Yersinia lipophila and its construction method and its application in the degradation of long-chain alkanes in high-salt environments
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-29
- Publication Date
- 2026-08-14
AI Technical Summary
然而,野生菌株常存在生长缓慢、遗传操作困难以及环境稳定性不佳等固有缺陷
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to Yersinia lipophila, its construction method, and its application in the degradation of long-chain alkanes in high-salt environments. Background Technology
[0002] With the deepening of global industrialization, petroleum, as an important energy source and chemical raw material, inevitably leads to leaks and emissions during its extraction, transportation, refining, and use, causing widespread pollution of soil, groundwater, and marine environments. Petroleum hydrocarbon pollutants have a complex composition and are toxic, mutagenic, and carcinogenic, posing a serious threat to ecosystems and human health. Their remediation has become a global environmental challenge.
[0003] This problem is particularly prominent in high-salinity environments, where the difficulty of remediation is greatly increased. Coastal mudflats, saline-alkali lands, offshore oil fields, and petrochemical industrial parks are not only "disaster areas" for oil pollution accidents, but their inherent high salinity also greatly restricts the application of traditional remediation technologies. High salinity conditions exert severe stress on most microorganisms, leading to cell dehydration, enzyme activity inhibition, and membrane structure damage, making it difficult for conventional bioremediation bacteria to survive or even causing them to become inactive.
[0004] The core mechanism of microbial degradation of petroleum hydrocarbon pollutants lies in the oxidase system produced by the microorganisms that catalyzes the oxidation of hydrocarbon compounds. Although various degradation enzyme resources have been reported, research on highly efficient degradation enzymes for long-chain alkanes and complex polycyclic aromatic hydrocarbons is still in the exploratory stage, and the scarcity of relevant enzyme resources has, to some extent, restricted the practical application of bioremediation technology.
[0005] Existing bioremediation strategies for high-salt environments mainly involve screening salt-tolerant degradative strains from natural high-salt environments or modifying strains using genetic engineering. However, wild-type strains often suffer from inherent drawbacks such as slow growth, difficulty in genetic manipulation, and poor environmental stability. In the construction of genetically engineered bacteria, current technologies largely focus on enhancing single functions, lacking a systematic integration of the synergistic relationships between different physiological processes (such as energy metabolism, gene expression regulation, and protein synthesis). How to effectively couple multiple salt tolerance and degradation mechanisms to ensure efficient operation and maintain genetic stability under extreme environmental pressures remains a pressing technical challenge in this field. Summary of the Invention
[0006] In view of this, the technical problem to be solved by the present invention is to provide a lipophilic yeast, a method for constructing it, and its application in the degradation of long-chain alkanes in a high-salt environment.
[0007] The transcription levels of one or more target genes in the *Yersinia lipolytica* strain provided by this invention are upregulated compared to wild-type *Yersinia lipolytica*:
[0008] I) Genes related to the tricarboxylic acid cycle;
[0009] II) Spliceosome-related genes;
[0010] III) Endoplasmic reticulum function-related genes.
[0011] In this invention, by overexpressing key genes related to energy metabolism, the efficiency of ATP synthesis can be improved, ensuring that cells are able to initiate and maintain an efficient salt tolerance mechanism when facing salt stress. This significantly enhances the salt tolerance and survival ability of engineered bacteria in high-salt environments. As a feasible example, the tricarboxylic acid cycle-related gene is selected from at least one of ACLY, CIT1, and gltA. For example, it can be a combination of ACLY and CIT1, or a combination of ACLY and gltA, or a combination of CIT1 and gltA, or a combination of ACLY, CIT1, and gltA.
[0012] In this invention, overexpression of spliceosome-related genes can significantly improve the quality and efficiency of protein synthesis in cells under stress. By enhancing the function of spliceosome-related genes, intron excision and exon joining of pre-mRNA can be precisely catalyzed, ensuring the accuracy of genetic information transmission. This ensures that cells can still efficiently synthesize the correct functional proteins under salt stress, maintain cellular homeostasis and signal transduction, thereby enhancing the salt tolerance and hydrocarbon degradation ability of engineered strains. The spliceosome-related genes are selected from at least one of BUD31, DDX23, and Prp18. For example, it can be a combination of BUD31 and DDX23, or a combination of BUD31 and Prp18, or a combination of DDX23 and Prp18, or a combination of BUD31, DDX23, and Prp18.
[0013] In this invention, overexpression of endoplasmic reticulum (ER) function-related genes can enhance the salt tolerance and degradation performance of *Yarrowia lipophila* through multiple mechanisms: As a key site for post-translational modification and quality control of proteins, strengthening the ER ensures the correct folding and stable transport of lipophilic enzymes under salt stress, preventing physiological disorders caused by the accumulation of faulty proteins; simultaneously, the ER participates in lipid synthesis, helping to repair cell membrane structures damaged by salt stress and maintain cell integrity. These synergistic effects ultimately enhance the survival ability of the strain in high-salt environments and its hexadecane degradation efficiency. The ER function-related genes are selected from at least one of SSC1, SSA4, and SEC61. For example, it can be a combination of SSC1 and SSA4, or a combination of SSC1 and SEC61, or a combination of SSA4 and SEC61, or a combination of SSC1, SSA4, and SEC61.
[0014] In a specific embodiment, the *Yarrowia lipolyticis* strain overexpresses any one of ACLY, CIT1, gltA, BUD31, DDX23, Prp18, SSC1, SSA4, and SEC61.
[0015] Taking the overexpression of two genes as an example, the combinations selected are: ACLY and CIT1, ACLY and gltA, CIT1 and gltA, BUD31 and DDX23, BUD31 and Prp18, DDX23 and Prp18, SSC1 and SSA4, SSC1 and SEC61, SSA4 and SEC61, ACLY and BUD31, ACLY and DDX23, ACLY and Prp18, ACLY and SSC1, ACLY and SSA4, ACLY and SEC61, CIT1 and BUD31, CIT1 and DDX23, and CIT1 and Pr... Combinations of p18, CIT1 and SSC1, CIT1 and SSA4, CIT1 and SEC61, gltA and BUD31, gltA and DDX23, gltA and Prp18, gltA and SSC1, gltA and SSA4, gltA and SEC61, BUD31 and SSC1, BUD31 and SSA4, BUD31 and SEC61, DDX23 and SSC1, DDX23 and SSA4, DDX23 and SEC61, Prp18 and SSC1, Prp18 and SSA4, Prp18 and SEC61.
