A compound inoculum of *Priscilla argentea* and *Trichoderma harzianum* and its application in cucumber disease resistance and growth promotion.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-12
- Publication Date
- 2026-08-14
AI Technical Summary
[0006]单一菌株菌剂易受田间温湿度、土壤理化性质、根际微环境等外界因素干扰,存在防效波动、稳定性差的缺陷
1、本发明筛选获得的阿氏普里斯特氏菌(Priestia aryabhattai)5932对尖孢镰刀菌具有抑制作用,其抑菌率为6.54%。
Smart Images

Figure FT_1 
Figure FT_2 
Figure SMS_1
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural microbiology, specifically to a compound inoculum of *Priscilla argentea* and *Trichoderma harzianum* and its application in promoting disease resistance and growth in cucumbers. Background Technology
[0002] cucumber( Cucumis sativus Cucumber (L.) is a major economic vegetable crop cultivated in my country, with a wide cultivation range and high economic benefits, occupying an important position in the vegetable production system. Under intensive planting models, long-term continuous cropping of cucumbers leads to soil microecological disorder, accumulation of harmful pathogens, and frequent occurrence of soil-borne diseases. Among them, Fusarium wilt has become one of the main obstacles restricting high-quality and high-yield cucumber production.
[0003] Cucumber wilt is caused by Fusarium oxysporum (Fusarium oxysporum) Fusarium oxysporum Caused by infection, this pathogen can persist in the soil environment for a long time, invading the vascular tissue of the plant through the root system, hindering the transport of water and nutrients, and inducing typical symptoms such as yellowing, wilting, root rot, and browning of the vascular bundles. In severe cases, it can cause the death of the entire plant. Due to its strong survival ability and hidden infection, conventional control methods are difficult to completely eradicate the disease.
[0004] Currently, the control of cucumber wilt mainly relies on chemical agents, soil improvement, crop rotation, and the planting of disease-resistant varieties. However, long-term use of chemical agents can easily lead to problems such as pathogen resistance, damage to the soil microecology, and pesticide residues, which does not meet the requirements of modern green ecological agriculture. Therefore, safe, pollution-free, highly efficient, and stable microbial biological control technology has become the mainstream research direction for the control of soil-borne diseases.
[0005] Bacillus bacteria are excellent biocontrol and growth-promoting microorganisms, possessing advantages such as strong resistance, spore production, easy formulation, and suitability for large-scale production. They can inhibit pathogen proliferation by secreting antibacterial active substances and enhance crop growth by activating soil nutrients and secreting growth-promoting substances. Trichoderma is a widely used biocontrol fungus that achieves soil-borne disease control through multiple mechanisms, including nutrient space competition, pathogen hyperparasitism, secretion of degrading enzymes, and induction of plant resistance. Among them, *Trichoderma harzianum* (African *Trichoderma*) Trichoderma afroharzianum It has outstanding biological control potential and strong application adaptability.
[0006] Single-strain inoculants are easily affected by external factors such as field temperature and humidity, soil physicochemical properties, and rhizosphere microenvironment, resulting in fluctuating efficacy and poor stability. Combining Bacillus-like bacteria with Trichoderma can enhance biocontrol through complementary and synergistic effects of strain functions; however, compatibility differences exist between different strains, and some Bacillus-like bacteria can inhibit the growth of Trichoderma, leading to the failure of the compound system. Therefore, screening for Bacillus-like bacterial strains with excellent antibacterial properties and good compatibility with Trichoderma harzianum to construct highly efficient and synergistic compound inoculants is of significant practical value for strengthening the control of cucumber wilt and promoting cucumber growth.
[0007] In summary, developing a microbial agent combining Bacillus-like bacteria and Trichoderma harzianum, and exploring its synergistic antibacterial ability and cucumber growth-promoting effect, can provide a new microbial resource for the green control of cucumber wilt disease and contribute to the green and sustainable development of the facility vegetable industry. Summary of the Invention
[0008] The purpose of this invention is to provide a compound inoculum of *Priscilla argentea* and *Trichoderma harzianum* and its application in promoting disease resistance and growth in cucumbers.
[0009] Firstly, the present invention claims protection for a composite bacterium.
[0010] The combined bacteria claimed in this invention consist of *Priscilla auriculi* and *Trichoderma harzianum*. The *Priscilla argentea* mentioned is *Priscilla argentea* (… Priestia aryabhattai )5932, whose number at the Agricultural Microbiology Center of the China Committee on Culture Collection of Microorganisms is ACCC64577. In some embodiments of the present invention, the *Trichoderma harzianum* is *Trichoderma harzianum* (…). Trichoderma afroharzianum )225-2P1, whose number at the Agricultural Microbiology Center of the China Committee on Culture Collection of Microbial Cultures is ACCC33109.
[0011] In some embodiments of the present invention, in the combined bacteria, the *Priestella auriculi* is counted as an effective viable number (CFU), the *Trichoderma harzianum* is counted as a conidia number, and the ratio of the number of *Priestella auriculi* to the number of *Trichoderma harzianum* is 10:1.
[0012] Secondly, the present invention claims protection for compound microbial agents containing the combined bacteria described in the first aspect above.
[0013] The active ingredient of the compound microbial agent is the combined microorganisms described in the first aspect above.
