A strain of fungus ZLLLJ10 and its application in the control of Agastache rugosa.

Abstract

This invention relates to a fungus Didymella sp. ZLLLJ10 and its application in controlling *Eupatorium adenophorum*. The fungus is... Didymella sp. ZLLLJ10, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42795, is an isolated strain from the dead leaves of the native plant *Chrysanthemum indicum*, which grows alongside *Ageratum adenophorum*. It exhibits high lethality against *Ageratum adenophorum* seedlings and is safe for various native plants and economic crops. This invention also provides a biocontrol agent containing this fungus and its application method. This invention can effectively kill *Ageratum adenophorum* seedlings, inhibit its population establishment and spread, reduce the use of chemical herbicides, and provide a new microbial resource and technical solution for the green control of the invasive alien plant *Ageratum adenophorum*.

Description

Technical Field

[0001] This invention belongs to the field of microbiology and its application technology, and in particular to a fungus for controlling the growth of *Eupatorium adenophorum* seedlings (…). Didymella sp . ZLLLJ10 and its application technology field. Background Technology

[0002] Purple-stemmed Eupatorium ( Ageratina adenophora *Ageratum adenophorum* is a perennial herbaceous plant belonging to the genus *Ageratum* in the family Asteraceae. Native to Central America, it invaded southern Yunnan, my country from Myanmar in the 1940s and has since spread rapidly, now widely distributed in Yunnan, Guizhou, Guangxi, Sichuan, Hubei, and Chongqing. This plant displaces native plants, forming dense, monoculture communities in farmland, disturbed forests, and roadsides, inhibiting native plant growth and causing ecological damage and severe economic losses to agriculture, forestry, and animal husbandry. In 2003, *Ageratum adenophorum* was listed by the State Environmental Protection Administration as one of the 16 most important invasive alien species in my country. It is predicted that it will spread to most potential suitable habitats within the next 20 years. Therefore, controlling the invasion of *Ageratum adenophorum* is a crucial task for ecological environmental protection in southwestern my country.

[0003] Currently, biological control of *Ageratum adenophorum* mostly employs fungal inoculants, but most of these inoculants primarily target mature plants. Mature plants are highly resistant to pathogens, and control efficacy is often unsatisfactory under natural conditions. In contrast, seedlings allocate more resources to growth than defense, making them less resistant to pathogens. Given the crucial role of seedling survival in the establishment of invasive plant populations, the application of biocontrol agents during the seedling stage is expected to significantly improve control effectiveness. Developing fungal control technologies targeting the seedling stage will provide a sustainable and environmentally friendly solution for the control of *Ageratum adenophorum*. Summary of the Invention

[0004] This invention aims to address the aforementioned problems and deficiencies by providing a fungus isolated and screened from the natural environment. Didymella sp . ZLLLJ10. This fungus has a high lethal effect on *Ageratum adenophorum* seedlings, effectively controlling the survival and spread of *Ageratum adenophorum* during the seedling stage. Preparing this fungus into a biocontrol agent and applying it to *Ageratum adenophorum* seedlings overcomes the problem of poor efficacy caused by existing fungal agents primarily acting on mature plants, significantly reducing the survival rate of *Ageratum adenophorum* seedlings, thereby inhibiting its population establishment and further invasion. This invention provides a safe, efficient, and environmentally friendly new solution for the biological control of *Ageratum adenophorum*.

[0005] The present invention is implemented using the following technical solution.

[0006] A fungus, the fungus described in this invention is ( Didymellasp.) ZLLLJ10 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42795. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0007] As a product, the present invention provides a biocontrol agent comprising the aforementioned fungus ( Didymella sp . )ZLLLJ10.

[0008] As an application, the present invention relates to the use of the aforementioned fungus in the control of Agastache rugosa.

[0009] This invention relates to the application of the aforementioned biocontrol agent in controlling Agastache rugosa.