[0016] Taking the overexpression of three genes as an example, the combinations are: ACLY, CIT1, and gltA; BUD31, DDX23, and Prp18; SSC1, SSA4, and SEC61; ACLY, CIT1, and BUD31; ACLY, CIT1, and DDX23; ACLY, CIT1, and Prp18; ACLY, CIT1, and SSC1; ACLY, CIT1, and SSA4; ACLY, CIT1, and SEC61; ACLY, gltA, and BUD31; ACLY, gltA, and DDX23; ACLY, gltA, and Prp18; ACLY... Combinations of gltA and SSC1, ACLY, gltA and SSA4, ACLY, gltA and SEC61, CIT1, gltA and BUD31, CIT1, gltA and DDX23, CIT1, gltA and Prp18, CIT1, gltA and SSC1, CIT1, gltA and SSA4, CIT1, gltA and SEC61, ACLY, BUD31 and DDX23, ACLY, BUD31 and Prp18, ACLY, BUD31 and SSC1, ACLY, BUD31 and SSA4, ACLY, BUD31 and SSA4, ACLY, BUD31 and SSC1 ... Combinations of D31 and SEC61, ACLY, DDX23 and Prp18, ACLY, DDX23 and SSC1, ACLY, DDX23 and SSA4, ACLY, DDX23 and SEC61, ACLY, Prp18 and SSC1, ACLY, Prp18 and SSA4, ACLY, Prp18 and SEC61, ACLY, SSC1 and SSA4, ACLY, SSC1 and SEC61, ACLY, SSA4 and SEC61, CIT1, BUD31 and DDX23, CIT1, BUD31 and Prp18, CI Combinations of T1, BUD31, and SSC1; Combinations of CIT1, BUD31, and SSA4; Combinations of CIT1, BUD31, and SEC61; Combinations of CIT1, DDX23, and Prp18; Combinations of CIT1, DDX23, and SSC1; Combinations of CIT1, DDX23, and SSA4; Combinations of CIT1, DDX23, and SEC61; Combinations of CIT1, Prp18, and SSC1; Combinations of CIT1, Prp18, and SSA4; Combinations of CIT1, Prp18, and SEC61; Combinations of CIT1, SSC1, and SSA4; Combinations of CIT1, SSC1, and SEC61; Combinations of CIT1, SSA4, and SEC61.Combinations of gltA, BUD31, and DDX23; gltA, BUD31, and Prp18; gltA, BUD31, and SSC1; gltA, BUD31, and SSA4; gltA, BUD31, and SEC61; gltA, DDX23, and Prp18; gltA, DDX23, and SSC1; gltA, DDX23, and SSA4; gltA, DDX23, and SEC61; gltA, Prp18, and SSC1; gltA, Prp18, and SSA4; gltA, Prp18, and SEC61; gltA, SSC1, and SSA4; gltA, SSC1, and SEC61; gltA, SSA4, and SEC61; BUD31, DDX23, and SSC1; BUD31, DDX23, and SSA... Combinations of 4, BUD31, DDX23 and SEC61, BUD31, Prp18 and SSC1, BUD31, Prp18 and SSA4, BUD31, Prp18 and SEC61, BUD31, SSC1 and SSA4, BUD31, SSC1 and SEC61, BUD31, SSA4 and SEC61, DDX23, Prp18 and SSC1, DDX23, Prp18 and SSA4, DDX23, Prp18 and SEC61, DDX23, SSC1 and SSA4, DDX23, SSC1 and SEC61, DDX23, SSA4 and SEC61, Prp18, SSC1 and SSA4, Prp18, SSC1 and SEC61, Prp18, SSA4 and SEC61. ,
[0017] Chassis bacteria refer to microbial strains in synthetic biology that serve as hosts for the introduction of exogenous genes to achieve specific functions. This invention uses *Yarrowia lipolytica* YAH13 as the chassis bacteria. Compared to other chassis bacteria, the *Yarrowia lipolytica* strain constructed using this method exhibits superior hydrophobic substrate affinity and high salt tolerance.
[0018] The *Yarrowia lipolyticis* strain provided by this invention achieves systematic enhancement of cellular energy metabolism, gene expression regulation, and protein synthesis pathways by constructing and overexpressing genes selected from the tricarboxylic acid cycle (ACLY, CIT1, gltA), spliceosome (BUD31, DDX23, Prp18), and endoplasmic reticulum function (SSC1, SSA4, SEC61). This strain not only significantly improves its survival and robustness under high-salt conditions but also effectively reshapes cellular metabolic flux, enabling it to maintain highly efficient hydrocarbon degradation activity under salt stress, thus overcoming the shortcomings of excessive physiological burden and poor stability in single-gene modification.
[0019] This invention also provides a method for constructing *Yarrowia lipophila* as described above, comprising: upregulating the transcriptional levels of one or more target genes as follows:
[0020] I) Genes related to the tricarboxylic acid cycle;
[0021] II) Spliceosome-related genes;
[0022] III) Endoplasmic reticulum function-related genes.
[0023] In this invention, the methods for upregulating the transcriptional level of the target gene include, but are not limited to: homologous recombination integration, strong promoter replacement, CRISPR-Cas9-mediated gene editing, multi-copy integration, in vitro transcription activation, and ribosome binding site optimization. In a specific embodiment, it is preferable to use an integration vector with a strong promoter (such as a TEF promoter) for homologous recombination to insert the target gene into a safe genomic site.
[0024] Furthermore, the present invention also provides the application of Yersinia lipophila, as described above, in the treatment of petroleum hydrocarbon pollution.
[0025] In this invention, the petroleum hydrocarbons include, but are not limited to, alkanes, cycloalkanes, aromatic hydrocarbons, and mixtures thereof. The alkanes include, but are not limited to, straight-chain alkanes and branched-chain alkanes. Specifically, the straight-chain alkanes are long-chain alkanes, preferably. For example, the straight-chain alkanes include, but are not limited to, n-decane, n-undecane, n-dodecane, n-tridecane, n-tetradecane, n-pentadecane, n-hexadecane, n-heptadecane, n-octadecane, n-eicosane, and n-triadecane. The cycloalkanes include, but are not limited to, cyclohexane, methylcyclohexane, and decahydronaphthalene. The aromatic hydrocarbons include, but are not limited to, monocyclic or polycyclic aromatic hydrocarbons such as benzene, toluene, ethylbenzene, xylene, naphthalene, phenanthrene, and anthracene. In specific embodiments, this invention exhibits a significant degradation effect on long-chain alkane components, such as n-hexadecane, which are highly hydrophobic and difficult to degrade.
[0026] In this invention, the petroleum hydrocarbon pollution refers to petroleum hydrocarbon pollution in a high-salt environment.