[0014] In addition to the active ingredients, the above-mentioned compound microbial agent may also contain a carrier. The carrier may be a commonly used agricultural carrier that is biologically inert. The carrier may be a solid carrier or a liquid carrier; the solid carrier may be a mineral material, plant material, or polymer compound; the mineral material may be at least one of clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica, and diatomaceous earth; the plant material may be at least one of corn flour, soybean flour, and starch; the polymer compound may be polyvinyl alcohol and / or polyethylene glycol; the liquid carrier may be an organic solvent, vegetable oil, mineral oil, or water; the organic solvent may be decane and / or dodecane.
[0015] The above-mentioned compound microbial agents can be in various dosage forms, such as liquid, emulsion, suspension, powder, granules, wettable powder, water-dispersible granules, lyophilized preparations or microcapsule preparations.
[0016] Depending on the requirements, surfactants (such as Tween 20, Tween 80, etc.), binders, stabilizers (such as antioxidants), pH adjusters, etc. may also be added to the compound microbial agent.
[0017] Furthermore, both the combined bacteria and the compound bacterial agent possess at least one of the following characteristics: inhibiting Fusarium oxysporum; preventing and controlling plant wilt; promoting plant growth; and mitigating the harmful effects of Fusarium oxysporum on plants.
[0018] Thirdly, the present invention claims protection for the use of the combined bacteria described in the first aspect above or the compound bacterial agent described in the second aspect above in any of the following: (A1) Inhibits Fusarium oxysporum; (A2) Prepare a product for inhibiting Fusarium oxysporum.
[0019] In some embodiments of the present invention (specifically, the plate test in the embodiments), in the application, the Trichoderma harzianum and the Priestella auriculata, under non-contact conditions of physical isolation and air-connection, synergistically inhibit Fusarium oxysporum through gas-phase interaction.
[0020] Fourthly, the present invention claims protection for the use of the combined bacteria described in the first aspect above or the compound bacterial agent described in the second aspect above in any of the following: (B1) Control of plant wilt; (B2) Prepare products for the prevention and control of plant wilt; (B3) Promotes plant growth; (B4) Prepare products that promote plant growth; (B5) Reduce the harmful effects of Fusarium oxysporum on plants; (B6) Prepare products that reduce the harmful effects of Fusarium oxysporum on plants.
[0021] The plant wilt disease mentioned above is caused by Fusarium oxysporum.
[0022] Fifthly, the present invention claims a method for preventing and controlling plant wilt disease.
[0023] The method for controlling plant wilt disease claimed in this invention may include: applying the combined microorganisms described in the first aspect or the compound microbial agent described in the second aspect above to the plant and / or its cultivation substrate to control plant wilt disease.
[0024] Sixthly, the present invention claims a method for promoting plant growth.
[0025] The method for promoting plant growth claimed in this invention may include: applying the combined microorganisms described in the first aspect or the compound microbial agent described in the second aspect above to the plant and / or its cultivation substrate to promote plant growth.
[0026] Seventhly, the present invention claims a method for mitigating the harmful effects of Fusarium oxysporum on plants.
[0027] The method for mitigating the harmful effects of Fusarium oxysporum on plants claimed in this invention may include: applying the combined microorganisms described in the first aspect or the compound microbial agent described in the second aspect above to the plant and / or its cultivation substrate to reduce the harmful effects of Fusarium oxysporum on plants.
[0028] In the above three methods, the combined bacteria or the compound microbial agent can be applied to plant seeds, seedlings, roots, rhizosphere soil, or cultivation substrates. The application methods can specifically include root irrigation, root dipping, seed soaking, seed coating, soil mixing, hole application, fertigation, and drip irrigation. The application time of the combined bacteria or the compound microbial agent can specifically be before sowing, at sowing time, during transplanting, at the planting stage, before disease occurrence, or at the early stage of disease occurrence.
[0029] In the aforementioned aspects, the promotion of plant growth can specifically be manifested in all or part of the following: promoting increased plant height, promoting increased root length, and promoting increased fresh weight. The reduction of the harmful effects of Fusarium oxysporum on plants can specifically be manifested in all or part of the following: promoting increased plant height and promoting increased root length under Fusarium oxysporum stress.
[0030] In the aforementioned relevant aspects, the plant may be any of the following: (C1) Cucurbitaceae family plants; (C2) Plants of the Cucumber genus; (C3) Cucumber.
[0031] In the aforementioned related aspects, the *Fusarium oxysporum* can be *Fusarium oxysporum* cucumber-specific type. In some embodiments of the present invention, the *Fusarium oxysporum* is *Fusarium oxysporum* cucumber-specific type (…). oxysporum f. sp. cucumerinum ACCC 37438.
[0032] Compared with the prior art, the present invention has the following beneficial effects: 1. The *Priscilla auriculata* strain obtained by screening in this invention (… Priestia aryabhattai )5932 has an inhibitory effect on Fusarium oxysporum, with an inhibition rate of 6.54%.
[0033] 2. The *Priscilla auriculata* obtained by screening in this invention (… Priestia aryabhattai The inhibition rate of 5932 against the African Trichoderma harzianum strain ACCC 33109 was 0%, indicating that the two have good compatibility.