[0010] The purple-stemmed eupatorium in the aforementioned applications of this invention is a seedling of purple-stemmed eupatorium.

[0011] In the aforementioned applications, the present invention is applied using the mycelium form of the fungus.

[0012] As a method, the present invention provides a method for controlling *Eupatorium adenophorum*, the method comprising: [the method is described in the original text, but the provided text is incomplete and cannot be accurately translated]. Didymella sp . ZLLLJ10 was applied to Eupatorium fortunei.

[0013] As a method, the present invention provides a method for controlling *Eupatorium adenophorum*, the method comprising applying the aforementioned biocontrol agent to *Eupatorium adenophorum*.

[0014] The purple-stemmed eupatorium in the aforementioned method of this invention is a seedling of purple-stemmed eupatorium.

[0015] In the aforementioned method, the fungus is applied in the form of mycelium.

[0016] The beneficial effects of this invention are as follows: 1) The strain is safe in origin and exhibits good ecological adaptability. The strain ZLLLJ10 described in this invention was isolated from the dead leaves of *Chrysanthemum indicum*, a native plant that grows alongside *Eupatorium adenophorum*, and obtained by infecting *Eupatorium adenophorum* seedlings under natural conditions. This strain originates from the local ecological environment and is not exogenously introduced. It has a natural adaptability to the target habitat, avoiding the ecological risks that may be caused by the introduction of exogenous microorganisms and ensuring its environmental safety in pest control applications.

[0017] 2) It has a high lethal effect on seedlings of *Eupatorium adenophorum*. Greenhouse experiments showed that a suspension of *ZLLLJ10* mycelium (concentration 1×10⁻⁶) had a high lethal effect. 5 Spraying 4-week-old *Ageratum aizoon* seedlings with mycelial fragments ( / mL) can cause mass seedling mortality in a short period of time (see [link]). Figure 7 , Figure 8 Compared to existing fungal agents that mainly act on resistant mature plants, this invention precisely targets the seedling stage, significantly improving control efficiency and effectively curbing the establishment and spread of *Ageratum adenophorum* populations.

[0018] 3) High safety to local plants and economic crops. Host range determination results show (see...) Figure 4 (See Table 1) ZLLLJ10 showed no significant pathogenicity to 20 native plant species, including Senecio scandens, dandelion, Buddleja officinalis, peach, lemon, waxberry, and pear, as well as 5 common economic crops. Field safety assessments also confirmed that the fungus produced only mild or no symptoms on non-target plants such as Buddleja officinalis (see Table 1). Figure 3 This indicates that the bacterium has high host specificity and can be used for targeted control in areas invaded by Eupatorium adenophorum without harming local biodiversity and agricultural production.

[0019] 4) The preparation method is simple and easy to promote and apply. This invention uses conventional PDA / PDB medium for strain culture, and the mycelial suspension can be obtained by simple grinding. No complicated equipment or special fermentation conditions are required. It is convenient to operate, low in cost, and suitable for large-scale preparation and field application.

[0020] 5) Green and environmentally friendly, reducing reliance on chemical herbicides. The biological control method provided by this invention can effectively replace or reduce the use of chemical herbicides, reduce the harm of chemical residues to soil, water bodies and non-target organisms, meet the requirements of sustainable agricultural development, and provide a safe, efficient and environmentally friendly new solution for the ecological management of Agastache rugosa invasion.

[0021] The present invention will be further explained below with reference to the accompanying drawings and specific embodiments. Attached Figure Description

[0022] Figure 1 A photograph of fungal dead leaves of *Chrysanthemum inoculated onto water agar medium of *Eupatorium adenophorum* seedlings.

[0023] Figure 2 The image shows the results of the sequence of the strain selected in this invention being uploaded to the NCBI database for comparison.

[0024] Figure 3 A field safety evaluation diagram of a strain that has a high lethal effect on *Eupatorium adenophorum* seedlings on *Buddleja officinalis* leaves.