[0027] As a feasibility example, the high-salinity environment refers to the pollution of soil, surface water, and marine environments caused by oily waste generated during industrial production, transportation, or crude oil extraction. Specifically, the petroleum hydrocarbons include, but are not limited to, crude oil, refined oil, lubricating oil, and various alkanes, cycloalkanes, and aromatic hydrocarbons derived from them in the environment. As a feasibility example, the high-salinity environment refers to an environment with a sodium chloride concentration of not less than 0.5 mol / L, such as, but not limited to, typical saline-polluted sites such as coastal mudflats, saline-alkali land, offshore oil spill areas, and petrochemical industrial parks around salt lakes.
[0028] Furthermore, the present invention also provides a product for treating petroleum hydrocarbon contamination, comprising Yersinia lipolyticis as described above.
[0029] The dosage forms of the products described in this invention include, but are not limited to, bacterial suspensions, powders, granules, microcapsule formulations, and immobilized carrier bacterial agents; wherein, the powder may be freeze-dried bacterial powder, which is convenient for storage and transportation at room temperature. As a feasible example, the granules or immobilized carrier bacterial agents may use porous zeolite, biochar, or sodium alginate as carriers.
[0030] Furthermore, the present invention also provides a method for treating petroleum hydrocarbon pollution, comprising: applying Yersinia lipophila as described above or applying the product as described above.
[0031] In this invention, the application methods include: direct sprinkling, trenching, hole application, drilling injection, surface spraying, fertigation, preparation as bioremediation bed filler, and fabrication of immobilized microbial reactors. Taking high-salt soil environments as an example, the preferred method for treating petroleum hydrocarbon pollution is tillage and mixing or drilling injection to promote contact between the microorganisms and deep pollutants. Taking high-salt water bodies or tidal flat environments as an example, the preferred method for treating petroleum hydrocarbon pollution is the placement of colonization carriers or in-situ treatment using floating bioreactors.
[0032] In the petroleum hydrocarbon pollutants described in this invention, the concentration of sodium chloride is not less than 0.5 mol / L. In a specific embodiment, the concentration of sodium chloride is 1.5 mol / L.
[0033] This invention aims to construct a multifunctional yeast strain capable of efficiently coping with petroleum pollution in high-salt environments by systematically genetically modifying *Yarrowia lipolyticis* and integrating exogenous degradation pathways with salt tolerance modules. This will provide a high-performance cell factory for solving bioremediation challenges in complex environments. Experiments have demonstrated that by targeting and enhancing specific physiological nodes, the strain can achieve an 80.39% degradation rate of n-hexadecane under high-salt stress (1.5 M NaCl), with significantly enhanced intracellular ATP levels and increased cell surface hydrophobicity, effectively overcoming the degradation activity decline caused by energy deficit in high-salt environments. Attached Figure Description
[0034] Figure 1 Construction of engineered strains to enhance energy metabolism pathways;
[0035] Figure 2 OD of engineered strains that enhance energy metabolism pathways 600 ;
[0036] Figure 3 Characterization of the salt tolerance and hydrocarbon reduction ability of engineered strains: (a) degradation rate of engineered strains under salt-free and high-salt stress conditions; (b) hydrophobicity of cell surface of engineered strains under salt-free conditions; (c) hydrophobicity of cell surface of engineered strains under high-salt stress conditions; (d) ATP content of engineered strains;
[0037] Figure 4 Construction of engineered strains to enhance the physiological process of splicing;
[0038] Figure 5 Characterization of the salt tolerance and hydrocarbon reduction ability of engineered strains: (a) OD of engineered strains under salt-free and high-salt stress conditions 600 (b) Degradation rate of n-hexadecane by engineered strains under salt-free and high-salt stress conditions;
[0039] Figure 6 Construction of engineered strains to enhance the endoplasmic reticulum protein synthesis pathway;
[0040] Figure 7 The growth status of engineered strains that enhance endoplasmic reticulum protein synthesis is shown.
[0041] Figure 8 The hexadecane degradation rate of an engineered strain that enhances endoplasmic reticulum protein synthesis under no-salt stress was shown.
[0042] Figure 9 Construction of engineered strains with multi-strategy synergistic modification;
[0043] Figure 10 Characterization of the salt tolerance and hydrocarbon reduction ability of the engineered strain: (a) Growth trend of the engineered strain under salt-free and high-salt stress conditions; (b) Degradation rate of n-hexadecane of the engineered strain under salt-free and high-salt stress conditions;
[0044] Figure 11 The study demonstrates the enhanced degradation rate of engineered strains under both salt-free and high-salt stress conditions. Detailed Implementation
[0045] This invention provides *Yarrowia lipophila* strains, their construction methods, and their application in the degradation of long-chain alkanes in high-salt environments. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art will clearly be able to modify or appropriately alter and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0046] Unless otherwise defined in this invention, the scientific and technical terms associated with this invention shall have the meanings understood by one of ordinary skill in the art.
[0047] The terms “comprising,” “including,” and “having” are used interchangeably to indicate the inclusiveness of a scheme, meaning that the scheme may contain elements other than those listed. It should also be understood that the use of “comprising,” “including,” and “having” herein also provides for schemes “consisting of…”.
[0048] The term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can mean: A exists alone, A and B exist simultaneously, or B exists alone. A and B can be singular or plural.
[0049] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single or multiple items.
[0050] The numerical ranges and parameters involved in this invention have been presented as precisely as possible in the specific embodiments. However, any numerical value inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all numerical ranges or specific data used in this disclosure may have a reasonable deviation within a certain range, such as ±10%, ±5%, ±1%, or ±0.5%.
[0051] In this invention, "transcription level" refers to the abundance or quantity of mRNA molecules generated by the transcription of a specific gene within a cell. Upregulation of the "transcription level" means that, compared to the unmodified wild-type control strain (YAH13), the mRNA expression level of a specific gene within the cell is significantly increased.
[0052] In this invention, the "target gene" refers to the set of functional genes whose expression is selectively regulated in order to enhance the salt tolerance and hydrocarbon reduction performance of Yersinia lipophila. Specifically, these include genes related to the tricarboxylic acid cycle, genes related to the spliceosome, and genes related to the endoplasmic reticulum function.
[0053] In this invention, the "tricarboxylic acid cycle-related gene" refers to a gene that encodes enzyme proteins involved in the tricarboxylic acid cycle (TCA cycle) and its upstream and downstream metabolic pathways, specifically selected from at least one of ACLY, CIT1, and gltA.
[0054] In this invention, the "splicing-related gene" refers to a gene that encodes a protein involved in the eukaryotic pre-mRNA splicing process, constitutes the splicing complex, or catalyzes the splicing reaction, specifically selected from at least one of BUD31, DDX23, and Prp18.