[0034] 3. *Priscilla argentea* ( Priestia aryabhattai When 5932 was co-cultured with Trichoderma harzianum, the inhibition rate against Fusarium oxysporum reached 27.75%, which was higher than the 6.54% of the treatment with Priscilla auris alone and / or the 8.90% of the treatment with Trichoderma harzianum alone, indicating that the two have a synergistic antibacterial effect.
[0035] 4. Pot experiments showed that *Priscilla argentea* (…) Priestia aryabhattai The compound bacterial agent composed of Trichoderma harzianum strain 5932 and Trichoderma harzianum strain ACCC 33109 can significantly increase cucumber plant height, root length, and fresh weight of above-ground and below-ground parts.
[0036] 5. Metabolomics analysis showed that after application of the compound microbial agent, a variety of differential metabolites in cucumber plants or rhizosphere samples changed significantly, mainly involving metabolic pathways such as Amino sugar and nucleotide sugar metabolism, indicating that the compound microbial agent can improve the disease resistance and growth promotion ability of cucumber by regulating its metabolic response.
[0037] 6. The compound microbial agent of this invention has the advantages of being safe, environmentally friendly, easy to prepare, convenient to apply, and having stable disease prevention and growth promotion effects, making it suitable for promotion and application in green cucumber production.
[0038] In summary, the compound bacterial agent of *Priestella auriculi* 5932 and *Trichoderma harzianum* provided by this invention has good compatibility, synergistic antibacterial effect, disease prevention and growth promotion effect, and application stability. It can be used as a highly efficient biocontrol agent resource for the biological control of cucumber wilt and green production of cucumber, and has good prospects for field application and promotion value. Attached Figure Description
[0039] Figure 1Image of strain 5932 after 24 hours of culture on LB medium.
[0040] Figure 2 A phylogenetic tree for strain 5932 was constructed based on the 16S rRNA gene sequence. Detailed Implementation
[0041] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0043] The *Priscilla argentea* in this application ( Priestia aryabhattai Strain 5932 was collected on May 15, 2025, by the Agricultural Culture Collection of China (ACCC), also known as the China Agricultural Culture Collection Center (Address: Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Haidian District, Beijing, 100081, China), with accession number ACCC 64577. From the date of collection, the public can obtain these two strains from the ACCC. The ACCC has a dedicated website at http: / / www.accc.org.cn, where the public can order strains directly online.
[0044] Trichoderma harzianum in this application ( Trichoderma afroharzianumStrain 225-2P1 was collected on December 31, 2016, by the Agricultural Culture Collection of China (ACCC, address: Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Haidian District, Beijing, 100081, China), with accession number ACCC 33109. Since the date of collection, the public has been able to obtain these two strains from the ACCC. The ACCC has a dedicated website at http: / / www.accc.org.cn, where the public can directly order strains online. Hereinafter referred to as *Trichoderma harzianum* ACCC 33109.
[0045] The *Fusarium oxysporum* cucumber-specific strain in this application ( oxysporum f. sp. cucumerinum IVF515 and HG080908 were collected on November 30, 2008, by the Agricultural Culture Collection of China (ACCC, address: Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Haidian District, Beijing, 100081, China), with accession number ACCC 37438. Since the date of collection, these two strains have been available to the public from the ACCC. The ACCC has a dedicated website at http: / / www.accc.org.cn, where the public can order strains directly online. Hereinafter referred to as *Fusarium oxysporum* ACCC 37438.
[0046] The culture conditions for the above strains are as follows: (1) Culture medium Trichoderma harzianum and Fusarium oxysporum were cultured using PDA medium. The PDA medium formula was: potato 200 g / L, glucose 20 g / L, agar 20 g / L, pH 5.6.
[0047] The remaining strains were cultured using LB medium. The LB medium formula was: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0.
[0048] (2) Cultivation conditions Trichoderma harzianum was inoculated into PDA plates and incubated at 28°C for 7 days.
[0049] Fusarium oxysporum was inoculated into PDA plates and incubated at 28°C for 7 days.
[0050] The remaining strains were inoculated into LB liquid medium and cultured at 37°C and 180 r / min for 24 h with shaking.
[0051] Example 1, *Priscilla argentea* ( Priestia aryabhattai Isolation and identification of 5932 The *Priscilla argentea* strain of this invention was isolated from saline-alkali soil in Daqing, Heilongjiang Province, and obtained through antagonistic functional screening. Priestia aryabhattai ) strain 5932.
[0052] I. Isolation of strain 5932 Using a gradient dilution method, 10g of soil sample was weighed and placed in an Erlenmeyer flask containing 90mL of sterile water. The flask was shaken at 150r / min for 30min at 28℃ to prepare a soil suspension. The suspension was then serially diluted with sterile water to a concentration of 10g. -3 10 -4 10 -5 Concentration gradients were applied to LB agar plates and incubated upside down at 37°C for 24 hours. Single colonies were picked and streaked across four zones of LB agar plates using a sterile inoculation loop. One of the obtained strains was identified as strain 5932.
[0053] II. Identification of strain 5932 1. Morphological identification The colony morphology of strain 5932 was observed using the streak plating method, and the morphology of the bacterial cells and spores was observed using an optical microscope.
[0054] Strain 5932 cells are rod-shaped and, after culturing on LB medium for 24 h, as... Figure 1 As shown, the colonies are milky yellow, round, smooth, and slightly convex, similar to... Priestia They share similar morphological characteristics with other bacteria.