[0025] Figure 4 The image shows the pathogenic lesions on the leaves of *Buddleja officinalis* caused by the strain one week later.

[0026] Figure 5 Heatmaps were generated to determine the host range of ZLLLJ10 for 20 native plant species and 5 economic crops, and the average mortality rate of 20 fungal strains on seedlings of Eupatorium adenophorum was also generated.

[0027] Figure 6 This is a photo of *Eupatorium adenophorum* germinating in a seedling tray.

[0028] Figure 7 This is a photograph of strain ZLLLJ10 cultured in an Erlenmeyer flask for one week.

[0029] Figure 8 The image shows the effect of spraying ZLLLJ10 mycelial suspension onto Eupatorium fortunei seedlings for 4 days.

[0030] Figure 9 The image shows the effect of spraying ZLLLJ10 mycelial suspension onto PDA double-antibiotic medium on seedlings of Eupatorium adenophorum that died after being killed. (The seedlings were identified as ZLLLJ10 based on morphological comparison.)

[0031] Figure 10 Comparison of mortality between the blank control and the ZLLLJ10 treatment.

[0032] Figure 11 This is a graph showing the trend of mortality rates in the control group and the ZLLLJ10 treatment within 2 weeks after bacterial spraying. Detailed Implementation

[0033] The following embodiments are only a part of the technical solutions of the present invention and are not intended to limit all technical solutions of the present invention. The embodiments of the present invention are provided to further explain and illustrate the details of the technical solutions of the present invention. Unless otherwise specified, the methods in the embodiments are performed according to conventional operations, and the reagents used are all conventionally purchased reagents or reagents prepared according to conventional methods.

[0034] A fungus, the fungus described in this invention is ( Didymella sp.) ZLLLJ10 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42795. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0035] As a product, the present invention provides a biocontrol agent comprising the aforementioned fungus ( Didymella sp . )ZLLLJ10.

[0036] As an application, the present invention relates to the use of the aforementioned fungus in the control of Agastache rugosa.

[0037] This invention relates to the application of the aforementioned biocontrol agent in controlling Agastache rugosa.

[0038] The purple-stemmed eupatorium in the aforementioned applications of this invention is a seedling of purple-stemmed eupatorium.

[0039] In the aforementioned applications, the present invention is applied using the mycelium form of the fungus.

[0040] As a method, the present invention provides a method for controlling *Eupatorium adenophorum*, the method comprising: [the method is described in the original text, but the provided text is incomplete and cannot be accurately translated]. Didymella sp . ZLLLJ10 was applied to Eupatorium fortunei.

[0041] As a method, the present invention provides a method for controlling *Eupatorium adenophorum*, the method comprising applying the aforementioned biocontrol agent to *Eupatorium adenophorum*.

[0042] The purple-stemmed eupatorium in the aforementioned method of this invention is a seedling of purple-stemmed eupatorium.

[0043] In the aforementioned method, the fungus is applied in the form of mycelium.

[0044] To achieve the above objectives, the present invention adopts the following technical measures: 1. Sample collection and processing Native plants sharing the same habitat as *Eupatorium adenophorum* were selected. Leaf litter / rhizosphere soil samples were collected from Gaoligong Mountain, Tengchong City, Yunnan Province, while *Eupatorium adenophorum* seeds were collected from Tuanjie Township, Kunming City, Yunnan Province. Samples were collected from three plots, with three replicates per population. Each population was used as a replicate, and the three populations were selected as three independent replicates.

[0045] The collected local plant leaf samples were dried, and the leaves were ground and cut into pieces of about 2 mm. 0.1 g of each withered leaf sample was weighed and placed in a 2 mL sterile centrifuge tube. These samples will be used to inoculate *Eupatorium adenophorum* seedlings. All samples were divided into a bacterial group and a sterile group. The sterile group consisted of sterile samples irradiated with gamma rays, while the bacterial group consisted of samples that had not been irradiated and contained microorganisms.

