An engineered strain for synthesizing C12 and C14 fatty acids, its construction method, and its applications.

Abstract

This invention belongs to the field of microbial genetic engineering and metabolic engineering applications, specifically relating to an engineered strain producing C12 and C14 fatty acids, its construction method, and its applications. The engineered strain is obtained by integrating fatty acid synthase into a recombinant yeast host; or by integrating a restriction long-chain fatty acid β-oxidase into the obtained engineered strain. The recombinant Hansenula polymorpha yeast optimized using the above strategies can accurately and efficiently accumulate C12 and C14 fatty acids using methanol as a carbon source.

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering and metabolic engineering applications, specifically relating to an engineered strain that produces C12 and C14 fatty acids, its construction method, and its application. Background Technology

[0002] C12 fatty acids (lauric acid, n-dodecanoic acid) are pale yellow solids with a distinctive aroma and taste. With rising living standards and changing consumption habits, the demand for lauric acid is increasing in the food, personal care, and pharmaceutical industries. C14 fatty acids (myristic acid, n-tetradecanoic acid) are also widely recognized as active ingredients in skincare products. Therefore, C12 / C14 fatty acids have significant economic value. Statistics show that global sales of C12 fatty acids reached US$1.395 billion in 2022 and are projected to reach US$1.691 billion by 2026 (https: / / www.chinabgao.com / info / 1246817.html). Global sales of C14 fatty acids reached US$0.8 billion in 2022 and are projected to reach US$1.6 billion by 2029 (https: / / www.shangyexinzhi.com / article / 11535754.html). C12 / C14 fatty acids are classified as medium-chain fatty acids. Oil palm and coconut seeds are rich in medium-chain fatty acids and are the main sources of C12 / C14 fatty acids (Jadhav HB et al. J. Food Sci. Technol. 2023, 60(8): 2143-2152). However, the long planting cycle of oil palm and other plants and the complicated product separation process lead to high production costs of C12 / C14 fatty acids. With the continuous development of synthetic biology, the construction of microbial cell factories for the synthesis of medium-chain fatty acids is expected to reduce production costs. Currently, the construction of cell factories for synthesizing medium and short-chain fatty acids using Escherichia coli, Saccharomyces cerevisiae, and Yersinia lipolyticis as substrates has been launched (Zhu Z et al. Nat. Catal. 2020, 3(1): 64-74; Gajewski J et al. Nat. Commun. 2017, 8: 14650; Xu P et al. Proc. Natl. Acad. Sci. US A. 2016, 113(39): 10848-53; Wang K et al. ACS Synth. Biol. 2022, 11(8): 2564-2577). However, these cell factories all use sugars, which are relatively expensive raw materials, and cannot significantly reduce production costs.

[0003] Methanol, as a high-energy-density organic C1 compound, is one of the important carbon sources and energy raw materials in the chemical industry. Methanol can be synthesized from a variety of abundant raw material resources such as natural gas, coal, biomass, and CO2 hydrogenation, with a global average annual production capacity of over 100 million tons. It has advantages such as wide availability, easy preparation, low price, and convenient transportation and storage (Gao Jet al. Synth. Bio. J. 2020, 1(2): 158-173). Therefore, by constructing a methanol bioconversion cell factory for the synthesis of C12 / C14 fatty acids, the production cost will be significantly reduced, and potential problems such as competition between chemical production and food production for land and food will be avoided. It is expected to achieve green and mild production of lauric acid and myristic acid. Ogataea polymorpha is a natural methyl-nutritive yeast that can grow rapidly in a culture medium with methanol as the sole carbon and energy source. In addition, Ogataea polymorpha is a heat-resistant yeast that is suitable for growth at 37-43℃ and can tolerate up to 49℃. *Hansenula polymorpha* is a facultative aerobe with a pH range of 2.5-8.0 and can grow in inexpensive, non-selective media. As a Crabtree-negative yeast, it is tolerant of ethanol produced during fermentation, making high-density fermentation very easy, with cell concentrations reaching up to 120 g / L. These characteristics demonstrate its potential as a chassis strain for industrial production. In recent years, with the deepening research on *Hansenula polymorpha*, a relatively complete genetic manipulation platform has been established, enabling the homologous recombination efficiency of genes in *Hansenula polymorpha* to reach 60-70% (Gao J et al. iScience. 2021, 24(3): 102168). In addition, genetic manipulation elements of *Hansenula polymorpha*, such as gene integration sites and promoters, have also been explored and developed (Yu W et al. Synth. Syst. Biotechnol. 2021, 6(2): 63-68; Zhai X, et al. Appl. Microbiol. Biotechnol. 2021, 105(23): 8761-8769). These research foundations have provided tools for the construction of *Hansenula polymorpha* cell factories. It has been reported that long-chain (C16-C18) fatty acids can be synthesized using methanol as a single carbon source by constructing *Hansenula polymorpha* cell factories (Gao J et al.). (al.Nat.Metab.2022,4:932-943). However, due to the unsustainable production methods of medium-chain (C12, C14) fatty acids, constructing microbial cell factories and using methanol as a raw material to synthesize C12 / C14 fatty acids can compensate for the insufficient production capacity of C12 / C14 fatty acids and reduce their production costs, providing a paradigm for the development of biosynthetic pathways for fatty acids of specific chain lengths. Summary of the Invention

[0004] The purpose of this invention is to provide an engineered strain that produces C12 and C14 fatty acids, as well as its construction method and applications.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] An engineered strain that synthesizes C12 and C14 fatty acids is characterized in that the engineered strain is obtained by integrating fatty acid synthase with recombinant yeast as the host.

[0007] Alternatively, limiting long-chain fatty acid β-oxidase can be integrated into the resulting engineered bacteria to obtain engineered bacteria.

[0008] The engineered bacteria obtained by integrating the strain of restricted long-chain fatty acid β-oxidase and further regulating the enzyme in the formaldehyde to dihydroxyacetone pathway, or by regulating the enzyme and increasing the supply of NADPH in the strain's cytoplasm, are thus obtained.

[0009] Furthermore, the engineered bacteria are obtained by integrating fatty acid synthase into recombinant yeast as a host.

[0010] Alternatively, acyl-CoA synthase, acyl-CoA oxidase, and acyl-CoA thioesterase can be knocked out and / or integrated into the resulting engineered bacteria to obtain engineered bacteria.

[0011] The engineered bacteria obtained by further regulating the enzymes in the formaldehyde-to-dihydroxyacetone pathway, or by regulating these enzymes and increasing the supply of NADPH to the strain's cytoplasm, are obtained by knocking out and / or integrating acyl-CoA synthase, acyl-CoA oxidase, and acyl-CoA thioesterase.

[0012] The recombinant yeast was obtained by knocking out fatty acid synthase in yeast as a host; wherein the fatty acid synthase is the OpFAS1 and / or OpFAS2 gene.

[0013] Specifically, the process involves constructing sgRNA expression plasmids pHpgRNA35 or pHpgRNA36 to knock out endogenous FAS2 or FAS1 in Hansenula polymorpha strains, introducing them into Hansenula polymorpha strains, thereby knocking out the FAS2 and / or FAS1 genes in Hansenula polymorpha strains and obtaining recombinant yeast.