[0055] 2. Sequencing and construction of molecular phylogenetic tree of the strain (1) Gene sequence of 16S rRNA Genomic DNA was extracted from strain 5932 and used as a template. PCR amplification was then performed using universal primers 27F and 1492R. The PCR reaction mixture (25 μL) consisted of: 12.5 μL of 2×Es Taq Master Mix (Beijing Tiangen Biotech Co., Ltd.), 1 μL of DNA template, 1 μL each of universal primers 27F and 1492R, and 9.5 μL of ddH2O. An equal amount of ddH2O was added as a control instead of the DNA template. PCR amplification conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 60 s, 55℃ annealing for 90 s, 72℃ extension for 90 s, 30 cycles; 72℃ extension for 10 min, 4℃ infinity.
[0056] Upstream primer 27F: AGAGTTTGATCCTGGCTCAG (5'-3'); Downstream primer 1492R: GGTTACCTTGTTACGACTT (5'-3').
[0057] After amplification, the amplified products were detected by 1.2% agarose gel electrophoresis and then sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results (the gene sequence of the 16S rRNA of strain 5932 contains SEQ ID NO:1) were compared with the 16S rRNA gene sequences in GenBank of NCBI. The sequence with high similarity to the type strain was selected as the reference sequence. Sequence alignment was then performed using MEGA software and manually corrected. The processed data were then subjected to multi-site sequence alignment using MEGA software and the sequencing sequence. The sequences were manually cut and corrected, and a molecular phylogenetic tree was constructed using the neighbor-joining tree method to identify the taxonomic position of the strain. The phylogenetic tree of strain 5932 based on the 16S rRNA gene sequence is shown below. Figure 2 As shown in the figure. It can be seen from the figure that strain 5932 is related to *Priscilla auriculata* (…). Priestia aryabhattai They are highly homologous.
[0058] Based on the above results, strain 5932 can be identified as *Priscilla auriculata* (…). Priestia aryabhattai The strain was deposited on May 15, 2025, at the Agricultural Culture Collection of China (ACCC, address: Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Haidian District, Beijing, 100081, China), with accession number ACCC64577. Hereinafter referred to as *Priscilla argentea* 5932.
[0059] Example 2: Evaluation of the compatibility of *Priscilla argentea* 5932 with *Trichoderma harzianum* and its antifungal activity against *Fusarium oxysporum*. 1. Compatibility test of *Priscilla argentea* 5932 with *Trichoderma harzianum* from Africa The effect of *Priscilla argentea* 5932 on the growth of *Trichoderma harzianum* was investigated using the plate-on-plate culture method.
[0060] A 6 mm diameter mycelium of Trichoderma harzianum ACCC 33109 was inoculated into the center of a PDA plate. 100 μl of a 1×10⁻⁶ μL solution was used as the concentration. 7 A CFU / ml culture of *Priscilla argentea* 5932 was spread onto LB medium and placed on top of a culture dish inoculated with *Trichoderma harzianum* ACCC 33109. The upper and lower culture dishes were separated by sterile cellophane and sealed with sealing film.
[0061] After inoculation, the plates were incubated at 28°C for 3 days. After incubation, the colony diameter of Trichoderma harzianum ACCC33109 was measured, and the inhibition rate of Trichoderma harzianum 5932 against Trichoderma harzianum ACCC33109 was calculated.
[0062] The formula for calculating the inhibition rate is: Inhibition rate (%) = (Control colony diameter - Treated colony diameter) × 100 / Control colony diameter. Wherein, the control colony diameter is the diameter of a single Trichoderma harzianum ACCC 33109 colony; the treated colony diameter is the diameter of a Trichoderma harzianum ACCC 33109 colony treated with Priscilla argentea 5932. The experiment was conducted in triplicate, and the results are expressed as the mean.
[0063] The results showed that *Priestella argentea* 5932 had a 0% inhibition rate against *Trichoderma harzianum* ACCC 33109, indicating that this strain has good compatibility with *Trichoderma harzianum* and is suitable as a candidate strain for compounding with *Trichoderma harzianum*.
[0064] 2. Screening for the antibacterial activity of *Priscilla argentea* 5932 against *Fusarium oxysporum*. A 6 mm diameter Fusarium oxysporum ACCC 37438 disc was inoculated into the center of a PDA plate. 100 μl of a 1×10⁻⁶ μL solution was used as the concentration. 7 A CFU / ml culture of *Priscilla argentea* 5932 was spread onto LB medium and inverted onto a culture dish inoculated with *Fusarium oxysporum* ACCC37438. The upper and lower culture dishes were separated by sterile cellophane and sealed with sealing film.
[0065] After inoculation, the plates were incubated at 28°C for 5 days. After incubation, the colony diameter of Fusarium oxysporum ACCC37438 was measured, and the inhibition rate of each candidate strain against Fusarium oxysporum was calculated.
[0066] The formula for calculating the inhibition rate is: Inhibition rate (%) = (Control colony diameter - Treated colony diameter) × 100 / Control colony diameter. Wherein, the control colony diameter is the diameter of a single *Fusarium oxysporum* colony; the treated colony diameter is the colony diameter of *Fusarium oxysporum* ACCC 37438 treated with *Priscilla argentea* 5932. The experiment was conducted in triplicate, and results are expressed as mean ± standard deviation.