[0046] 2. Germination of *Eupatorium adenophorum* and inoculation with dead leaves / rhizosphere soil and determination of its mortality rate First, prepare water agar medium. Then, surface-sterilize the seeds of *Ageratum adenophorum* (immerse in 75% ethanol solution for 30 seconds, 2% sodium hypochlorite solution for 3 minutes, and rinse 5 times with sterile water) and soak them in sterile water for 12 hours to promote germination. After soaking, blot the seeds dry with sterile filter paper, and select plump seeds to inoculate them onto water agar plates, with 16 seeds inoculated per plate. Place them in an artificial climate chamber for germination. After 3 weeks of germination, evenly inoculate 0.1g of prepared dead leaf or rhizosphere soil sample into the water agar medium containing *Ageratum adenophorum* seedlings. Observe the seedling mortality for 2 weeks, and then pick out dead seedlings to isolate fungi.

[0047] 3. Molecular identification Single fungal colonies were selected, and DNA was extracted from fungal hyphae using the CTAB method. The ITS region of the DNA was then amplified using universal primers ITS4 (5'-TCCTCCGCTTATTGATATGC-3') and ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3'). The amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared and analyzed on NCBI (https: / / static.pubmed.gov / portal / portal.fcgi / ) to record the fungal taxonomic position. Based on the comparative analysis, this strain is classified as... Didymella sp.

[0048] 4. Preparation and application methods of mycelial suspension Step 1) Pick out ZLLLJ10 from the slant and culture it on potato dextrose solid medium (PDA) at 25°C under light for one week.

[0049] Step 2) Use a 6mm punch to make holes around the colony, and transfer the colony block to an Erlenmeyer flask containing 100mL of potato glucose broth (PDB) for one week of incubation at 180rpm, 25℃, and light.

[0050] Step 3) Filter the mycelium through a funnel, and mix it with 10% glycerol and 2% sucrose in a 1:1 ratio. Grind the mycelium using a mixer (PHILIPS, HR2864, China) on speed 1 for 2 minutes, adjusting the concentration to 1 x 10⁻⁶. 5 Mycelial segments / mL.

[0051] Step 4) Spray the prepared mycelium suspension onto the surface of 4-week-old Agastache rugosa seedlings.

[0052] The reagents required for this invention are: agar, sucrose, ethanol, sodium hypochlorite, streptomycin sulfate, and ampicilin sodium.

[0053] Water agar medium: 1000mL tap water, 10g agar, natural pH.

[0054] PDA medium (500mL): Boil 100g of potato in 500mL of tap water, filter, and add water to bring the volume to 500mL. Agar 8g, sucrose 10g, natural pH.

[0055] PDB medium (150 mL): Potato glucose broth (PDB medium) (Chinok) 5.25 g, add water to 150 mL, natural pH.

[0056] 1 / 5 PDA medium (500mL): Boil 20g of potato in 500mL of tap water, filter, and add water to bring the volume to 500mL. Add 2g of sucrose and 8g of agar, at natural pH.

[0057] Example 1 Isolation, screening and identification of strains

[0058] 1) Samples were collected from Gaoligong Mountain in Tengchong City, Yunnan Province, using *Chrysanthemum indicum*, a native plant that grows alongside *Eupatorium adenophorum*. Samples were collected from three plots, with three replicates per population. Each population was used as a replicate, and three populations were selected as three independent replicates. Rhizosphere soil samples were collected from the rhizosphere soil of plants with dead leaves. After collection, samples were allowed to air dry in a clean room. Rhizosphere soil samples were sieved through a 2mm sieve, and dead leaf samples were ground and chopped into approximately 2mm pieces. Each sample was aliquoted (1g) into sterile 2ml centrifuge tubes and stored at 4℃ for subsequent experiments. All samples were divided into two groups: sterile and non-sterile. The sterile group consisted of samples irradiated with gamma rays (30kGy, 30h, Kunming Huayuan Nuclear Radiation Technology Co., Ltd.) without any microorganisms. The sterile group consisted of untreated samples.

