439 (CK). With increasing temperature, the growth rate of both strains slowed down. At 30℃, the mycelial growth rate of Ganoderma lucidum strain L5470 was faster than that of Ganoderma lucidum strain L4439 (CK). When the temperature reaches 32℃, neither the mycelium of Ganoderma lucidum strain L5470 nor the Ganoderma lucidum strain L4439 (CK) will germinate.
[0175] Based on the results of the low-temperature resistance test, it can be found that the optimal temperature for mycelial culture of Ganoderma lucidum strain L5470 is 22℃~24℃, while the optimal temperature for mycelial culture of control strain L4439 (CK) is 24℃~26℃. Compared with strain L4439 (CK), strain L5470 is more resistant to both high and low temperatures, and has a wider mycelial growth temperature range.
[0176] Table 12 Inhibition rates of Ganoderma lucidum strains L5470 and L4439 (CK) against Penicillium
[0177] Among them, R CK R1: Radius of normally growing contaminating bacteria (cm); R2: Radius of contaminating bacteria in the two-point confrontation experiment (cm) Results: Table 12 shows that in the antibacterial test of Ganoderma lucidum against Penicillium, the inhibition rate of Ganoderma lucidum strain L5470 against Penicillium was 72.2%, while that of strain L4439 (CK) was 47.6%. This indicates that strain L5470 had a higher inhibition rate than the control strain L4439 (CK), demonstrating stronger resistance to Penicillium. Furthermore, it exhibited low contamination rates in seed production, rapid feeding, and low susceptibility to contamination by other microorganisms, demonstrating strong resistance to contamination. In multiple batches of cultivation trials, it also showed low rates of contamination and pest / disease occurrence. Therefore, the results indicate that strain L5470 possesses strong disease resistance.
[0178] XI. Morphological Observation of Fruiting Entities Morphological observation of the fruiting body, such as Figure 15 As shown.
[0179] Identification (diagnosis): The characteristics of white-fleshed Ganoderma lucidum are that it has a basidiospore (fruiting body) with a central stalk, a yellowish-brown to reddish-brown cap, and basidiospores that are shaped like melon seeds or broadly elliptical.
[0180] Etymology: White flesh refers to the fleshy part of the Ganoderma lucidum fruiting body, especially the white color of the flesh after it is cut open.
[0181] Fruiting body: Annual, stalked, submesotropic to mesotropic or lateral, hard to woody. The cap is solitary; when immature, it is mostly nearly round and yellowish-brown; when fully mature, it is mostly round, glossy and reddish-brown, reaching 9.16-12.79 cm in diameter and 2.15 cm in thickness. It has a weak to strong glossy sheen, is yellowish-brown, smooth, covered with a thin layer of hard shell, and has concentric rings. The margin is distinct, slightly blunt, and variable in color, white when young, and the same color as the cap when mature. The flesh is no more than 2.32 cm thick, double-layered; the lower layer is pale yellow, fibrous, composed of loose coarse fibers; the upper layer is white; it is corky to woody, with distinct concentric growth zones, and no black sheath lines are observed. The tubes are hard woody, grayish-brown, up to 0.6 cm long, and not layered. Pores 4-6 per millimeter, round to angular, with slightly thickened septa and entire margins; pore surface grayish-white to lead-gray (2D2), turning pale yellow when dry (5D1). Stipe 4.82-5.85 × 1.94-2.16 cm, central, cylindrical, with a strong lacquer-like sheen, dark reddish-brown, fibrous to woody.
[0182] The mycelium has three systems: reproductive hyphae are 2.0-3.5 μm in diameter, colorless, thin-walled, and have clamp connections; skeletal hyphae are 3.0-6.0 μm in diameter, nearly thick-walled to solid, without septa, dendritic with few branches, pale yellow to golden yellow; ligation hyphae are 1-2.5 μm in diameter, thick-walled, often interwoven and branched, transparent to pale yellow, and sparse; all hyphae are IKI- and CB+; the tissue darkens in KOH.
[0183] Cortex cells: 20-45×5.5-7.5μm, club-shaped to cylindrical, entire or with few lateral protuberances, thick-walled, without granules at the apex, golden yellow to yellowish-brown, moderately starchy when mature.
[0184] Basidiospores: (80 / 6 / 3)(9.0)10-11.0-12.0(12.5)×(6.5)7.0-7.9-8.5(9.0)μm, Q=(1.12)1.25-1.55(1.63), Qm=1.40±0.09 (including umbilicus); Main pattern: (40 / 2 / 1)10.0-10.9-12×7.0-7.9-8.5(9.0)μm, Q=(1.20)1.25-1.52, Qm=1.39±0.08 (including umbilicus). When mature, they are mostly kernel-shaped to broadly elliptical, usually tapering to obtuse at one end, with a blastopore at the apex, yellow to medium brown, IKI-, CB+, with a starchy reaction; sporangia wrinkled, double-walled, with a coarse free column within the wall. The basidia are broadly club-shaped to bladder-shaped, transparent, with clamp-like ligaments and four basidia stalks, 11-19 × 10-13 μm; the pseudo-basidia shell is pear-shaped to fusiform, 10-15 × 8-12 µm.
[0185] XII. Quality Analysis Report of White-fleshed Ganoderma L5470 Statistical analysis of nutrients and functional components of Ganoderma lucidum strains L5470 and L4439 (CK) is shown in Table 13.