[0014] Further, the specific steps of the above technical solution are as follows: Taking the FAS1 gene as an example, the genome editing of Hansenula polymorpha in this invention is mainly accomplished by a self-constructed CRISPR / Cas9 system. First, the sgRNA expression vector pHpgRNA-36 targeting the OpFAS1 gene is constructed, wherein the nucleotide sequence targeting OpFAS1 is as shown in SEQ ID NO: 15; then, the donor DNA molecule is constructed, and 1000bp sequences upstream and downstream of the coding region of the OpFAS1 gene are amplified respectively, and the complete donor DNA fragment is obtained by fusion PCR; the gRNA expression vector pHpgRNA-35 and the donor DNA are electroporated into recombinant Hansenula polymorpha integrating Cas9 protein at a dose of 500ng each, and cultured statically at 37℃ on SD (FFA+) plates for 2-3 days; after the transformants are cultured in liquid SD (FFA+) medium, the transformants are verified to be correct by PCR, and plasmids are lost on plates containing 5-fluoroorotic acid. The strains with plasmid loss (FAS1 gene knockout) are stored for later use.

[0015] The knockout of the OpFAS2 gene (the nucleotide sequence targeting OpFAS2 is shown in SEQ ID NO: 14) and other genome editing work described below all follow a similar procedure, and strains with the FAS2 gene knocked out can be obtained by following the above description.

[0016] Furthermore, based on the FAS2 gene knockout strain, by further knocking out the FAS1 gene following the above description, strains with both FAS2 and FAS1 genes knocked out can be obtained.

[0017] The process involves using the corresponding recombinant yeast as a host to integrate the corresponding mutated fatty acid synthase containing the OpFAS1 or / and OpFAS2 mutant genes, thereby obtaining engineered bacteria.

[0018] The recombinant microbial cell integrates multiple copies (at least 2-10 copies) of fatty acid synthase containing the OpFAS1 or / and OpFAS2 mutant genes, thus obtaining the engineered bacteria.

[0019] The OpFAS1 or / and OpFAS2 mutant gene is OpFAS2. G1240M (SEQ ID NO 6), OpFAS2 M1241S (SEQ ID NO 7), OpFAS2 G240M,M1241S (SEQ ID NO 8), OpFAS1 R1843K One or more of the genes in (SEQ ID NO 5).

[0020] Specifically, this involves constructing OpFAS2 separately. G1240M Or OpFAS2 M1241S Or OpFAS2G240M,M1241S Or OpFAS1 R1843K The gene nucleotide sequences are as follows: SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8.

[0021] The expression plasmids for the corresponding mutant genes were then pOpMCFA-16, pOpMCFA-17, pOpMCFA-18, or pOpMCFA-19, respectively. These plasmids were then introduced into *Hansenula polymorpha* strains to achieve OpFAS2. G1240M Or OpFAS2 M1241S Or OpFAS2 G240M,M1241S Or OpFAS1 R1843K Gene overexpression. Simultaneously, plasmids pOpMCFA-18 and 19 were transformed into *Hansenula polymorpha* strains to obtain overexpressed OpFAS2. G240M ,M1241S and OpFAS1 R1843K .

[0022] Furthermore, the specific steps of the above technical solution are: overexpressing OpFAS2 G1240M Taking genes as an example. First, construct a structure containing OpFAS2. G1240M The gene expression plasmid pOpMCFA-16 was used to amplify the vector backbone and P... FASα -OpFAS2up、OpFAS2dw-T FAS2 Next, the nucleotide fragments were seamlessly cloned using Gibson assembly technology to obtain a complete plasmid. The expression plasmid pOpMCFA-16 was electroporated into recombinant *Hansenula polymorpha* at a dose of 500 ng and cultured statically on SD plates at 37°C for 2–3 days. Transformants were cultured in liquid SD medium, and strains with correct nucleotide sequences were verified by PCR and sequenced and stored for later use. Free plasmid overexpression of OpFAS2 was also performed. M1241S (pOpMCFA-17) or OpFAS2 G240M,M1241S (pOpMCFA-18) or OpFAS1 R1843K (pOpMCFA-19) and OpFAS2 G240M,M1241S and OpFAS1 R1843K The overexpression of the genes (pOpMCFA-18 and pOpMCFA-19) and other free plasmid genes mentioned below followed a similar procedure.

[0023] Based on the above-mentioned engineered bacteria, a further restrictive long-chain fatty acid β-oxidation strategy to increase C12 / C14 fatty acid synthesis was adopted to obtain engineered bacteria, namely, the engineered bacteria in which acyl-CoA oxidase was knocked out and long-chain specific acyl-CoA synthase was integrated, and / or exogenous long-chain specific acyl-CoA oxidase was fused and expressed with medium-chain specific acyl-CoA thioesterase, thus obtaining engineered bacteria.

[0024] The engineered bacteria further integrate multiple copies (at least 2-10) of fatty acid synthase containing the OpFAS1 or / and OpFAS2 mutant gene; wherein, the OpFAS1 or / and OpFAS2 mutant gene is OpFAS2. G240M,M1241S or / and OpFAS1 R1843K .

[0025] Specifically, the process of knocking out the OpPOX1 gene in the *Hansenula polymorpha* strain based on the engineered strain obtained above includes: introducing the sgRNA expression plasmid pHpgRNA43 into the *Hansenula polymorpha* strain to knock out the OpPOX1 gene.

[0026] Subsequently, the recombinant *Hansenula polymorpha* strain targeted peroxisome fusion overexpression of long-chain specific acyl-CoA oxidase and medium-chain specific acyl-CoA thioesterase by: fusing the codon-optimized YlPOX2 gene from *Yarrowia lipolytica* and the AtACX2 gene from *Arabidopsis thaliana* with the hACOT4 gene from humans and the mACOT5 gene from mice, respectively, and integrating them into the *Hansenula polymorpha* strain, with the YlPOX2 gene preferentially fused to the hACOT4 gene.

[0027] And / or, the endogenous acyl-CoA synthase in the recombinant Hansenula polymorpha strain is replaced with a long-chain specific acyl-CoA synthase, preferably ScFAA1.

[0028] The preferred implementation steps of the above technical solution are as follows:

[0029] (1) Seamless knockout of the OpPOX1 gene

[0030] First, the sgRNA expression vector pHpgRNA43 targeting the OpPOX1 gene was constructed, with the 20bp targeting sequence shown in SEQ ID NO: 16. Next, donor DNA molecules were constructed, and 1000bp sequences upstream and downstream of the OpPOX1 coding region were amplified. The complete donor DNA fragment was obtained via fusion PCR. The sgRNA expression vector pHpgRNA43 and the donor DNA were transformed into recombinant Hansenula polymorpha containing the Cas9 protein using electroporation at 500 ng each. The transformed samples were then cultured on SD plates at 37°C for 2–3 days. After culturing in liquid SD medium and verifying correctness by PCR, the transformants were plated on plates containing 5-fluoroorotic acid for plasmid loss. The plasmid-loss strains were then stored for future use. Other gene knockout procedures described below followed a similar process.