[0067] The results showed that *Priscilla argentea* 5932 had an inhibition rate of 6.54% against *Fusarium oxysporum* (specific data: 6.54 ± 4.03, unit %). Combined with the result in step 1 that this strain had no inhibitory effect on *Trichoderma harzianum*, *Priscilla argentea* 5932 was determined to be the preferred strain for combination with *Trichoderma harzianum*.
[0068] Example 3: Combined antifungal effect of *Priscilla argentea* 5932 and *Trichoderma harzianum* against *Fusarium oxysporum*. 1. Preparation of Priscilla albopictus 5932 bacterial suspension Priestella auriculi 5932 was inoculated into LB liquid medium and cultured at 37°C with shaking at 180 r / min for 24 h. After the culture was completed, the bacterial concentration was adjusted to 1×10⁻⁶. 7 CFU / mL, for later use.
[0069] 2. Antibacterial test design Trichoderma harzianum ACCC 33109 and Fusarium oxysporum ACCC 37438 were grown and activated on PDA medium. After 7 days, a fungal disc of Trichoderma harzianum ACCC 33109 was punched out using a puncher (Φ=6mm) and inoculated into the center of a partitioned PDA medium plate. 50 μl of the culture solution of Priestella auriculi 5932 prepared in step 1 was spread on the other half of the partitioned plate (LB medium) and placed on top of the petri dish inoculated with Fusarium oxysporum ACCC 37438 (see Example 2). The plates were sealed with sealing film and incubated at 28°C for 5 days. Each treatment was repeated in triplicate. The colony diameter of Fusarium oxysporum ACCC 37438 was measured, and the inhibition rate was calculated.
[0070] Inhibition rate (%) = (Control colony diameter - Treatment colony diameter) × 100 / Control colony diameter. Wherein, the control colony diameter is the colony diameter of Fusarium oxysporum cultured alone; the treatment colony diameter is the colony diameter of Fusarium oxysporum treated in combination with Priscilla auriculi 5932 and Trichoderma harzianum ACCC 33109.
[0071] The experiment also included two single-strain inhibition experiments against *Fusarium oxysporum* as controls. One control consisted of *Priscilla argentea* 5932 inoculated onto LB medium (i.e., step 2 of Example 2, where the inoculation amount of *Priscilla argentea* 5932 was twice that used in the combined treatment group). The other control consisted of *Trichoderma harzianum* ACCC 33109 inoculated into 6 mm diameter mycelial discs on PDA medium, which were then incubated with *Fusarium oxysporum* ACCC 37438 in a sealed container at 28°C for 5 days. Each treatment was repeated three times. The colony diameter of *Fusarium oxysporum* ACCC 37438 was measured, and the inhibition rate was calculated. The experiment was repeated three times, and the results are expressed as mean ± standard deviation.
[0072] The results are shown in Table 1.
[0073] Table 1. Inhibition rates of different treatments against Fusarium oxysporum ACCC 37438
[0074] As shown in Table 1, the inhibition rate of *Priscilla argentea* 5932 alone against *Fusarium oxysporum* ACCC 37438 was 6.54%, and the inhibition rate of *Trichoderma harzianum* ACCC 33109 alone against *Fusarium oxysporum* ACCC 37438 was 8.90%. The combined treatment of *Priscilla argentea* 5932 and *Trichoderma harzianum* ACCC 33109 against *Fusarium oxysporum* ACCC 37438 reached 27.75%, which was significantly higher than the theoretical sum of the inhibition rates of the two strains (15.44%), indicating that there was a significant synergistic effect between the two strains in inhibiting *Fusarium oxysporum*.
[0075] Example 4: Evaluation of the effects of compound microbial agents on cucumber growth promotion and resistance to pathogenic stress. This embodiment identifies the effects of a compound inoculant composed of *Priscilla auris* 5932 and *Trichoderma harzianum* ACCC 33109 on the growth promotion and resistance to pathogenic stress in cucumbers. Details are as follows: 1. Cucumber materials and seedling cultivation The cucumber variety tested was Zhongnong 6.
[0076] Cucumber seeds were first soaked in 75% alcohol for 5 minutes, then in 0.5% NaOCl solution for 5 minutes, rinsed 5 times in sterile distilled water, and soaked in warm water for 5 hours. They were then placed in petri dishes and kept moist using sterile gauze and filter paper, and germinated in the dark at 28℃ for 24 hours. After germination, seeds with buds of similar uniformity were selected and sown in seedling trays containing substrate. These trays were then placed in a light incubator for seedling cultivation under the following conditions: 16 hours of light at 25℃ / 8 hours of darkness at 18℃. When the second true leaf was fully expanded (14 days), robust cucumber seedlings with similar above-ground and underground growth were selected for experimental use.
[0077] 2. Pot Experiment Design When the second true leaf has fully unfolded (14 days), select robust cucumber seedlings with consistent growth in both the above-ground and underground parts, and transplant them into pots. Fill each pot with 0.3 kg of soil and plant one seedling per pot.