[0186] Table 13 Component Statistics of Ganoderma lucidum strains L5470 and L4439 (CK)
[0187] In 2024, samples of Ganoderma lucidum strains L5470 and L4439 (CK) were collected from the planted and matured stages. After low-temperature drying, the dried samples were sent to the Guangdong Provincial Center for Microbiology Analysis and Testing for analysis. The total amino acid content of Ganoderma lucidum strain L5470 was 12.10 g / 100g, and that of Ganoderma lucidum strain L4439 (CK) was 14.0 g / 100g. The protein content of Ganoderma lucidum strain L5470 was 17.0 g / 100g, and that of Ganoderma lucidum strain L4439 (CK) was 17.9 g / 100g. The fat content of Ganoderma lucidum strain L5470 was 0.8 g / 100g. The fat content of strain L4439 (CK) was 1.4 g / 100 g, while the polysaccharide content of strain L5470 was 1.68%, and that of strain L4439 (CK) was 1.23%. The triterpenoids and sterols of strain L5470 were 2.84%, while those of strain L4439 (CK) were 3.62%. The polysaccharide content of strain L5470 was significantly higher than that of strain L4439 (CK).
[0188] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. A white-fleshed Ganoderma lucidum strain L5470, characterized in that, It was deposited at the Guangdong Provincial Center for Microbial Culture Collection, China on October 23, 2025, with accession number GDMCC No: 67155.
2. The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 according to claim 1, characterized in that, Includes the following steps: Step A, Propagation of Mother Culture: Under aseptic conditions, take tissue blocks of Ganoderma lucidum strain L5470 and inoculate them onto the mother culture PDA medium. Incubate at 24℃ for 10-12 days to obtain mycelial blocks. The mother culture PDA medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 19-21 parts agar powder, 1.9-2.1 parts potassium dihydrogen phosphate, and 990-1010 parts water; Step B, liquid shake flask culture: Inoculate the mycelial blocks cultured in Step A into sterilized shake flask culture medium and culture in a shaker at 22.5-23.5℃ for 8-10 days to obtain the seed liquid; The shake flask culture medium comprises the following raw materials by weight: 200 parts potato, 19-21 parts glucose, 1.9-2.1 parts soybean meal, 0.39-0.41 parts potassium dihydrogen phosphate, 0.19-0.21 parts calcium chloride, and 990-1010 parts water, with a pH of 7.5-8.
5. Step C, liquid fermentation culture: The seed culture obtained in step B is inoculated into the fermentation broth culture medium and cultured at 22.5-23.5℃ for 8-11 days to obtain liquid inoculum; The fermentation broth culture medium includes the following raw materials by weight: 600 parts soluble starch, 2350-2450 parts glucose, 190-210 parts soybean meal, 115-125 parts potassium dihydrogen phosphate, 59-61 parts calcium chloride, 99000-101000 parts water, with a pH value of 7.5-8.
5. Step D, Preparation of culture medium: Inoculate the liquid culture medium prepared in step C into the culture bag and place it in a constant temperature incubator at 23℃; The cultivation substrate in the cultivation bag comprises the following raw materials by weight: 73-75 parts hardwood sawdust, 3.8-5.2 parts cottonseed hulls, 17-19 parts wheat bran, 1.9-2.1 parts soybean meal, 0.9-1.1 parts gypsum powder, and 0.9-1.1 parts lime powder; pH value 6-8, moisture content 55-65%; Step E, Soil Covering Cultivation and Harvesting: After the mycelium in the cultivation bags has fully grown, transport them to the commercial forest cultivation base and pile them on the ground in a shaded area to continue post-ripening for 5-7 days. Make ridges along the slope of the forest land, with a ridge width of 1-1.2m and a furrow depth of 30-35cm. Then, open the bags with small holes, tilt them at a 45° angle, and cover them with soil for planting. When the pale yellow growth ring on the edge of the cap disappears and spores are released, the fruiting bodies can be harvested.
3. The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 according to claim 2, characterized in that, In step D, the cells are incubated at a constant temperature for 34-40 days.
4. The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 according to claim 2, characterized in that, In step E, the commercial forests include walnut forests and Chinese pine forests.
5. The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 according to claim 2, characterized in that, In step E, five mushroom sticks are planted horizontally on the ridge.
6. The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 according to claim 2, characterized in that, In step E, commercial forests with a canopy closure of 7.5-8 do not require shading, forests with a canopy closure greater than 8 are not suitable for planting, and forests with a canopy closure less than 7.5 can control the light intensity at 1800-3200 Lux by building small arched sheds.
7. The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 according to claim 6, characterized in that, In step E, the light intensity is adjusted by covering the small arched shed with a 3-6 needle shade net.
8. The cultivation method of the white-fleshed Ganoderma lucidum strain L5470 according to claim 6, characterized in that, In step E, if the weekly rainfall is greater than 30 mL, cover the small arched shed with a white plastic film to protect it from rain and keep it warm.
9. The use of the mycelium, fruiting body or fermentation broth of the white-fleshed Ganoderma lucidum strain L5470 as described in claim 1 in the preparation of drugs with hepatoprotective, anti-inflammatory and anti-tumor effects.
10. The use of the mycelium, fruiting body or fermentation broth of the white-fleshed Ganoderma lucidum strain L5470 as described in claim 1 in the preparation of drugs that enhance human immunity.