[0055] In this invention, the "endoplasmic reticulum function-related genes" refer to genes that encode proteins involved in physiological activities such as protein folding, misfolded protein degradation, protein transport, and lipid synthesis in the endoplasmic reticulum, specifically selected from at least one of SSC1, SSA4, and SEC61.
[0056] In this invention, "overexpression" refers to the process of introducing exogenous nucleic acid molecules (such as recombinant expression vectors) and using strong promoters to drive the transcription and translation of target genes in host cells, thereby increasing the protein expression level of the target gene to a level higher than the basal expression level of the host's endogenous gene.
[0057] In this invention, the "high-salt environment" refers to an environment in which the environmental medium contains a high concentration of inorganic salt ions, which has an inhibitory effect on the growth of common microorganisms. In this application, it specifically refers to an environment in which the sodium chloride concentration is not less than 0.5 mol / L.
[0058] In this invention, "treatment of petroleum hydrocarbon pollution" refers to the process of applying the engineered strains described in this invention or products containing such strains to contaminated environmental media (such as soil or water bodies) to convert petroleum hydrocarbon pollutants (especially n-hexadecane) into harmless small molecules or cellular biomass through the metabolic activities of microorganisms.
[0059] In this invention, the "chassis bacteria" refers to the original microbial strain that serves as a recipient for genetic engineering operations, used to receive and express exogenous target genes. In this invention, it is preferably a wild-type or engineered Yersinia lipolyticis yeast with alkane degradation potential, specifically the YAH13 strain.
[0060] In this invention, "petroleum hydrocarbon pollutants" refers to environmental media or objects that have been intruded upon and polluted by petroleum hydrocarbons, including but not limited to polluted soil (such as saline-alkali land, tidal flats, and soil around oil fields), surface water, groundwater, marine water bodies, and seabed sediments.
[0061] The test materials used in this invention are all common commercially available products, and can be purchased on the market. Among them:
[0062] The basal bacteria YAH13 is derived from an engineered modification of Yarrowia lipolytica ATCC 201249, specifically described as Δku80::P HP4D -LadA-octt, hisG, harboring pINA1269-ABC1.
[0063] The sequence of ACLY is:
[0064]
[0065] The sequence of CIT1 is:
[0066]
[0067] The sequence of gltA is:
[0068]
[0069] The sequence of BUD31 is as follows:
[0070] ATGGTGAAAATCCGCACTTCACGATCGAAAGCGCCTCCAGCTGGATTTGACGACATCTCCGATATTCTGCAGGAGTTTGGAGACAAGCTAAAAGACGCCCAAAACGCTCCAACCGAGGGAAAGAAAAAGAACCAGTTGTTATGGGACATTTATCGCATCCATCACCAGCGGTCTCGATATGTCTATGAGTTGTATTACAAGAAGGAGGCCATCACCAAAGAGCTGTATGCATATCTTCTGAAGAAGGGGTATGCCGATCAGAATCTCATTGCCAAGTGGCGAAAGCAGGGATACGAGAATCTCTGCTGTTTGAGGTGCATTCAAGGAAAGGAGAACATTCACGAAGGAACTTGTATCTGTCGGGTTCCTCGAAAGGATATCAAGGATGACAAGCCGGTGGAGTGTGTGACTTGTGGGTGTCGGGGTTGTGCTTCGAGTGATTAA;
[0071] The sequence of DDX23 is as follows:
[0072]
[0073] The sequence of Prp18 is:
[0074]
[0075] The sequence of SSC1 is:
[0076]
[0077] The sequence of SSA4 is:
[0078]
[0079] The sequence of SEC61 is:
[0080]
[0081] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.
[0082] This study, based on transcriptome analysis under high salt stress, systematically identified multiple key gene targets related to energy metabolism, post-transcriptional processing, and protein homeostasis. Using *Yarrowia lipolytica* YAH13, a strain previously constructed in our laboratory with preliminary alkane degradation capabilities, as a chassis, nine engineered strains were constructed using synthetic biology techniques, overexpressing genes related to energy metabolism (ACLY, CIT1, gltA), mRNA splicing (BUD31, DDX23, Prp18), and endoplasmic reticulum function (SSC1, SSA4, SEC61). Furthermore, a dual-node synergistic strategy of "energy metabolism-gene expression" was explored, leading to the construction of the dual-gene engineered strain YAS17, which simultaneously overexpresses gltA and Prp18. Through growth curve determination, ATP content analysis, cell surface hydrophobicity measurement, and hexadecane degradation rate assessment, the following main conclusions were obtained:
[0083] First, strengthening core energy metabolism nodes can significantly improve the overall performance of strains under high salt stress. Among the three energy metabolism modification targets, strain YAS03, which overexpresses the citrate synthase gene gltA, performed best. Its degradation rates of n-hexadecane under salt-free and high-salt (1.5 M NaCl) stress reached 85.07% and 80.39%, respectively, significantly better than the chassis strain. Mechanistic studies showed that gltA overexpression effectively enhanced the tricarboxylic acid cycle flux, significantly increasing intracellular ATP content, while also enhancing cell surface hydrophobicity and growth capacity under high salt conditions. This strategy, by strengthening the core energy supply of the cell, provides a fundamental guarantee for efficient hydrocarbon degradation under high salt stress and is currently the most promising single-gene modification scheme.
[0084] Second, enhancing mRNA splicing has a positive regulatory effect on degradation capacity under non-stress conditions. Overexpression of the splicing factor genes Prp18 (strain YAS04) or BUD31 (strain YAS06) increased the degradation rate of n-hexadecane to 88.38% and 83.62%, respectively, under salt-free conditions, indicating that improving pre-mRNA splicing efficiency is beneficial to the correct synthesis and functional expression of hydrocarbon degradation-related proteins. However, this strategy failed to significantly improve the degradation rate under high salt stress, but it helped maintain cell growth under adversity, suggesting that the improvement of splicing efficiency under high osmotic pressure may be limited by energy supply or other synergistic factors.
[0085] Third, endoplasmic reticulum (ER) protein transport is a potential bottleneck affecting the efficiency of degradative enzyme synthesis. Among ER function-related genes, overexpression of the protein transport subunit gene SEC61 (strain YAS09) increased the degradation rate to 83.20% under salt-free conditions, a 14.1% increase compared to the sclerotium bacteria, and significantly better than the effect of overexpressing the molecular chaperone genes SSA4 or SSC1. This result indicates that, under normal culture conditions, the efficiency of polypeptide chain transport to the ER is one of the key steps limiting the efficient synthesis of hydrocarbon-degrading enzyme systems. While overexpression of molecular chaperones has a limited effect on improving the degradation rate, it still has a protective function in promoting cell growth and maintaining protein homeostasis.