[0059] 2) Isolation and culture of biocontrol bacteria for *Eupatorium adenophorum* seedlings: First, prepare water agar medium (5g agar, 500ml water). Then, surface sterilize the *Eupatorium adenophorum* seeds by soaking them in 75% ethanol solution for 30 seconds, followed by soaking them in 2% sodium hypochlorite solution for 3 minutes, and then rinsing them 3-5 times with sterile water. After sterilization, pat the seed surface dry with sterilized filter paper, select plump seeds, and inoculate them onto water agar plates (16 seeds per plate). Place them in an artificial climate chamber (RXZ-380D, Ningbo Southeast Instrument Co., Ltd., Ningbo, China) for germination. The temperature is set at 25 / 20℃ (day / night), the light intensity is 12000 lux, the photoperiod is 12h, and the humidity is 60%. After 3 weeks of germination, 0.1g of prepared dead leaves or rhizosphere soil samples are evenly inoculated into the water agar medium containing *Eupatorium adenophorum* seedlings. For two consecutive weeks, the number of dead seedlings was observed and recorded daily, and the mortality rate was calculated.

[0060] Seedling mortality was observed after two weeks of continuous culture. If seedling death was observed due to fungal infection, the entire seedling was separated into fragments approximately 0.1 mm x 0.1 mm in size and inoculated into 1 / 5 PDA medium, with three inoculation points on each medium. After the strain grew, it was promptly isolated and purified into fresh PDA medium. Sequencing was performed one week later, and the fragments were stored at 4°C for subsequent experiments.

[0061] For strain identification, fungal mycelial DNA was extracted using the CTAB method, followed by amplification of the ITS region of the DNA using universal primers ITS4 and ITS5. The amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared and analyzed to record the taxonomic position of the fungus.

[0062] The sequencing company returned the result sequence (ZLLLJ10-ITS): ACCCTAGCCTGATCCGAGGTCAGAGTGTAAAAAATATACTTTTTGGACGTCGTCGTTGTGAGTGCAAAGCGCGAGATGTACTGCGCTCCGAAATCAATACGCCGGCGGCTGCCAATTGTTTTGAGGCGA GTCTGCGCGCAGAGGCGAGACAAACACCCAACACCAAGCAGAGCTTGAAGGTACAAATGACGCTCGAACAGGCATGCCCCATGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACT GAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAACTATTAAGTTTTTTCAGACGCTGATTTCAATTACAAAGGGTTT AAGTGTTGTCCAGTCGGCGGGCGGACCCGCCGAGGAAACGAAGGTACTCAAAAGACATGGGTAAGAGATGGCAGGCAAAGCCCGCAACTCTAGGTAATGATCCTTCCGCAGGTTCCCCTAACGGAAGGAT The sequence was uploaded to the NCBI database for comparison, and the results were obtained. Figure 2 The results are shown.

[0063] Example 2: Reinoculation Experiment with Pathogenic Fungi The isolated pathogenic fungi were activated in PDA medium for one week. After three weeks of seedling germination, holes were punched along the edges of the colonies using a 6mm diameter punch to prepare inoculation blocks, approximately 6mm in diameter and 3mm in height. After three weeks of seedling germination, petri dishes with ≥10 germinating plants were selected. The prepared inoculation blocks were inoculated onto the roots of *Ageratum aegyptium* seedlings, ensuring the colony side was in close contact with the stem to guarantee sufficient opportunity for fungal infection. Ten seedlings were inoculated with each pathogenic strain, with five replicates. Sterile PDA blocks were used as a control. Seedling mortality was observed and recorded daily after inoculation, continuing for two weeks.