[0031] (2) Fusion overexpression of genes YlPOX2 and hACOT4

[0032] The specific procedure is the same as the fusion overexpression method described above, wherein the constructed donor DNA is obtained by fusion PCR, including 1000bp homologous arms on each side and the expression cassette P. OpTEF1 -YlPOX2-Linker-hACOT4-T OpAOX The integration site is 3NS3, and the sgRNA expression plasmid is p3NS3. The combinations of other acyl-CoA oxidases and acyl-CoA thioesterases are consistent with this step, specifically P... OpTEF1 -YlPOX2-Linker-mACOT5-T OpAOX P OpTEF1 -RtACX2-Linker-hACOT4-T OpAOX P OpTEF1 -RtACX2-Linker-mACOT5-T OpAOX P OpTEF1 -YlPOX2-Linker-hACOT4-T OpAOX .

[0033] (3) Overexpression of the ScFAA1 gene

[0034] The specific procedure is the same as the fusion overexpression method described above, wherein the constructed donor DNA is obtained by fusion PCR, including 1000bp homologous arms on each side and the expression cassette P. OpFAA1 -ScFAA1-T OpFAA1 The integration site is OpFAA1, and the sgRNA expression vector is pHpgRNA42, which achieves seamless knockout of the OpFAA1 gene while integrating the ScFAA1 gene.

[0035] (4) Add the key gene OpFAS2 based on the above. G240M,M1241S or / and OpFAS1 R1843K Copy number strategies were employed to enhance C12 / C14 fatty acid synthesis, increasing copy numbers by 2-10. OpFAS2 was overexpressed in free plasmids. G240M,M1241S or / and OpFAS1 R1843K OpFAS2 was further increased in recombinant Hansenula polymorpha strains. G240M,M1241S or / and OpFAS1 R1843K Gene copy number is increased, thereby enhancing C12 / C14 fatty acid production. Chromosomal overexpression is preferred. Specifically, the constructed donor DNA is obtained by fusion PCR, including 1000bp homologous arms on each side and the expression cassette P. OpFAS2 -OpFAS2 G240M,M1241S -T OpFAS2 The integration site is NS2, and the sgRNA expression plasmid is pNS2. The strain is transformed into the constructed C12 / C14 fatty acid producing strain to obtain the engineered strain.

[0036] A method for constructing an engineered strain that synthesizes C12 and C14 fatty acids involves using a recombinant Hansenula polymorpha strain as the starting strain and overexpressing fatty acid synthase containing the OpFAS1 or / and OpFAS2 mutant genes to obtain the engineered strain.

[0037] Alternatively, by integrating a restriction long-chain fatty acid β-oxidase into the engineered bacteria obtained above, the engineered bacteria can be obtained.

[0038] Specifically, the recombinant Hansenula polymorpha strain that produces C12 / C14 fatty acids by knocking out the FAS2 and / or FAS1 genes was used as the starting strain. The OpFAS1 and OpFAS2 genes encoding endogenous fatty acid synthases were mutated. The OpFAS1 and OpFAS2 genes were amplified and the corresponding mutations were introduced using site-directed mutagenesis PCR technology. The mutated sequences are SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, respectively.

[0039] 1) Gene knockout

[0040] The constructed sgRNA expression plasmid was pHpgRNA36, with a 20bp target sequence as shown in SEQ ID NO: 15. The correctly sequenced plasmid pHpgRNA36 and donor DNA were transformed into the recombinant Hansenula polymorpha strain producing C12 / C14 fatty acids to knock out the OpFAS1 gene.

[0041] 2) Integration of mutant genes

[0042] The mutated OpFAS1R1843K The gene, obtained from constructed donor DNA via fusion PCR, includes 1000 bp homologous arms on each side and the expression cassette P. OpFAS1 -OpFAS1 R1843K -T OpAOX， The NS18 site of the recombinant Hansenula polymorpha strain (the strain after knocking out the FAS1 gene) that produces C12 / C14 fatty acids was integrated to mutate the MTP domain of the endogenous fatty acid synthase β chain. The sgRNA expression plasmid pNS18 was selected.

[0043] or,

[0044] 1) Gene knockout

[0045] The constructed sgRNA expression plasmid was pHpgRNA35, with a 20bp target sequence as shown in SEQ ID NO: 14. The correctly sequenced plasmid pHpgRNA35 and donor DNA were transformed into the recombinant *Hansenula polymorpha* strain producing C12 / C14 fatty acids to knock out the OpFAS2 gene.

[0046] 2) Integration of mutant genes

[0047] The mutated OpFAS2 G1240M,M1241S The donor DNA for gene construction was obtained by fusion PCR, including 1000 bp homologous arms on each side and the expression cassette P. OpFAS2 -OpFAS2 G120M,M1241S -T OpAOX， The NS2 site of the recombinant Hansenula polymorpha strain (the strain after knocking out the FAS2 gene) that produces C12 / C14 fatty acids was integrated to mutate the KS domain of the endogenous fatty acid synthase α chain, and the sgRNA expression plasmid pNS2 was selected.

[0048] Other mutant genes are constructed according to the above description. The corresponding mutant gene is integrated into the strain with the corresponding knockout gene. When integrating two mutant genes at the same time, it needs to be done step by step.

[0049] Then, the copy number of the mutant gene can be further regulated to obtain engineered bacteria that enhance the production of C12 / C14 fatty acids.

[0050] Based on the strains obtained above, restriction long-chain fatty acid β-oxidases were integrated, specifically by knocking out acyl-CoA oxidase and integrating long-chain specific acyl-CoA synthase, and / or exogenous long-chain specific acyl-CoA oxidase and fusing expression of medium-chain specific acyl-CoA thioesterase, thus obtaining engineered bacteria.

[0051] The engineered bacteria further integrate multiple copies of fatty acid synthase containing the OpFAS1 or / and OpFAS2 mutant gene; wherein, the OpFAS1 or / and OpFAS2 mutant gene is OpFAS2. G240M,M1241S or / and OpFAS1 R1843K .

[0052] Based on the strategy of enhancing the supply of fatty acid synthesis precursors in the recombinant Hansenula polymorpha strain producing C12 / C14 fatty acids, the yield of C12 / C14 fatty acids can be further increased. Specifically, using the aforementioned recombinant Hansenula polymorpha strain producing C12 / C14 fatty acids as the starting strain, its chromosome is overexpressed with the dihydroxyacetone synthase gene DAS2. The specific procedure is consistent with the above, wherein the constructed donor DNA is obtained by fusion PCR, including 1000 bp homologous arms on each side and the expression cassette P. OpTAL1 -OpDAS2-T OpFBA The preferred integration site is 5NS6, and the sgRNA expression plasmid is p5NS6.

[0053] To further enhance the yield by providing a strategy for regulating cytoplasmic NADPH supply in the strain, the recombinant Hansenula polymorpha strain producing C12 / C14 fatty acids was used as the starting strain. The chromosome of this strain was overexpressed with the isocitrate lyase gene ScIDP2 from Saccharomyces cerevisiae. The specific procedure was the same as described above. The donor DNA was obtained by fusion PCR, including 1000 bp homologous arms on each side and the expression cassette P. OpGAP -ScIDP2-T OpFBA The preferred integration site is NS9, and the sgRNA expression plasmid is pNS9.

[0054] Further regulation of cytoplasmic NADPH supply in the strains was achieved by overexpressing the endogenous malate dehydrogenase gene 'MDH3' (which removes the peroxisome signal peptide from *Hansenula polymorpha*), the pyruvate carboxylase gene PYC1, and the malate enzyme gene RtME1 (from *Rhodotorula buergerianum*) on the chromosomes of the obtained strains.