[0086] Fourth, the synergistic modification of the "energy metabolism-gene expression" dual-node failed to achieve the expected synergistic effect, revealing the complexity of multi-strategy integration. The dual-gene engineered strain YAS17, simultaneously overexpressing gltA and Prp18, exhibited degradation rates of 85.77% and 76.45% under salt-free and high-salt conditions, respectively, representing increases of 17.6% and 19.4% compared to the chassis strain. However, compared to the optimal single-gene strains YAS03 (25.5% increase under high-salt conditions) and YAS04 (21.2% increase under salt-free conditions), YAS17 did not show a synergistic effect exceeding the single optimal strategy, but rather exhibited a performance trade-off. Growth data showed that dual-gene co-overexpression significantly increased the metabolic burden on cells under salt-free conditions, resulting in significantly lower biomass than the chassis strain. These results indicate a complex interaction and resource competition between the two core systems of energy metabolism and post-transcriptional processing. Simple functional superposition is insufficient to achieve the expected synergistic effect, and future multi-strategy integration needs to focus more on metabolic adaptation and fine-tuning between modules.
[0087] In summary, this study successfully constructed a *Yasoemula lipolyticis* strain, represented by the YAS03 strain overexpressing gltA, through multi-dimensional and multi-strategy genetic modification. This strain exhibits both high hydrocarbon reduction efficiency and high salt tolerance. It maintains a high hexadecane degradation efficiency even under high salt stress, demonstrating promising practical application prospects. Furthermore, by systematically comparing the effects of single-strategy and dual-strategy modifications, this study revealed the potential mechanisms and limiting bottlenecks for improving the salt stress adaptability and petroleum hydrocarbon degradation performance of *Yasoemula lipolyticis* from multiple levels, including energy supply, post-transcriptional regulation, and protein transport. The technical solution provided by this invention has a clear modular design concept and scalability, offering valuable engineered strain resources and theoretical basis for constructing a multifunctional and robust microbial remediation system suitable for complex petroleum-polluted environments such as high-salt environments.
[0088] The present invention will be further illustrated below with reference to the embodiments:
[0089] Example 1: Construction and Characterization of Engineered Strains for Enhancing Energy Metabolism Based on Citrate Synthase
[0090] Microbial responses to high salt stress (such as synthesizing protective solutes and maintaining ion pump operation) are highly energy-intensive processes. Cells require a large amount of ATP to drive these stress-resistance physiological activities. If energy supply is insufficient, cells cannot effectively synthesize protective substances, leading to growth inhibition or even death. Overexpressing key energy metabolism genes (such as genes encoding rate-limiting enzymes in the tricarboxylic acid cycle and genes related to the mitochondrial respiratory chain) can improve ATP synthesis efficiency, ensuring that cells are able to initiate and maintain efficient salt tolerance mechanisms when facing salt stress. This significantly enhances the salt tolerance and survival ability of engineered bacteria in high-salt environments, providing a fundamental guarantee for hydrocarbon degradation.
[0091] 1. Construction of engineered strains to enhance energy metabolism pathways
[0092] This study selected three genes, ACLY, CIT1, and gltA, which are significantly upregulated in the tricarboxylic acid cycle under high salt stress. Using Yersinia lipolytica YAH13, which has shown preliminary alkane degradation ability in previous laboratory studies, as a chassis, the three genes ACLY, CIT1, and gltA were overexpressed to obtain engineered strains YAS01, YAS02, and YAS03. The effects of these genes on the salt stress tolerance and n-hexadecane degradation rate of Yersinia lipolytica were investigated.
[0093] These three genes are all located in the tricarboxylic acid cycle and its related pathways, but their biochemical functions, locations, and the physiological significance of their upregulation are crucially different. ACLY does not directly participate in reactions within the TCA cycle; it is located in the cytoplasm outside the mitochondria. Its function is to transport citrate, produced in the mitochondrial TCA cycle, to the cytoplasm, where it is cleaved to generate two key precursors: acetyl-CoA and oxaloacetate. Under high salt stress, cells need to synthesize large amounts of compatible solutes and cell membrane lipids to maintain membrane fluidity and resist osmotic pressure; the synthesis of these substances requires acetyl-CoA as a core precursor. CIT1 is a classic citrate synthase located in the mitochondrial matrix. It catalyzes the first and crucial rate-limiting step of the TCA cycle: the condensation of oxaloacetate and acetyl-CoA to generate citrate. The direct purpose of upregulating CIT1 is to accelerate the TCA cycle, increasing the overall flux and thus generating more reducing power for oxidative phosphorylation, ultimately producing more ATP. The catalytic function of gltA is similar to that of CIT1. A single enzyme may not be sufficient to meet the rapidly increasing energy and precursor requirements. Therefore, under salt stress, cells maximize their citrate synthesis capacity by simultaneously upregulating multiple genes encoding enzymes with the same function. The upregulation folds of ACLY, CIT1, and gltA gene expression levels in transcriptome analysis were 2.62, 2.64, and 12.16, respectively.
[0094] The ACLY, CIT1, and gltA genes were all derived from the genome of *Yarrowia lipolytica* YAH13. In this experiment, the IntK plasmid with a strong promoter was used as the integration vector. IntK was digested with BsaI restriction enzyme, and the linear vector IntK was obtained after gel extraction. The linear vector and the target gene fragment were assembled using SE ligase and transformed into competent *E. coli*. Colony PCR was performed on the transformants using the primer sequences shown in the table. After successful verification, the transformed *E. coli* were sent to a sequencing company. If the sequencing results were correct, successfully transformed engineered *E. coli* were obtained. Plasmids pIntK-ACLY, pIntK-CIT1, and pIntK-gltA were extracted from the engineered *E. coli*, digested with NotI, and finally linearized recombinant vectors PTEFI-ACLY-Tt8, PTEFI-CIT1-Tt8, and PTEFI-gltA-Tt8 were obtained after gel extraction. The linearized recombinant vector was transformed into the chassis strain. Colony PCR was performed on the transformed *Yarrowia lipolytica* using primers listed in the table to verify the transformation. Transformants that successfully integrated the ACLY, CIT1, and gltA genes into the chassis strain genome were screened. These transformed strains were then sent to a company for sequencing. If the sequencing results were correct, engineered yeast strains YAS01, YAS02, and YAS03, overexpressing the ACLY, CIT1, and gltA genes, were obtained. The specific construction process is as follows: Figure 1 As shown.