[0078] The experiment was set up as follows: CK: No inoculation with pathogens, no application of biocontrol bacteria; 33109: Apply only Trichoderma harzianum ACCC 33109; 37438: Inoculate only with Fusarium oxysporum ACCC 37438 (the pathogen causing cucumber wilt); 5932: Apply only *Priscilla argentea* 5932 and *Trichoderma harzianum* ACCC 33109; 5932+: Apply *Priscilla argentea* 5932 and *Trichoderma harzianum* ACCC 33109, and inoculate with *Fusarium oxysporum* ACCC 37438; Each treatment was set up with 4 replicates, with 1 plant per pot.
[0079] 3. Pathogen inoculation method After culturing Fusarium oxysporum ACCC 37438 in PDA medium for 15 days, a spore suspension was prepared and the concentration was adjusted to 1×10⁻⁶. 8 spores / mL.
[0080] The pathogen was inoculated by mixing it with soil. Each plant was inoculated with 30 mL of a spore suspension of Fusarium oxysporum ACCC 37438.
[0081] 4. Application method of microbial agents The bacterial concentration of *Priscilla auriculata* 5932 was 1×10⁻⁶. 9 CFU / mL, apply 30 mL per plant.
[0082] The spore suspension concentration of Trichoderma harzianum ACCC 33109 was 1×10⁻⁶. 8One spore / mL, apply 30mL per plant.
[0083] The inoculant is applied by mixing it into the soil. The inoculant is applied simultaneously with inoculation of the pathogen.
[0084] 5. Effects on promoting growth and resisting pathogenic stress Fourteen days later, the cucumber plant roots were cleaned and the moisture was gently pressed and absorbed with sterile filter paper. The plants were then divided into above-ground and underground parts, and the plant height, root length, stem diameter, and fresh weight of the above-ground and underground parts were measured. The results are shown in Table 2.
[0085]
[0086] Note: Different lowercase letters indicate significant differences (P < 0.05).
[0087] Table 2 shows that, compared with the CK treatment, the 5932 treatment group (i.e., applying *Priscilla arvensis* 5932 and *Trichoderma harzianum* ACCC 33109) significantly increased cucumber plant height, root length, and above-ground / below-ground fresh weight, indicating that the combination of *Priscilla arvensis* 5932 and *Trichoderma harzianum* has a good growth-promoting effect. Furthermore, compared with the 37438 treatment group (i.e., inoculated only with *Fusarium oxysporum* ACCC 37438), the 5932+ treatment group (i.e., applying *Priscilla arvensis* 5932 and *Trichoderma harzianum* ACCC 33109, and inoculating with *Fusarium oxysporum* ACCC 37438) significantly increased cucumber plant height and root length, indicating that the combination of *Priscilla arvensis* 5932 and *Trichoderma harzianum* can alleviate the inhibitory effect of *Fusarium oxysporum* on cucumber plant growth and reduce the harmful effects of the pathogen.
[0088] Example 5: Analysis of Metabolic Changes in Cucumber Potted Plants After Treatment with Compound Microbial Agent This embodiment analyzes the changes in the metabolome of cucumber potted plants after treatment with a compound inoculum consisting of *Priscilla auriculata* 5932 and *Trichoderma harzianum* ACCC 33109. Details are as follows: 1. Sample collection Rhizosphere soil samples were collected 14 days after the pot experiment treatment in Example 3. Each treatment was set up with 3 biological replicates, and each replicate contained a mixture of 4 plants.
[0089] Immediately after collection, the samples were flash-frozen in liquid nitrogen and stored at -80°C for later use.
[0090] 2. Metabolite extraction Soil samples were freeze-dried at low temperature and then sent to Ling'en Biotechnology Co., Ltd. for metabolomics detection and analysis. 1.0 g of sample was weighed and placed in an EP tube, and 1000 μL of 80% methanol aqueous solution was added for extraction. The mixture was then thoroughly vortexed and incubated on ice for 5 min. Afterward, it was centrifuged at 4℃ and 15000 g for 15 min, and the supernatant was collected. The supernatant was then centrifuged again at 4℃ and 15000 g for 20 min to further remove impurities. The supernatant from the second centrifugation was freeze-dried. After freeze-drying, the corresponding volume of 10% methanol solution was added to reconstitute the sample, and the mixture was then used for LC-MS analysis.
[0091] 3. Metabolomics testing Sample analysis was performed using liquid chromatography-mass spectrometry (LC-MS). Chromatographic separation was performed using a Hypersil Gold C18 column at 40℃ and a flow rate of 0.2 mL / min. Mobile phase A was 0.1% formic acid aqueous solution, and mobile phase B was methanol. A gradient elution program was used for separation under the following conditions: 0.0 to 1.5 min, A 98%, B 2%; 1.5 to 3.0 min, A decreased from 98% to 15%, B increased from 2% to 85%; 3.0 to 10.0 min, A decreased from 15% to 0%, B increased from 85% to 100%; 10.0 to 10.1 min, A recovered to 98%, B recovered to 2%; 10.1 to 12.0 min, A was maintained at 98%, B at 2% to equilibrate the column. All percentages represent volume percentages.
[0092] Mass spectrometry detection was performed using an electrospray ionization (ESI) source, scanning in both positive and negative ion modes. The mass spectrometry scan range was set to m / z 100 to 1500. The ion source parameters were set as follows: spray voltage 3.5 kV, sheath gas flow rate 35 psi, auxiliary gas flow rate 10 L / min, ion transfer tube temperature 320 °C, S-lens RF level 60, and auxiliary gas heater temperature 350 °C. Secondary mass spectrometry data acquisition was performed using data-dependent acquisition (DDA) mode.