[0064] Example 3: Safety evaluation of biocontrol fungi on local plants and economic crops Twenty-five common plant species in Kunming were selected as research subjects: *Senecio scandens*, *Chrysanthemum indicum*, *Artemisia capillaris*, *Eupatorium fortunei*, *Taraxacum mongolicum*, *Buddleja officinalis*, *Rhizoma Cynodon dactylon*, *Corydalis yanhusuo*, *Commelina communis*, *Caesalpinia buergerianum*, *Polygonum multiflorum*, *Achyranthes bidentata*, *Hypericum perforatum*, *Salvia splendens*, *Rubia cordifolia*, *Hibiscus rosa-sinensis*, *Salix babylonica*, *Hypericum vulgare*, *Phytolacca acinosa*, *Ligustrum lucidum*, *Hedychium yunnanense*, *Prunus cerasifera*, *Ligustrum lucidum*, *Myrica rubra*, and *Pyrus pyrifolia*. First, a wound approximately 6 mm in diameter was made on the underside of the leaf using a sterile bamboo skewer. Then, a fungal spore was inoculated onto the wound, and the spore was secured with transparent tape and a paperclip. The spores were cultured in a natural environment for one week. After one week, the pathogenicity was observed, and the area of ​​the lesions was measured.

[0065] Table 1. Information on 25 plants for safety evaluation

[0066]

[0067] Figure 3 In the reinoculation experiment, strains with high mortality rates against *Eupatorium adenophorum* seedlings in petri dishes were selected, and their pathogenicity was tested on 25 native plant species in the field. The strain name label and the mycelium block were connected with tape. The back of the native plant was punctured with a bundle of seven toothpicks, and the mycelium block was attached to the punctured area and secured with colored paperclips. Test leaves were collected one week later.

[0068] Figure 4 The black areas on the edges of the leaves of *Buddleja officinalis* represent the sites where fungal blocks were applied in the pathogenicity test (safety evaluation) experiment. The presence of black indicates that the fungus is pathogenic to the injured area. When compiling the results, the length and width of the black areas were measured with a ruler, and the lesion area was calculated. The data were then compiled into a... Figure 5 The heat map was used to select bacteria with low pathogenicity and minimal impact on local plants for the control of Agastache rugosa seedlings.

[0069] Figure 5The left side of the green border shows the pathogenicity results of ZLLLJ10 on 25 local plant species, with the shade of color indicating the level of pathogenicity. ZLLLJ10 showed slightly higher pathogenicity to *Chrysanthemum indicum* and *Eupatorium fortunei* than the other 23 species, but was still considered a low-pathogenic bacterium compared to other strains. The right side of the green border shows the mortality rate of ZLLLJ10 against *Eupatorium adenophorum* in petri dishes, showing a 100% mortality rate.

[0070] Experiment Example 4: Greenhouse Experiment on the Control Effect of Mycelial Suspension

[0071] 1) Preparation of mycelial suspension: The target strain was inoculated into PDB and cultured in a temperature-controlled shaker at 25℃ and 180 rpm for 4 days. The mycelia were then isolated by filtration, rinsed three times with sterile water, and then mixed with 10% glycerol and 2% sucrose. The mixture was then ground on speed 1 for 2 minutes. The bacterial suspension used in the efficacy evaluation experiment should not be stored for more than 7 days. When using the suspension, the concentration should be adjusted to 1 x 10⁻⁶ using the dilution plating method. 5 Mycelial segments / mL.