[0055] (1) Overexpression of MDH3 and PYC1 genes

[0056] The specific process is consistent with the first aspect of the present invention described above, wherein the constructed donor DNA is obtained by fusion PCR method, including 1000bp homologous arms on both sides and expression cassette P. OpTEF -'MDH3-T OpPDB P OpPAM -PYC1-T OpFBA The preferred integration site is NS19, and the sgRNA expression plasmid is pNS19.

[0057] (2) RtME1 gene overexpression

[0058] The specific process is consistent with the first aspect of the present invention described above, wherein the constructed donor DNA is obtained by fusion PCR method, including 1000bp homologous arms on both sides and expression cassette P. OpADH2-1 -RtME1-T OpFBA The preferred integration site is NS11, and the sgRNA expression plasmid is pNS11.

[0059] The application of an engineered strain for synthesizing C12 and C14 fatty acids is characterized by the application of the engineered strain in the synthesis of C12 and C14 fatty acids.

[0060] A method for synthesizing C12 and C14 fatty acids, wherein the engineered bacteria are used to ferment and synthesize C12 and C14 fatty acids in a system with methanol as a carbon source.

[0061] A method for amplifying the recombinant Hansenula polymorpha yeast in methanol medium to produce C12 / C14 fatty acids was developed, enabling the recombinant Hansenula polymorpha yeast to synthesize more than 2 g / L of C12 / C14 fatty acids using methanol as the sole carbon source, with the proportion exceeding 60%.

[0062] In this application, codon optimization, or sequence optimization, is performed. Different species have different codon preferences, and failure to optimize the expression of exogenous genes using codons may affect transcription efficiency. The specific optimization process is accomplished using computer technology. Attached Figure Description

[0063] Figure 1 This is a schematic diagram of fatty acid metabolism provided in an embodiment of the present invention.

[0064] Figure 2 This is a schematic diagram illustrating the construction of the Hansenula polymorpha endogenous fatty acid synthase mutant plasmid provided in an embodiment of the present invention.

[0065] Figure 3 The graph shows the fatty acid yield of Hansenula polymorpha strains expressing different fatty acid synthase mutants, as provided in the embodiments of the present invention.

[0066] Figure 4 The graph shows the fatty acid yield of Hansenula polymorpha in different ways of expressing fatty acid synthase, as provided in the embodiments of the present invention.

[0067] Figure 5 The graph shows the fatty acid yield of Hansenula polymorpha after blocking or remodeling fatty acid oxidation, as provided in the embodiments of the present invention.

[0068] Figure 6 The graph shows the fatty acid yield of Hansenula polymorpha after increasing the copy number of fatty acid synthase, as provided in the embodiments of the present invention.

[0069] Figure 7The graph shows the fatty acid yield of Hansenula polymorpha fermentation using methanol as a carbon source in shake flasks, as provided in this embodiment of the invention.

[0070] Figure 8 The graph shows the fatty acid production after enhanced methanol metabolism in Hansenula polymorpha, as provided in an embodiment of the present invention.

[0071] Figure 9 The graph shows the fatty acid production of Hansenula polymorpha after NADPH fortification, as provided in an embodiment of the present invention.

[0072] Figure 10 The diagram shows the fatty acid yield of Hansenula polymorpha fermentation using methanol as a carbon source, provided in an embodiment of the present invention. Detailed Implementation

[0073] The following non-limiting embodiments are intended to enable those skilled in the art to more fully understand the present invention, but do not limit the invention in any way. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials and reagents used can be purchased from biological or chemical companies.

[0074] Information on strains, amino acid sequences, nucleotide sequences, plasmids, primers, and donor DNA construction involved in each embodiment is described in the subsequent tables.

[0075] Example 1

[0076] Construction of C12 / C14 fatty acid-producing recombinant Hansenula polymorpha strain

[0077] Hansenula polymorpha's endogenous fatty acid synthases can synthesize long-chain (C16-C18) fatty acids and trace amounts of C14 fatty acids, but cannot synthesize C12 fatty acids. Therefore, chain length preference modification of Hansenula polymorpha's endogenous fatty acid synthases is needed to achieve efficient synthesis of C12 / C14 fatty acids, thereby regulating the synthesis and catabolism of C12 / C14 fatty acids. Figure 1 As shown.

[0078] 1) Obtaining recombinant strains:

[0079] The strain JQcr03L (which was deposited on October 24, 2024, at the China General Microbiological Culture Collection Center, with accession number CGMCC) was used. No. 32325, classified as *Ogataea polymorpha*, is deposited at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The construction process of strain JQcr03L is as follows: Using recombinant *Ogataea polymorpha* strain Δku80 as the starting strain (iScience.2021,24,3,102168), the ScSAE2 gene from *Saccharomyces cerevisiae* was overexpressed on its chromosome, and the LEU2 gene was further added back to obtain recombinant *Ogataea polymorpha* strain JQcr03L. The specific operation process is as follows: First, using primers p545 / p546, p547 / p548, and p549 / p550, DNA fragments NS5up and P... were amplified from the genome of *Ogataea polymorpha* strain y34 (derived from iScience.2021,24,3,102168), respectively. OpTKL1 -ScSAE2-T OpURA3 The fragments were NS5dw and then fused into a complete donor DNA dScSAE2 by SOE-PCR. This dScSAE2 was then co-transformed with gRNA plasmid pNS5 into strain Δku80. The correct transformant was named JQcr03.

[0080] Further, using primers Leu-2-3 / Leu-2-2 and Leu-2-1 / Leu-2-4, the LEU2 gene fragments LEU2up and LEU2dw were amplified from the *Hansenula polymorpha* genome, respectively. Simultaneously, the mutation site was reversed (the LEU2 gene in *Hansenula polymorpha* Δku80 and JQcr03 has a point mutation that renders it inactive, thus preventing leucine synthesis; the purpose of reversing the LEU2 mutation is to restore the gene's normal function). Then, the above fragments were fused into complete donor DNA dLEU2 via SOE-PCR and transformed into strain JQcr03. The correctly transformed strain was named JQcr03L. The original starting strain was then used for recombination, which was obtained by knocking out its fatty acid synthase; the fatty acid synthase is the OpFAS1 and / or OpFAS2 gene. The following description uses the knockout of the OpFAS2 gene as an example.

[0081] Specifically,

[0082] First, the OpFAS2 gene was knocked out in the genome of strain JQcr03L to obtain the recombinant Hansenula polymorpha strain ZX-MF10. The specific construction method is as follows: First, the DNA fragment containing SEQ ID NO: 14 was amplified using primers p624 (GAGGACGAAACGAGTAAGCTCGTCTCAGATATGAGCTCTAAAATGCCTGGGTTTTAGAGCTAGAAATAG) and p102 (AGAAAGCTGGCGGCCGCCGCGTTTGGATCAACAGACGAC). Then, the gRNA expression plasmid backbone was amplified using primers p506 (ATCTGAGACGAGCTTACTCGTTTCG) and p507 (GTTCATCAGGTCGTCTGTTGATCCAAAC). Finally, the above DNA fragment was assembled using Gibson assembly technology to obtain the complete gRNA expression plasmid gRNA-35. The upstream and downstream homologous arms of the Hansenula endogenous OpFAS2 gene were amplified using primer pairs p612(GATGAGAATAACTCGAAGACTTGCTTCAAC) / p613(TATAGTGTATAGAAAAAAATCAATAAGTAGGTCAATTCAAATTTAAATATC) and p614(CTACTTATTGATTTTTTTCTATACACTATATTGAGATGGAGCTATGAAGTCCCG) / p615(GTTCTAGATTACAAATCTAACGATGACAGCTCTC). Then, the above DNA fragments were fused into a DNA donor dHp-159 using fusion PCR technology. This donor dHp-159 was then co-transformed with the obtained sgRNA expression plasmid gRNA-35 into strain JQcr03L to seamlessly knock out the OpFAS2 gene. The correctly obtained transformant was named ZX-MF10.