[0095] 2. Characterization of the salt tolerance and hydrocarbon reduction effects of engineered strains with enhanced energy metabolism pathways
[0096] OD200 analysis was performed on the three engineered strains. 600 The results of the measurement are as follows: Figure 2 The figure shows that the engineered bacteria exhibited better growth than the chassis strain YAH13 after 24 hours, indicating that enhanced energy metabolism is beneficial for cells to maintain normal proliferation in a high-salt environment.
[0097] Further evaluation of its degradation performance revealed ( Figure 3 Under both salt-free and high-salt stress (1.5 M NaCl) conditions, strain YAS03, overexpressing gltA, exhibited the best performance, with hexadecane degradation rates of 85.07% and 80.39%, respectively. Surface hydrophobicity assays showed that under high-salt stress, YAS01 and YAS03 possessed stronger hydrophobic surfaces in the early stages of degradation, which was beneficial for the adsorption and uptake of hydrocarbon substrates. Notably, YAS03 showed significantly higher intracellular ATP content at 24 h than other engineered bacteria and chassis bacteria, indicating that gltA overexpression not only enhanced TCA cycle flux but also provided cells with more abundant energy reserves, which may be the main reason for its high degradation efficiency under high-salt stress.
[0098] Example 2 Construction and characterization of engineered strains for enhancing splicing physiological processes
[0099] In eukaryotes, genetic information stored in DNA is transformed into functional protein molecules through a series of complex regulated biological processes. These proteins play crucial roles in maintaining cellular homeostasis, mediating signal transduction, and regulating life activities. First, the DNA encoding the protein combines with RNA polymerase to transcribe pre-mRNA. Pre-mRNA is then processed and transported into mature mRNA, which can then begin translation and post-translational processing and folding to form the normal protein. During this process, due to the presence of introns in the eukaryotic genome, pre-mRNA needs to have introns removed and exons joined in the cell nucleus to become mature mRNA, thus transmitting the correct genetic information and synthesizing the correct protein. The system in eukaryotic cells that performs this task of intron removal from pre-mRNA is called the spliceosome, a complex system composed of various proteins that precisely removes introns from pre-mRNA and joins exons to generate mature mRNA. This study selected three genes—BUD31, DDX23, and Prp18—from the spliceosome, all of which are closely related to pre-mRNA splicing, to investigate the effects of overexpression of these three genes on the salt tolerance and hexadecane degradation ability of *Yarrowia lipolytica*. BUD31 encodes a protein that is a component of the spliceosome protein complex; DDX23 encodes a protein that is both a component of the spliceosome protein and can also function independently as an enzyme, catalyzing one step of the splicing reaction; and Prp18 encodes a protein that is one of the enzymes catalyzing the exon ligation step in the splicing reaction.
[0100] 1. Construction of engineered strains to enhance splicing physiological processes
[0101] In this study, the strain YAH13 was overexpressed with Prp18, which encodes a precursor mRNA splicing factor; DDX23, which encodes an ATP-dependent RNA helicase; and BUD31, which encodes a site-selective protein. The upregulation folds of these genes in transcriptome analysis were 2.63, 3.74, and 3.21, respectively. All three genes act on the spliceosome. BUD31 catalyzes the synthesis of spliceosome activating proteins; DDX23 catalyzes spliceosome assembly and is also a component of the spliceosome; and Prp18 catalyzes the ligation of exons during the splicing reaction.
[0102] The three genes, BUD31, DDX23, and Prp18, were all derived from the genome of *Yarrowia lipolytica* YAH13; their specific base sequences are provided in the appendix. In this experiment, the IntK plasmid with a strong promoter was used as the integration vector. IntK was digested with BsaI restriction enzyme, and the linear vector IntK was obtained after gel extraction. The linear vector and the target gene fragment were assembled using SE ligase and transformed into competent *E. coli*. Colony PCR was performed on the transformants using the primer sequences in the table. After successful verification, the transformed *E. coli* were sent to the company for sequencing. Correct sequencing results indicated successful transformation of engineered *E. coli*. Plasmids pIntK-Prp18, pIntK-DDX23, and pIntK-BUD31 were extracted from the engineered *E. coli*. These were digested with NotI and, after gel extraction, finally yielded the linearized recombinant vectors PTEFiN-Prp18-Tt8, PTEFiN-DDX23-Tt8, and PTEFiN-BUD31-Tt8. The linearized recombinant vector was transformed into the chassis strain. Colony PCR was performed on the transformed *Yarrowia lipolytica* using primers listed in the table to verify the transformation. Transformants that successfully integrated the Prp18, DDX23, and BUD31 genes into the chassis strain genome were screened. These transformed strains were then sent to a company for sequencing. If the sequencing results were correct, engineered yeast strains YAS04, YAS05, and YAS06, overexpressing the Prp18, DDX23, and BUD31 genes, were obtained. The specific construction process is as follows: Figure 4 As shown.
[0103] 2. Characterization of the salt tolerance and hydrocarbon reduction effect of engineered strains with enhanced splicing physiological processes
[0104] Experimental results are as follows Figure 5 The results showed that under salt-free conditions, the growth of the engineered strains was slightly lower than that of the substrate bacteria, possibly due to the metabolic burden caused by gene expression. However, under high salt stress, the growth of all engineered strains was superior to YAH13, indicating that enhanced splicing efficiency helps cells maintain the accuracy and timeliness of protein synthesis under stress. Regarding degradation performance, under salt-free conditions, the degradation rates of strains overexpressing Prp18 (YAS04) and BUD31 (YAS06) increased to 88.38% and 83.62%, respectively, while the degradation rate of the DDX23 overexpressing strain (YAS05) decreased slightly (66.99%). Under high salt conditions, the degradation rates of the engineered strains and substrate bacteria did not differ significantly, indicating that the enhancement of the splicing process mainly improves degradation capacity in non-stress environments, but its supporting role in cell growth under salt stress remains important.
[0105] Example 3 Construction and characterization of engineered strains for enhancing endoplasmic reticulum protein synthesis pathway
[0106] The main mechanisms by which *Yersinia lipolytica* responds to salt stress include adjusting cell membrane lipid composition, accumulating similarly soluble solutes, sodium ion efflux, potassium ion accumulation, and activation of the antioxidant system. The endoplasmic reticulum (ER) plays a crucial role in various mechanisms of salt stress response in *Yersinia lipolytica*, participating in post-translational modifications, quality control, and lipid synthesis. Therefore, this study selected three genes—SSC1, SSA4, and SEC61—closely related to protein folding, misfolded protein degradation, and protein transport in the ER. Using *Yersinia lipolytica* YAH13 as a chassis, overexpressed these three genes to obtain engineered strains YAS07, YAS08, and YAS09, respectively, to investigate their effects on the salt stress tolerance and hexadecane degradation rate of *Yersinia lipolytica*.