[0072] 2) Greenhouse effect evaluation: 24-cell seedling trays (36.5cm*23cm*11cm, 5.5cm deep) with transparent covers were used. Each cell in each tray was filled with 5cm of humus soil and 5mL of water to ensure the soil was fully moist. Nine seeds of *Ageratum adenophorum* were sown per cell in the seedling trays filled with nutrient soil. The trays were placed in the greenhouse for germination and cultivation. After germination, the seedlings were watered every 3 days (300mL / tray) and given Hoagland nutrient solution weekly (300mL / tray). Germination rate was recorded daily for 3 weeks (using a quartz stone placed at the base of the seedling to indicate germination). Different *Ageratum adenophorum*, *Bidens pilosa*, and *Solanum kaxiana* seedlings were selected with growth cycles of 0, 1, 2, 3, and 4 weeks. Prepared mycelial suspensions were evenly sprayed onto the leaves of each seedling, with 6 replicates and 1 control for each cycle. To prevent cross-infection, a transparent cap was immediately placed on the seedlings after spraying the mycelial suspension, and the number of deaths was recorded daily for two weeks (two quartz stones were used to mark the seedlings as dead). Simultaneously, lethal fungi were randomly isolated from dead seedlings at each growth cycle, and their morphological characteristics were used to verify their presence in the dead seedlings.

[0073] Figure 10 In the greenhouse experiment, seedling trays were used. Nine seeds of *Eupatorium adenophorum* were sown in each cell. Seedlings were set up as follows: 0-week seedlings (sprayed with ZLLLJ10 mycelial suspension on the day of sowing), 1-week seedlings (sprayed with ZLLLJ10 mycelial suspension one week after sowing), and so on, from 0 to 4 weeks. Figure 10The results of spraying 4-week-old seedlings with ZLLLJ10 mycelial suspension were compared. Before spraying, the control group, sprayed with sterile water, and the 4-week-old seedlings showed good growth. One week after treatment, the control group continued to grow well, while all 4-week-old seedlings sprayed with ZLLLJ10 mycelial suspension died. After two weeks of observation, the control group showed good growth, while all 4-week-old seedlings sprayed with ZLLLJ10 mycelial suspension died, and the ungerminated seeds did not germinate. This suggests that ZLLLJ10 may have an inhibitory effect on the germination of Agastache rugosa seeds.

[0074] Figure 11 The line graph shows the mortality of *Ageratum aizoon* seedlings within two weeks after spraying with sterile water and ZLLLJ10 mycelial suspension, respectively. Blue indicates spraying with sterile water (control group CK), with no mortality during the two-week observation period. Red indicates spraying with ZLLLJ10 mycelial suspension; no seedlings died on days 1, 2, and 3, but all died on day 4, reaching a mortality rate of 100%. This indicates that ZLLLJ10 has a significant lethal effect on *Ageratum aizoon* seedlings under greenhouse conditions.

[0075] The above descriptions are merely some specific embodiments of the present invention. Commonly known details or common knowledge in the solutions are not described in detail here (including but not limited to abbreviations, acronyms, units commonly used in the art, experimental methods, parameter conditions, etc.). It should be noted that the above embodiments do not limit the present invention in any way. For those skilled in the art, any technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.

Claims

1. A fungus, characterized by, The fungus is ( Didymella sp.) ZLLLJ10 is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No.42795.

2. A biological control agent, characterized in that, It includes the fungus described in claim 1.

3. The application of the fungus described in claim 1 in the control of Agastache rugosa.

4. The application of the biological control agent according to claim 2 in the control of Agastache rugosa.

5. The application according to claim 3 or 4, characterized in that, The purple-stemmed eupatorium refers to the seedlings of the purple-stemmed eupatorium.

6. The application according to claim 3 or 4, characterized in that, The fungus is applied in the form of mycelium.

7. A method for controlling *Eupatorium adenophorum*, characterized in that, This includes applying the fungus of claim 1 to Eupatorium adenophorum.

8. A method for controlling *Eupatorium adenophorum*, characterized in that, This includes applying the biocontrol agent of claim 2 to Eupatorium adenophorum.

9. The method according to claim 7 or 8, characterized in that, The purple-stemmed eupatorium refers to the seedlings of the purple-stemmed eupatorium.

10. The method according to claim 7 or 8, characterized in that, The fungus is applied in the form of mycelium.

Images