[0083] Further, following the same procedure as described above, the endogenous OpFAS1 gene of *Hansenula polymorpha* was knocked out, and the primers used to construct the gRNA expression plasmid gRNA-36 and the donor dHp-160 are shown in Table 6. The expression plasmid gRNA-36 and the donor dHp-160 were then transformed into strain ZX-MF10 using free plasmids to obtain recombinant *Hansenula polymorpha* ZX-MF12 (i.e., OpFAS1 and / or OpFAS2 genes knocked out).

[0084] The above description describes the transformation of expression plasmid gRNA-36 and donor dHp-160 into strain JQcr03L using a free plasmid, resulting in a recombinant Hansenula polymorpha strain with the OpFAS1 gene knocked out, named ZX-MF11.

[0085] 2) Integrated fatty acid synthase

[0086] OpFAS1 was overexpressed in Hansenula polymorpha using a free plasmid expression mode (integrated fatty acid synthase). R1843K Genes, OpFAS2 G1240M Or OpFAS2 M1241S Or OpFAS2 G240M,M1241S One or more of these can be used to obtain the corresponding recombinant Hansenula polymorpha strain.

[0087] To construct a separate expression of OpFAS1 R1843K The construction method of the recombinant Hansenula polymorpha strain (XMCFA43) is described in detail below: First, the expression vector backbone is amplified using primers p152 (GGATCCTCAACATCTTTGGATAATATCAGAATGAGA) and p153 (TGTACGCATGTAACATTATACTGAAAACCTTGCTTGAG). The upstream fragment of OpFAS1 is amplified and a mutation is introduced using primers p041 (CTGATATTATCCAAAGATGTTGAGGATCCGTTAGCGATGACAATGGAGCACCACTTTTT G) and p039 (CATGGTCATACCCTTGTAGAACACC). The downstream fragment of OpFAS1 is amplified using primers p040 (AAGGTTTTCAGTATAATGTTACATGCGTACACAGCTGCTGCATCGAACGGCCTGTACC TG) and p038 (GGTGTTCTACAAGGGTATGACCATG). Then, cloning and ligation are performed using the Gibson Assembly method to obtain the recombinant plasmid (…). Figure 2 D).

[0088] After sequencing, the transformant was transformed into recombinant Hansenula polymorpha ZX-MF11, and the correct transformant was named XMCFA43.

[0089] Recombinant Hansenula polymorpha strain XMCFA44 (ZX-MF12) transformed into OpFAS1 R1843K gene OpFAS2 G1240M (Gene), XMCFA45 (ZX-MF12 transferred into OpFAS1) R1843K gene OpFAS2 M1241S (gene) and XMCFA46 (ZX-MF12 transferred into OpFAS1) R1843K Genes and OpFAS2 G240M,M1241S The gene construction method is similar to that of XMCFA43.

[0090] Example 2

[0091] Fermentation by C12 / C14 fatty acid-producing recombinant Hansenula polymorpha strain

[0092] (1) Culture medium

[0093] YPD medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract;

[0094] SD medium: 20 g / L glucose, 6.7 g / L YNB;

[0095] SD (FFA+) medium: 20 g / L glucose, 6.7 g / L YNB, 50 mg / L C16 and C18 fatty acids;

[0096] Fermentation medium (basic components): (NH4)2SO4 2.5 g / L, KH2PO4 14.4 g / L, MgSO4·7H2O 0.5 g / L, add approximately 900 mL ddH2O, adjust pH to 5.6, bring volume to 950 mL, and sterilize at 115℃ for 30 min. After sterilization, add 1 mL of vitamin solution and 2 mL of trace metal solution. Essential amino acids should be added before use. Different carbon sources, including 20 g / L glucose or 10 g / L methanol, can be added to the fermentation medium for fatty acid fermentation.

[0097] (2) Experimental Procedure and Conditions

[0098] The strains obtained in Example 1 above, along with JQcr03L as a control, were activated. Three single colonies were picked and cultured in 3 / 15 mL YPD medium at 37°C with shaking at 220 rpm for 24 h. For seed culture, the activated bacterial culture was transferred at 1% (v / v) to 20 / 100 mL YPD medium and cultured at 37°C with shaking at 220 rpm for 16–18 h. Inoculation was performed according to the initial OD. 600 =0.2g inoculated into fermentation medium (carbon source: glucose), with a volume of 20mL / 100mL Erlenmeyer flask, and fermented at 37℃ and 220rpm. Point-to-point or endpoint sampling was used for biomass (expressed as absorbance at 600nm) and yield analysis.

[0099] The YPD medium mentioned above can also be replaced with SD medium.

[0100] (3) Synthesis of C12 / C14 fatty acids based on glucose

[0101] The activated and constructed C12 / C14 fatty acid recombinant Hansenula polymorpha strains XMCFA43, XMCFA44, XMCFA45, and XMCFA46, along with JQcr03L as a control, were used to conduct fatty acid fermentation experiments according to the above experimental procedure under basal medium containing 20 g / L glucose (see [link to experimental procedure]). Figure 3 ).

[0102] Experimental results are as follows Figure 3 As shown, all four strains successfully synthesized C12 / C14 fatty acids except for XMCFA43, but the yield and proportion of C12 / C14 fatty acids differed. The C12 / C14 fatty acid yield was: XMCFA46 (2.8 mg / L) > XMCFA45 (1.5 mg / L) > XMCFA44 (0.9 mg / L); the C12 / C14 fatty acid proportion was: XMCFA46 (59.5%) > XMCFA45 (48.4%) > XMCFA44 (34.6%). Furthermore, the results showed that the long-chain fatty acid content of XMCFA43 was reduced by 28.9% compared to the control strain. Therefore, mutating the 1843 amino acid residue at the key site of OpFAS1 can effectively reduce the synthesis of long-chain fatty acids in *Hansenula polymorpha*. In this invention, the 1843 amino acid residue is preferably mutated to lysine (Lys, K). The chain length specificity of OpFAS2 can be altered by mutating amino acid residues at key sites 1240 and 1241. In this invention, it is preferred to mutate amino acid residue 1240 to methionine (Met, M) and amino acid residue 1241 to serine (Ser, S).