[0107] 1. Construction of engineered strains to enhance endoplasmic reticulum protein synthesis pathway
[0108] Heat shock proteins (HSPs), also known as molecular chaperone proteins, are proteins produced by bacterial strains under high temperature or other stress. HSPs participate in protein folding, transport, and synthesis, preventing protein misfolding, stabilizing intracellular protein conformation, mediating protein delivery to target organelles, and maintaining intracellular protein homeostasis. Furthermore, HSPs are involved in cell cycle regulation, intracellular signal transduction, and apoptosis. The Hsp70 molecular chaperone participates in multiple fundamental cellular functions, including the folding of newly synthesized proteins, protein transport, and the assembly and disassembly of protein complexes. In this study, the chassis strain YAH13 was overexpressed with SSC1 and SSA4, which encode the HSP70 heat shock protein family, and SEC61, which encodes the protein transporter. Their gene expression levels were upregulated by folds of 2.96, 6.95, and 2.96, respectively, in transcriptome analysis. All three genes act on the endoplasmic reticulum; SSC1 and SSA4 are involved in protein folding, while SEC61 is involved in protein assembly.
[0109] The SSC1, SSA4, and SEC61 genes were all derived from the genome of *Yarrowia lipolytica* YAH13; the specific base sequences are provided in the appendix. In this experiment, the IntK plasmid with a strong promoter was used as the integration vector. IntK was digested with BsaI restriction enzyme, and the linear vector IntK was obtained after gel extraction. The linear vector and the target gene fragment were assembled using SE ligase and transformed into competent *E. coli*. Colony PCR was performed on the transformants using the primer sequences in the table. After successful verification, the transformed *E. coli* were sent to the company for sequencing. If the sequencing results were correct, successfully transformed engineered *E. coli* were obtained. Plasmids pIntK-SSC1, pIntK-SSA4, and pIntK-SEC61 were extracted from the engineered *E. coli*, digested with NotI, and finally linearized recombinant vectors PTEFiN-SSC1-Tt8, PTEFiN-SSA4-Tt8, and PTEFiN-SEC61-Tt8 were obtained after gel extraction. The linearized recombinant vector was transformed into the chassis strain. Colony PCR was performed on the transformed *Yarrowia lipolytica* using primers listed in the table to verify the transformation. Transformants that successfully integrated the SSA4, SSC1, and SEC61 genes into the chassis strain genome were screened. These transformed strains were then sent to a company for sequencing. If the sequencing results were correct, engineered yeast strains YAS07, YAS08, and YAS09, overexpressing the SSA4, SSC1, and SEC61 genes, were obtained. The specific construction process is as follows: Figure 6 As shown.
[0110] 2. Characterization of the salt tolerance and hydrocarbon reduction effects of engineered strains with enhanced endoplasmic reticulum protein synthesis pathway
[0111] Experimental results showed that, under salt-free conditions, the three engineered bacteria exhibited superior growth rates in the logarithmic growth phase and higher biomass in the stationary phase compared to YAH13, indicating that overexpression of endoplasmic reticulum-related genes helps improve protein synthesis efficiency and may alleviate the folding and transport bottlenecks during cell proliferation. Under high salt stress, the engineered bacteria still outperformed the chassis bacteria, with the SEC61 overexpressing strain (YAS09) showing the best performance, suggesting that protein transport to the endoplasmic reticulum may be a key factor limiting cellular adaptability in a high-salt environment.
[0112] Analysis of the degradation rate data of the engineered Yersinia lipophila strain under salt-free stress in the figure shows that ( Figures 7-8Overexpression of the SSA4 and SSC1 genes had limited effect on improving the degradation of n-hexadecane, with degradation rates of 74.33% and 73.75%, respectively, representing increases of only 1.9% and 1.4%. Overexpression of the SEC61 gene, however, brought a significant improvement, with a degradation rate of 83.20%, an increase of 14.1%. Based on growth data, it is speculated that under normal conditions, protein folding and misdegradation are not the main limiting steps, while the efficiency of polypeptide chain transport to the endoplasmic reticulum directly affects the synthesis and function of hydrocarbon degradation-related enzymes. Under high salt stress, although the engineered bacteria grew better than the wild type, the degradation rate was not significantly improved, indicating that the impact of salt stress on the activity of degrading enzymes or substrate uptake may exceed the compensatory range of endoplasmic reticulum function enhancement. Furthermore, although overexpression of SSC1 and SSA4 did not significantly improve the degradation rate, they may play a protective role similar to molecular chaperones in maintaining cell growth homeostasis and delaying senescence, providing a theoretical basis for subsequent multi-gene synergistic regulation.
[0113] Example 4 Construction and characterization of multi-strategy synergistic modified strains
[0114] Previous studies have shown that single-dimensional modification strategies have achieved certain results in improving the salt tolerance and hydrocarbon reduction performance of bacterial strains. YAS03, overexpressing gltA, enhanced the core energy metabolism of cells by strengthening the flux at the TCA cycle inlet, exhibiting the best performance under high salt stress with a degradation rate of 80.39%. YAS04, overexpressing Prp18, improved the synthesis capacity of functional proteins by optimizing pre-mRNA splicing efficiency, exhibiting the best performance under salt-free conditions with a degradation rate of 88.38%. However, these single-strategy modifications act on different metabolic or physiological nodes, and there is potential for complementarity and synergy among them. Energy metabolism and gene expression are the two core pillars of cellular response to environmental stress. On the one hand, sufficient ATP supply is a prerequisite for the efficient operation of energy-consuming molecular machines such as the spliceosome; on the other hand, efficient protein synthesis ensures the timely renewal and functional maintenance of various enzymes and proteins in metabolic pathways. Therefore, synergistically integrating energy metabolism enhancement and gene expression regulation is expected to produce synergistic effects beyond those of single strategies.
[0115] Based on the above assumptions, this study constructed a dual-gene synergistic modified strain, YAS17, from the chassis strain YAH13. This strain simultaneously overexpressed gltA (a key enzyme at the TCA cycle inlet) and Prp18 (a key factor in exon linking catalyzed by the spliceosome), aiming to explore the synergistic effect of the "energy metabolism-gene expression" dual-node synergistic strategy on the salt tolerance and hydrocarbon reduction performance of *Yarrowia lipolytica*. By comparing the performance with strains that only overexpress gltA or Prp18, the synergistic mechanism between the metabolic and physiological modifications was analyzed, providing a theoretical basis for multi-strategy integration. The strain construction method is the same as described above, and the construction diagram is shown below. Figure 9As shown.