[0093] 4. Data processing and differential metabolite screening Non-targeted metabolomics analysis is based on high-resolution mass spectrometry (HRMS) detection technology and combines it with a high-quality secondary mass spectrometry database to match and identify molecular characteristic peaks. This enables high-throughput and high-quality detection of metabolites in samples, thus providing a more comprehensive reflection of the overall metabolic information of the sample. During metabolite identification, a mass deviation of 10 ppm is used as a threshold, and the results are compared with adduct ion information and a high-quality secondary mass spectrometry database to complete metabolite annotation.
[0094] To improve the reliability of data analysis results, the raw metabolomics quantitative data underwent missing value processing, background ion removal, standardization, and quality control filtering. First, metabolites with missing values greater than 50% were removed; missing values in the retained metabolites were filled using the K-nearest neighbor (KNN) method. Subsequently, blank samples were used to remove background ion interference. The processed raw quantitative results were standardized to reduce the impact of systematic bias between samples. The standardization formula is as follows: Raw quantitative value of sample / (Total quantitative values of metabolites in sample / Total quantitative values of metabolites in QC sample). Quality control (QC) samples were prepared by mixing equal volumes of all experimental samples and were used to monitor the stability of sample pretreatment and instrument detection processes. Data repeatability was assessed based on the relative standard deviation (RSD) of the relative peak areas of metabolites in the QC samples, and compounds with RSD > 30% were removed, ultimately obtaining reliable metabolite identification and relative quantitative results. In addition, the data quality was comprehensively evaluated through total ion chromatogram (TIC), QC sample correlation analysis, and visualization of overall abundance distribution.
[0095] To assess inter-sample metabolomic differences and intra-group repeatability at an overall level, this invention employs principal component analysis (PCA) based on metabolite relative abundance data. PCA is a commonly used unsupervised multivariate statistical analysis method that extracts the main components reflecting data variation through dimensionality reduction, visually demonstrating the similarities and differences between different samples while preserving as much original data information as possible. Before analysis, the metabolite relative abundance data is standardized to reduce the impact of variable magnitude differences and systematic errors on the statistical results. Based on the distribution characteristics of samples in the PCA score plot, the clustering and separation trends of samples from different groups are analyzed, and the stability of the detection platform and the overall reliability of the data are evaluated in conjunction with the clustering degree of QC samples.
[0096] Based on the experimental design and sample grouping, inter-group comparative analysis was performed on the relative abundance data of metabolites after quality control to screen for differentially expressed metabolites. For comparisons between two groups, differentially expressed metabolites were screened by combining the fold change (FC) of metabolite abundance and the results of significance tests. Typically, |log2FC| ≥ 1 and P < 0.05 were used as the screening criteria, where the P value was derived from an appropriate statistical test. For comparisons among multiple groups, one-way analysis of variance (One-way ANOVA) was used for significance testing, and P < 0.05 was used as the initial screening criterion for differentially expressed metabolites. Further analysis was conducted on the screened differentially expressed metabolites based on their variation trends, clustering characteristics, and database annotation results.
[0097] To further elucidate the biological processes and metabolic regulatory mechanisms involved by differentially metabolites, pathway annotation and enrichment analysis were performed on the screened differentially metabolites based on the KEGG database. By comparing the distribution of differentially metabolites in various metabolic pathways, significantly enriched metabolic pathways were screened, and their potential biological significance was analyzed in conjunction with the changing trends of key metabolites.
[0098] 5. Statistical results of differential metabolites The results are shown in Table 3.
[0099] Table 3. Statistical results of differential metabolites among different treatments
[0100] As shown in Table 3, compared with the 33109 treatment group (i.e., Trichoderma harzianum ACCC 33109), the 5932 treatment group (i.e., Priscilla argentea 5932 and Trichoderma harzianum ACCC 33109) caused significant changes in a large number of metabolites in the cucumber potted soil samples. A total of 657 differentially expressed metabolites were screened, including 379 upregulated metabolites and 278 downregulated metabolites.
[0101] 6. Representative differential metabolites The results showed that in the 5932 treatment group (i.e., treated with *Priscilla argentea* 5932 and inoculated with *Trichoderma harzianum* ACCC33109), the metabolites with the largest upregulation included Rauwolscine, Licoisoflavone B, Kopsinol, Ajmalicine, Licoisoflavone A, Desmethylglycitein, 1,8-Epoxy-p-menthan-4-olglucoside, and 2-(4-Hydroxyphenyl)-1-nitroethane, etc.; the metabolites with the largest downregulation included N-Benzyladenine, Polygalatenoside D, Withangulatin C, and Mosloflavanone.