[0103] To facilitate subsequent optimization of the engineered strain, the above-mentioned OpFAS1 was used. R1843K OpFAS2 G240M,M1241S The gene was integrated into the genome of strain ZX-MF12 to obtain recombinant Hansenula polymorpha XMCFA4601. The specific procedure was as follows: First, the DNA donor dOpMCFA-50 and 51 were amplified according to the primers in Table 6 to construct the required DNA fragment. Then, ligation was performed using SOE-PCR. The obtained donor DNA fragment, along with gRNA plasmids pNS18 and pNS2, was sequentially transformed into recombinant Hansenula polymorpha ZX-MF12. The obtained correctly transformed strain was then named XMCFA4601. Subsequently, the strain was cultured according to the C12 / C14 fatty acid synthesis method using glucose as a substrate as described above, and the C12 / C14 fatty acid synthesis was detected. Figure 4 It is evident that it is similar to XMCFA46. Figure 4 ).

[0104] Example 3

[0105] Restricted long-chain fatty acid β-oxidation strategy (also known as long-chain fatty acid β-oxidation brake) enhances the C12 / C14 fatty acid synthesis capacity of recombinant Hansenula polymorpha strains.

[0106] Fatty acid synthesis in yeast is strictly regulated; excess fatty acids are further oxidized and degraded into acetyl-CoA, releasing NADH. This process is known as fatty acid β-oxidation. To reduce the oxidation capacity of C12 / C14 fatty acids in Hansenula polymorpha while simultaneously braking the oxidation of long-chain fatty acids (i.e., stopping the oxidative degradation of long-chain fatty acids at C12 / C14), a limited-long-chain-fatty-acid-β-oxidation strategy was developed.

[0107] Specifically, the process involves: first, knocking out the endogenous acyl-CoA oxidase gene POX1 in *Hansenula polymorpha*; second, targeting the peroxidase to select and express a long-chain specific acyl-CoA oxidase (YlPOX2) from *Yersinia lipolytica* and a human medium-chain specific acyl-CoA thioesterase (hACOT4); and finally, replacing the endogenous Faa1 in *Hansenula polymorpha* with a long-chain specific acyl-CoA synthase (ScFAA1) from *Saccharomyces cerevisiae*.

[0108] (1) Knockout of the endogenous acyl-CoA oxidase gene POX1 in Hansenula polymorpha

[0109] Acyl-CoA oxidase (encoded by the POX1 gene) catalyzes the first step of the fatty acid oxidation cycle. Knocking out this gene may effectively reduce the rate of fatty acid oxidation. Therefore, the POX1 gene was seamlessly knocked out in recombinant *Hansenula polymorpha* XMCFA4601 to obtain recombinant *Hansenula polymorpha* strain XMCFA47. The specific procedure was as follows: First, the DNA donor dPOX1 was amplified using the primers in Table 6 to construct the required DNA fragment. Then, it was ligated using SOE-PCR. The obtained donor DNA fragment was co-transformed with the gRNA plasmid pHpgRNA43 into recombinant *Hansenula polymorpha* XMCFA4601, and the correctly obtained transformant was named XMCFA47. Glucose fermentation results showed that the deletion of the POX1 gene increased the yield of C12 / C14 fatty acids by 2.0 times (from 2.9 mg / L to 5.8 mg / L). Figure 5 A).

[0110] (2) Knockout of the endogenous acyl-CoA synthase gene FAA1 in Hansenula polymorpha.

[0111] Acyl-CoA synthase (encoded by the FAA1 gene) catalyzes the CoA-ation of fatty acids, a crucial step in the subsequent oxidation of fatty acids. Knocking out this gene blocks fatty acid activation, thereby inhibiting fatty acid oxidation and increasing the accumulation of free fatty acids. Therefore, the FAA1 gene was seamlessly knocked out in recombinant *Hansenula polymorpha* XMCFA47 to obtain recombinant *Hansenula polymorpha* strain XMCFA48. The specific procedure was as follows: First, the DNA donor dFAA1 was amplified using primers in Table 6 to construct the required DNA fragment. Then, ligation was performed using SOE-PCR. The obtained donor DNA fragment was co-transformed with the gRNA plasmid pHpgRNA42 into recombinant *Hansenula polymorpha* XMCFA47, and the correct transformant obtained was named XMCFA48. Glucose fermentation results showed that the deletion of the FAA1 gene increased the yield of C12 / C14 fatty acids by 1.9 times (from 5.8 mg / L to 10.8 mg / L). Figure 5 A).

[0112] (3) Targeted peroxisome overexpression of long-chain specific acyl-CoA oxidase and medium-chain specific acyl-CoA thioesterase

[0113] Long-chain fatty acids are activated to acyl-CoA and then enter peroxisomes for subsequent β-oxidation and are ultimately degraded to acetyl-CoA. To avoid the waste of raw materials caused by the complete degradation of long-chain acyl-CoA, the oxidation process of long-chain acyl-CoA needs to be paused at C12 / C14 and rapidly hydrolyzed into free fatty acids, thereby promoting the accumulation of C12 / C14 fatty acids. Based on this, a fusion expression cassette of long-chain specific acyl-CoA oxidase (encoded by the YlPOX2 gene) and medium-chain specific acyl-CoA thioesterase (encoded by the hACOT4 gene) was constructed. The specific procedure is as follows: First, the DNA donor YlPOX2-hACOT4 was amplified according to the primers in Table 6 to construct the required DNA fragment. Then, the fragment was ligated by SOE-PCR. The obtained donor DNA fragment was co-transformed with gRNA plasmid p3NS3 into recombinant Hansenula polymorpha XMCFA47. The correct transformants were named XMCFA62. Fermentation results on glucose medium showed that the C12 / C14 fatty acid synthesis capacity of strain XMCFA62 increased by 26.6% (from 6.4 mg / L to 8.1 mg / L). Figure 5 B).

[0114] (4) Replacing the endogenous Faa1 of *Hansenula polymorpha* with a long-chain specific acyl-CoA synthase (ScFAA1) derived from *Saccharomyces cerevisiae*. Replacing the endogenous non-specific acyl-CoA synthase of *Hansenula polymorpha* with a long-chain specific acyl-CoA synthase activates long-chain fatty acids into the subsequent β-oxidation cycle, while medium-chain fatty acids are retained, further enhancing the synthesis of C12 / C14 fatty acids. Based on this objective, it is preferable to replace the endogenous Faa1 of strain XMCA62 with a long-chain specific acyl-CoA synthase (ScFAA1) derived from *Saccharomyces cerevisiae* to obtain recombinant *Hansenula polymorpha* XMCFA63. The specific procedure is as follows: First, the DNA donor dOpMCFA-42 is amplified according to the primers in Table 6 to construct the required DNA fragment. Then, it is ligated by SOE-PCR. The obtained donor DNA fragment is co-transformed with gRNA plasmid pHpgRNA42 into recombinant *Hansenula polymorpha* XMCFA62. The obtained correct transformant is named XMCFA63. Fermentation on glucose medium showed that this strategy further increased the synthesis of C12 / C14 fatty acids by 28.4% (from 8.1 mg / L to 10.4 mg / L). Figure 5 B).

[0115] Example 4

[0116] Add OpFAS1 R1843K OpFAS2 G240M,M1241S Increased gene copy number in recombinant Hansenula polymorpha strains enhances C12 / C14 fatty acid synthesis.

[0117] As described in Example 1 above, free plasmids pOpMCFA-18 and 19 were introduced into strain XMCFA63 to further overexpress OpFAS1. R1843K OpFAS2 G240M,M1241S The recombinant Hansenula polymorpha strain XMCFA80, after fermentation on glucose medium, showed that the C12 / C14 fatty acid yield reached 15.6 mg / L, which was 50% higher than that of the control strain XMCFA63. Figure 6 ).