[0116] The constructed strain YAS17 was inoculated into fermentation medium containing 10 g / L n-hexadecane and cultured in shake flasks under salt-free and high-salt (1.5 mol / L NaCl) conditions (30℃, 96 h). OD values were measured at appropriate intervals during the culture process. 600 The value was determined, and after 96 h, n-hexadecane in the culture medium was extracted with ethyl acetate. After appropriate dilution, the n-hexadecane content was detected by GC-MS, and the alkane degradation rate was calculated. The results are as follows: Figure 10 As shown.
[0117] like Figure 10 As shown in Figure a, under salt-free conditions, the growth of YAS17 and the chassis strain YAH13 was comparable in the early stages of culture, with similar OD values. 600 All reached approximately 5. However, after 12 hours, the biomass growth rate of YAS17 slowed significantly, while that of the chassis strain continued to rise; after 24 hours, the OD of the chassis strain... 600 The growth rate of gltA stabilized at around 10, while that of YAS17 increased slowly, eventually reaching around 7 at 96 h. The overall growth level of YAS17 was significantly lower than that of the chassis strain, indicating that the co-overexpression of gltA and Prp18 imposed a significant metabolic burden on cell growth under salt-free conditions. It is speculated that this is because the simultaneous overexpression of the two genes consumes a large amount of cellular resources such as energy, amino acids, and ribosomes, and that the two genes act on two highly interconnected metabolic nodes—the TCA cycle and the spliceosome—and their cumulative effect may have disrupted the cell's original metabolic homeostasis.
[0118] Despite its poor growth performance, YAS17 showed relatively good degradation performance, such as... Figure 10 In the salt-free condition, YAS17 achieved a 96-hour hexadecane degradation rate of 85.77%, a 17.6% increase compared to the chassis strain (72.95%). Under high salt stress, the degradation rate of YAS17 reached 76.45%, a 19.4% increase compared to the chassis strain (64.03%). This phenomenon of growth limitation but high degradation efficiency may be due to YAS17 preferentially allocating its limited metabolic resources to alkane degradation-related enzyme systems such as cytochrome P450, alcohol dehydrogenase, and aldehyde dehydrogenase, rather than for cell proliferation. In other words, co-overexpression of the two genes may reshape the cellular metabolic flux, shifting it from growth-oriented to degradation-oriented. This strategy has certain advantages in bioremediation applications, maintaining high substrate degradation efficiency even with low cell biomass.
[0119] A cross-sectional comparison was made between YAS17 and single-gene strains, and the results are as follows: Figure 11As shown, YAS03 (single gltA) showed a 16.6% improvement over the chassis under salt-free conditions and a 25.5% improvement under high-salt conditions; YAS04 (single Prp18) showed a 21.2% improvement over the chassis under salt-free conditions and a 1.8% decrease under high-salt conditions; YAS17 (gltA-Prp18) showed a 17.6% improvement over the chassis under salt-free conditions and a 19.4% improvement under high-salt conditions. Analysis of the above data shows that the improvement of YAS17 under salt-free conditions (17.6%) falls between that of YAS03 (16.6%) and YAS04 (21.2%), and does not show a synergistic effect exceeding the optimal single-gene strain; under high-salt conditions, although YAS17 (19.4%) is significantly better than the negatively performing YAS04 (-1.8%), it is still lower than YAS03 (25.5%). This indicates that the co-expression of gltA and Prp18 did not achieve the expected synergistic effect, but rather exhibited a compromise, compensating for the negative defects of YAS04 under high salt conditions while failing to reach the optimal level of YAS03 under stress.
[0120] This result suggests a complex interaction between energy metabolism and splicing efficiency, rather than a simple linear additive relationship. On one hand, the enhanced TCA cycle flux from gltA overexpression may provide more energy support for the spliceosome, thus mitigating the negative effects of YAS04 under high salt conditions due to metabolic burden. On the other hand, the increased splicing efficiency from Prp18 overexpression may not have effectively coupled with the enhanced energy metabolism from gltA, instead resulting in mutual constraints due to resource competition. Furthermore, the dual metabolic burden from co-overexpression may be further amplified under high salt stress, limiting the full realization of synergistic potential.
[0121] In summary, the construction and characterization of YAS17 revealed the complexity of the synergistic modification of the metabolic-physiological dual nodes. Although the co-expression of the two genes showed better degradation performance than the chassis strain, it did not surpass the optimal single-gene strategy.
[0122] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. *Yersinia lipolytica*, in which the transcriptional levels of one or more of the following target genes are upregulated compared to wild-type *Yersinia lipolytica*: I) Genes related to the tricarboxylic acid cycle; II) Spliceosome-related genes; III) Endoplasmic reticulum function-related genes.
2. The *Yarrowia lipophila* strain according to claim 1, characterized in that, The tricarboxylic acid cycle-related genes are selected from at least one of ACLY, CIT1, and gltA; The spliceosome-related gene is selected from at least one of BUD31, DDX23, and Prp18; The endoplasmic reticulum function-related genes are selected from at least one of SSC1, SSA4, and SEC61.
3. The *Yarrowia lipophila* strain according to claim 1, characterized in that, It overexpresses any one of ACLY, CIT1, gltA, BUD31, DDX23, Prp18, SSC1, SSA4, and SEC61.
4. The *Yarrowia lipolyticis* strain according to any one of claims 1 to 3, characterized in that, Its substrate bacteria are YAH13.
5. The method for constructing *Yarrowia lipophila* according to any one of claims 1 to 4, comprising: Upregulate the transcriptional levels of one or more of the following target genes: I) Genes related to the tricarboxylic acid cycle; II) Spliceosome-related genes; III) Endoplasmic reticulum function-related genes.
6. The use of Yersinia lipophila according to any one of claims 1 to 4 in the treatment of petroleum hydrocarbon pollution.
7. The application according to claim 6, characterized in that, The petroleum hydrocarbon pollution mentioned refers to petroleum hydrocarbon pollution in high-salinity environments.
8. A product for treating petroleum hydrocarbon pollution, characterized in that, Includes the *Yersinia lipophila* strain as described in any one of claims 1 to 4.
9. Methods for treating petroleum hydrocarbon pollution, including: Apply the Yersinia lipophila strain according to any one of claims 1 to 4 or apply the product according to claim 8.
10. The method according to claim 9, characterized in that, Among petroleum hydrocarbon pollutants, the concentration of sodium chloride is not less than 0.5 mol / L.