[0102] Classified by chemical category, the differentially metabolites mainly include flavonoids / isoflavones, alkaloids, sulfur-containing compounds, and some small molecules related to basic metabolism. Among them, flavonoids / isoflavones such as Licoisoflavone A, Licoisoflavone B, Desmethylglycitein, 2'-Hydroxydaidzein, 3',4'-Dihydroxyflavone, Glaborol, and Dehydromillettone were generally elevated in the 5932 treatment group; alkaloids such as Rauwolscine, Ajmalicine, and Kopsinol were also upregulated; sulfur-containing compounds such as 1-Isothiocyanatobutane, Diisopropyl trisulfide, and Diethyldithiocarbamic acidmethyl ester accumulated in higher amounts in the 5932 treatment group. In addition, small molecules related to basic metabolism, such as Bisnorbiotin, 3-hydroxy-cis-5-octenoylcarnitine, 1-Methyluric acid, and Acamprosate, were also upregulated.
[0103] 7. Metabolic pathway enrichment analysis Pathway enrichment analysis showed that differentially metabolites were mainly enriched in pathways such as Amino sugar and nucleotide sugar metabolism, indicating that the combined treatment affected sugars and related metabolic processes in potted soil. In summary, compared with the 33109 treatment group (i.e., application of *Trichoderma harzianum* ACCC 33109), the 5932 treatment group (i.e., application of *Priscilla argentea* 5932 and inoculation with *Trichoderma harzianum* ACCC 33109) showed a significant remodeling of the potted soil metabolite profile, with differentially metabolites predominantly upregulated. This corresponds to the superior growth-promoting effect of the 5932 treatment group.
[0104] The above results indicate that the compound inoculum of *Priscilla argentea* 5932 and *Trichoderma harzianum* can regulate the rhizosphere metabolic network of cucumber, promote the accumulation of metabolites related to disease resistance and growth, thereby enhancing the resistance of cucumber to Fusarium wilt and promoting plant growth.
[0105] Based on the results of the above embodiments, it can be seen that the *Priscilla argentea* 5932 screened in this invention possesses both strong inhibitory activity against *Fusarium oxysporum* and good compatibility with *Trichoderma harzianum*. The combination of *Priscilla argentea* 5932 and *Trichoderma harzianum* significantly enhances the inhibitory effect against *Fusarium oxysporum*. Pot experiments showed that this compound inoculum significantly promoted cucumber growth. Metabolomics analysis indicated that this compound inoculum can regulate the accumulation of related metabolites and changes in metabolic pathways in the cucumber rhizosphere, thereby enhancing the cucumber's disease resistance and growth-promoting ability. Therefore, the *Priscilla argentea* 5932 and *Trichoderma harzianum* compound inoculum provided by this invention has good compatibility, synergistic antibacterial activity, disease prevention and growth-promoting effects, and application stability. It can be used as a highly efficient biocontrol agent resource for the biological control of cucumber wilt and green cucumber production, possessing good field application prospects and promotional value.
[0106] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A combination of bacteria, characterized in that: The combined bacteria consist of *Priestella auriculi* and *Trichoderma harzianum*. The *Priscilla argentea* mentioned is *Priscilla argentea* (… Priestia aryabhattai )5932, whose number at the Agricultural Microbiology Center of the China Committee on Culture Collection of Microorganisms is ACCC64577.
2. The combined bacteria according to claim 1, characterized in that: The African Trichoderma is Trichoderma harzianum ( Trichoderma afroharzianum )225-2P1, whose number at the Agricultural Microbiology Center of the China Committee on Culture Collection of Microbial Cultures is ACCC33109.
3. The combined bacteria according to claim 1 or 2, characterized in that: In the combined bacteria, the *Priestella auriculi* is counted in effective viable cell counts (CFU), and the *Trichoderma harzianum* is counted in conidia. The ratio of the number of *Priestella auriculi* to the number of *Trichoderma harzianum* is 10:
1.
4. A compound bacterial agent containing any one of the combined bacteria described in claims 1-3.
5. The use of the combined bacteria according to any one of claims 1-3 or the compound bacterial agent according to claim 4 in any of the following: (A1) Inhibits Fusarium oxysporum; (A2) Prepare a product for inhibiting Fusarium oxysporum.
6. The use of the combined bacteria according to any one of claims 1-3 or the compound bacterial agent according to claim 4 in any of the following: (B1) Control of plant wilt; (B2) Prepare products for the prevention and control of plant wilt; (B3) Promotes plant growth; (B4) Prepare products that promote plant growth; (B5) Reduce the harmful effects of Fusarium oxysporum on plants; (B6) Prepare products that reduce the harmful effects of Fusarium oxysporum on plants.
7. A method for controlling plant wilt disease, comprising: Applying the combined microorganisms of any one of claims 1-3 or the compound microbial agent of claim 4 to plant plants and / or their cultivation substrate to control plant wilt disease.
8. A method for promoting plant growth, comprising: Applying the combined microorganisms of any one of claims 1-3 or the compound microbial agent of claim 4 to plant plants and / or their cultivation substrate to promote plant growth.
9. A method for mitigating the harmful effects of Fusarium oxysporum on plants, comprising: Applying the combined microorganisms of any one of claims 1-3 or the compound microbial agent of claim 4 to plant plants and / or their cultivation substrates can reduce the harmful effects of Fusarium oxysporum on plants.
10. The application or method according to any one of claims 5-9, characterized in that: The plant is any one of the following: (C1) Cucurbitaceae family plants; (C2) Plants of the Cucumber genus; (C3) Cucumber; And / or, The *Fusarium oxysporum* species mentioned is the cucumber-specific variant of *Fusarium oxysporum*.