[0118] Example 5

[0119] Fermentation experiment of recombinant Hansenula polymorpha strain in methanol basal medium

[0120] The recombinant Hansenula polymorpha strain XMCFA80 was selected as the test subject, and shake-flask fed-batch fermentation was carried out using methanol as the sole carbon source.

[0121] Specifically:

[0122] (1) Culture medium

[0123] SD medium: 20 g / L glucose, 6.7 g / L YNB;

[0124] Fermentation medium (basic components): (NH4)2SO4 2.5 g / L, KH2PO4 14.4 g / L, MgSO4·7H2O 0.5 g / L, add approximately 900 mL ddH2O, adjust pH to 5.6, bring volume to 950 mL, and sterilize at 115℃ for 30 min. After sterilization, add 1 mL of vitamin solution and 2 mL of trace metal solution. Add 10 g / L methanol to the fermentation medium for fatty acid fermentation.

[0125] (2) Experimental Procedure and Conditions

[0126] XMCFA80 strain was activated by picking three single colonies and incubating them in 3 / 15 mL SD medium at 37°C with shaking at 220 rpm for 24 h. For seed culture, the activated bacterial culture was transferred at 1% (v / v) to 20 / 100 mL SD medium and incubated at 37°C with shaking at 220 rpm for 16–18 h. Inoculation was performed according to the initial OD... 600 =1 inoculated into the fermentation medium, with a liquid volume of 50 mL / 250 mL Erlenmeyer flask, and fermented at 37 °C and 220 rpm. Point-to-point or endpoint sampling was used for biomass (expressed as absorbance at 600 nm) and yield analysis.

[0127] (3) Fatty acid synthesis using methanol as a substrate

[0128] Fermentation experiments of fatty acids were conducted using 50 mL / 250 mL Erlenmeyer flask fermentation medium (containing 10 g / L methanol) as the starting medium. Specifically:

[0129] culture medium

[0130] SD medium: 10 g / L methanol, 6.7 g / L YNB;

[0131] Fermentation medium (basic components): (NH4)2SO4 2.5 g / L, KH2PO4 14.4 g / L, MgSO4·7H2O 0.5 g / L, add approximately 900 mL ddH2O, adjust pH to 5.6, bring volume to 950 mL, and sterilize at 115℃ for 30 min. After sterilization, add 1 mL of vitamin solution and 2 mL of trace metal solution. Add 10 g / L methanol to the fermentation medium for fatty acid fermentation.

[0132] Experimental Procedure and Conditions

[0133] XMCFA80 strain was activated by picking three single colonies and incubating them in 3 / 15 mL SD medium at 37°C with shaking at 220 rpm for 24 h. For seed culture, the activated bacterial culture was transferred at 1% (v / v) to 20 / 100 mL SD medium and incubated at 37°C with shaking at 220 rpm for 16–18 h. Inoculation was performed according to the initial OD... 600 =1 inoculated into the fermentation medium, with a liquid volume of 50 mL / 250 mL Erlenmeyer flask, and fermented at 37 °C and 220 rpm. Point-to-point or endpoint sampling was used for biomass (expressed as absorbance at 600 nm) and yield analysis.

[0134] Feeding and pH adjustment were performed based on real-time monitoring of methanol concentration and pH in the culture medium. After 210 hours of continuous fermentation, the recombinant Hansenula polymorpha strain XMCFA80 synthesized 53.3 mg / L of C12 / C14 fatty acids using methanol as the sole carbon source. Figure 7 A), C12 / C14 fatty acids accounted for 67.24% of the total free fatty acids. Figure 7 B), and long-chain fatty acids did not accumulate in large quantities with increasing fermentation time. Figure 7 B). This result demonstrates the potential of Hansenula polymorpha as a host cell for the bioconversion of methanol into C12 / C14 fatty acids.

[0135] Example 6

[0136] Increased precursor supply promotes C12 / C14 fatty acid synthesis in recombinant Hansenula polymorpha strains

[0137] The results of fed-batch methanol shake-flask fermentation revealed that a low methanol conversion rate led to a slow accumulation rate of C12 / C14 fatty acids. DAS2 is a key enzyme gene in the methanol assimilation process of Hansenula polymorpha, mainly responsible for converting formaldehyde into dihydroxyacetone, which is a raw material for the growth and production of the strain. Therefore, by further overexpressing the DAS2 gene to improve the catalytic efficiency of this enzyme, the methanol utilization efficiency of the recombinant Hansenula polymorpha strain can be further improved.

[0138] Based on this, a DAS2 gene expression cassette was constructed and integrated into the chromosome of strain XMCFA80 to obtain recombinant *Hansenula polymorpha* strain XMCFA85. The specific procedure was as follows: First, the DNA donor dOpMCFA-43 was amplified using primers in Table 6 to construct the required DNA fragment. Then, ligation was performed using SOE-PCR. The obtained donor DNA fragment dOpMCFA-43 was co-transformed with gRNA plasmid p5NS6 into recombinant *Hansenula polymorpha* XMCFA80, and the correct transformant was named XMCFA81. Further, strain XMCFA81 was transformed with plasmids pOpMCFA-18 and 19 to obtain recombinant *Hansenula polymorpha* XMCFA85. Fermentation in methanol medium in shake flasks showed that the C12 / C14 fatty acid yield of recombinant *Hansenula polymorpha* strain XMCFA85 was further increased to 65 mg / L. Figure 8 ).

[0139] Example 7

[0140] Increasing the supply of NADPH to the cytoplasm of recombinant Hansenula polymorpha further promotes the synthesis of C12 / C14 fatty acids.

[0141] Fatty acid synthesis requires a high amount of reducing agent NADPH. Appropriately increasing the NADPH supply in the cytoplasm of the strain can effectively promote fatty acid synthesis. First, the gene expression cassettes RtME1, PYC1, MDH3, and SciDP2 were constructed and integrated into the chromosome of strain XMCFA85 to obtain the recombinant Hansenula polymorpha strain XMCFA88.

[0142] The specific procedure is as follows: First, the DNA donors dMDH3-PYC1, dRtME, and dScIDP2 were amplified according to the primers in Table 6 to construct the required DNA fragments. Then, ligation was performed using SOE-PCR. Using strain XMCFA85 as the starting strain, the obtained donor DNA fragments were sequentially recombined with gRNA plasmids pNS19(dMDH3-PYC1), pNS11(dRtME), and pNS9(dScIDP2) to obtain the final correct transformant, named XMCFA88. Fermentation in methanol medium in shake flasks showed that the C12 / C14 fatty acid yield of the recombinant Hansenula polymorpha strain XMCFA88 was further increased to 96.6 mg / L. Figure 9 )

[0143] Example 8

[0144] The ability of the final strain XMCFA88 to synthesize C12 / C14 fatty acids from methanol was evaluated using a 1L bioreactor.

[0145] The optimal recombinant Hansenula polymorpha C12 / C14 fatty acid producing strain XMCFA88 was subjected to scale-up fermentation, specifically:

[0146] (1) Culture medium

[0147] SD medium: 20 g / L glucose, 6.7 g / L YNB;

[0148] Fermentation medium (basic components): (NH4)2SO4 2.5 g / L, KH2PO4 14.4 g / L, MgSO4·7H2O 0.5 g / L, add approximately 900 mL ddH2O, adjust pH to 5.6, bring volume to 950 mL, dispense into bioreactors (285 mL / reactor), and sterilize at 115℃ for 30 min. After sterilization, add 0.3 mL of vitamin solution and 0.6 mL of trace metal solution. Add 10 g / L methanol to the fermentation medium for fatty acid fermentation.

[0149] (2) Experimental Procedure and Conditions

[0150] XMCFA88 strain was activated, and three single colonies were picked and cultured in 3 / 15 mL SD medium at 37°C with shaking at 220 rpm for 24 h. For seed culture, the activated bacterial culture was transferred at 1% (v / v) to 50 / 250 mL SD medium and cultured at 37°C with shaking at 220 rpm for 17 h. Inoculation was performed according to the initial OD... 600 =1 was inoculated into the fermentation medium, with a liquid volume of 300 mL / L bioreactor. When methanol was depleted, 600 g / L methanol and 5× Delft minimum component medium (2:1, v / v) were fed at a rate of 1 mL / h. Temperature, pH, and dissolved oxygen were set at 37 °C, 5.6%, and 30%, respectively. The initial stirring rate was set at 400 rpm and increased to a maximum of 800 rpm based on the dissolved oxygen level. The initial aeration rate was 18 sL / h and increased to a maximum of 48 sL / h based on the dissolved oxygen level. During fermentation, residual methanol was monitored to control the feed rate while maintaining a low methanol concentration (<5 g / L). After 240 h of fermentation, the engineered strain XMCFA80 consumed 200 g / L methanol to synthesize 2.0 g / L C12 / C14 fatty acids, which accounted for 57.1% ( Figure 10 ).

[0151] Meanwhile, the PCR methods used in this invention for amplifying DNA fragments all follow the following description (using TaKaRa high-fidelity enzyme). (Taking DNA Polymerase as an example): The PCR reaction system is 50 μL, including 10 μL of 5×PrimeSTAR Buffer, 4 μL of dNTP Mixture (2.5 mM each), 10 pmol of Primer 1, 10 pmol of Primer 2, template (200 ng of genome / 40 ng of plasmid), 0.5 μL of PrimeSTAR DNA Polymerase, and sterile water to a final volume of 50 μL. The PCR program is set as follows: 1 cycle (98℃ for 3 min), 33 cycles (98℃ for 30 s, 65℃ for 15 s, 72℃ for 1 kb / min), and 1 cycle (72℃ for 10 min).

[0152] In summary, this invention presents four key strategies for enhancing the production of C12 and C14 fatty acids in this series of strains. These strategies include: mutating the endogenous FAS gene of *Hansenula polymorpha* to make it more C12 / C14 chain length specific; replacing the endogenous FAA1 gene of *Hansenula polymorpha* with the long-chain specific *Saccharomyces cerevisiae*-derived *ScFAA1* gene; replacing the endogenous POX1 gene of *Hansenula polymorpha* with the long-chain specific *Yarrowia lipolytica*-derived *POX2* gene fused with the medium-chain specific human-derived *hACOT4* gene; cofactor engineering; and increasing precursor supply. The recombinant *Hansenula polymorpha* strain optimized by these strategies can accurately and efficiently accumulate C12 and C14 fatty acids using methanol as a carbon source.

[0153] Table 1. Strain Information

[0154]

[0155]

[0156]

[0157] Table 2 Amino acid sequences

[0158]

[0159]

[0160]

[0161]

[0162] Table 3 Nucleotide Sequences

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183] Table 4 Plasmid Information

[0184]

[0185]

[0186] Table 5 Primer Information

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193] Table 6 Donor DNA Construction Information

[0194]

[0195]

[0196]

[0197]

Claims

1. An engineered strain that synthesizes C12 and C14 fatty acids, characterized in that: Engineered bacteria are obtained by integrating fatty acid synthase into recombinant yeast as a host. Alternatively, acyl-CoA synthase, acyl-CoA oxidase, and acyl-CoA thioesterase can be knocked out and / or integrated into the resulting engineered bacteria to obtain engineered bacteria.

2. The engineered strain for synthesizing C12 and C14 fatty acids according to claim 1, characterized in that: The engineered bacteria obtained by further regulating the enzymes in the formaldehyde-to-dihydroxyacetone pathway, or by regulating these enzymes and increasing the supply of NADPH to the strain's cytoplasm, are obtained by knocking out and / or integrating acyl-CoA synthase, acyl-CoA oxidase, and acyl-CoA thioesterase.

3. The engineered strain for synthesizing C12 and C14 fatty acids according to claim 1, characterized in that: The recombinant yeast was obtained by knocking out fatty acid synthase in yeast as a host; wherein the fatty acid synthase is the OpFAS1 and / or OpFAS2 gene.

4. The engineered strain for synthesizing C12 and C14 fatty acids according to claim 1 or 3, characterized in that: The process involves using the corresponding recombinant yeast as a host to integrate the corresponding mutated fatty acid synthase containing the OpFAS1 or / and OpFAS2 mutant genes, thereby obtaining engineered bacteria.

5. The engineered strain for synthesizing C12 and C14 fatty acids according to claim 4, characterized in that: The OpFAS1 or / and OpFAS2 mutant gene is OpFAS2. G1240M (SEQ ID NO 6), OpFAS2 M1241S (SEQ ID NO 7), OpFAS2 G240M ,M1241S (SEQ ID NO 8), OpFAS1 R1843K One or more of the genes in (SEQ ID NO 5).

6. The engineered strain for synthesizing C12 and C14 fatty acids according to claim 5, characterized in that: The recombinant microbial cells integrate multiple copies of fatty acid synthase containing the OpFAS1 or / and OpFAS2 mutant genes, thus obtaining engineered bacteria.

7. The engineered strain for synthesizing C12 and C14 fatty acids according to any one of claims 1-6, characterized in that: The engineered bacteria have had acyl-CoA oxidase knocked out and have integrated long-chain specific acyl-CoA synthase and / or exogenous long-chain specific acyl-CoA oxidase and fused to express medium-chain specific acyl-CoA thioesterase, thus obtaining the engineered bacteria.

8. A method for constructing an engineered strain for synthesizing C12 and C14 fatty acids as described in claim 1, characterized in that: Using recombinant Hansenula polymorpha strain as the starting strain, the engineered strain was obtained by overexpressing fatty acid synthase containing the OpFAS1 and / or OpFAS2 mutant genes. Alternatively, by integrating a restriction long-chain fatty acid β-oxidase into the engineered bacteria obtained above, an engineered bacterium can be obtained; or, by further regulating the enzyme in the formaldehyde-to-dihydroxyacetone pathway of the strain obtained by integrating the restriction long-chain fatty acid β-oxidase, or by regulating the enzyme and increasing the supply of NADPH in the strain's cytoplasm, an engineered bacterium can be obtained.

9. The application of the engineered strain for synthesizing C12 and C14 fatty acids as described in claim 1, characterized in that: The application of the engineered bacteria in the synthesis of C12 and C14 fatty acids.

10. A method for synthesizing C12 and C14 fatty acids, characterized in that: Using the engineered bacteria described in claim 1, C12 and C14 fatty acids are synthesized by fermentation in a system with methanol as the carbon source.

Images