Compound microbial agents suitable for rain-fed agriculture ridge-mulching model and their application

Abstract

This invention discloses a compound microbial agent suitable for rain-fed agriculture's ridging and mulching model and its application, belonging to the field of agricultural microbiology technology. The compound microbial agent disclosed in this invention is composed of... Klebsiella sp . YCMR11 bacterial suspension and Pseudomonas sp . This compound microbial agent was prepared by mixing equal volumes of MR464 bacterial suspension. When applied during the seedling and jointing stages of maize in a raised-mulch planting pattern, it optimizes maize root architecture, promotes root growth, increases the number and diameter of aerial roots, and enhances the plant's resistance to lodging. Simultaneously, this compound agent can improve maize yield and water use efficiency. Under extreme drought conditions, it helps maintain stable maize yield; under conditions of ample rainfall, it can further increase maize yield. This compound agent exhibits excellent adaptability to raised-mulch planting patterns in arid regions, meeting the needs of sustainable production.

Description

Technical Field

[0001] This invention relates to the field of agricultural microbial technology, and more specifically to a compound microbial agent suitable for the ridge-mulching model of rainfed agriculture in arid areas, and the application of the agent in optimizing maize root structure and promoting its efficient water use. Background Technology

[0002] In rain-fed agriculture areas with limited water resources, conventional flat cropping often faces problems such as intense soil evaporation and limited rainwater infiltration depth, severely restricting the improvement of water use efficiency. Ridging and mulching technology, by constructing a composite microenvironment of "rainwater collection on the ridge surface and planting in the furrow," can effectively inhibit water evaporation within the mulch, promote rainwater infiltration, and increase crop transpiration water consumption. At the same time, it also has the functions of regulating soil temperature and activating soil nutrients, thereby achieving a high degree of synergy between crop water consumption and yield formation, significantly improving crop water use efficiency.

[0003] Soil microorganisms, as the core engine driving nutrient turnover, directly determine the availability of soil nutrients and the efficiency of crop absorption through their community structure and metabolic activity. They not only activate the soil nutrient pool through processes such as decomposing organic matter, mineralizing nitrogen and phosphorus, and secreting organic acids, but also promote crop root development and aboveground growth through direct pathways such as synthesizing siderophores, producing plant hormones (such as auxins and cytokinins), and regulating ethylene levels. Furthermore, beneficial microorganisms enhance crops' tolerance to biotic and abiotic stresses by competing for ecological niches with pathogens or inducing systemic resistance (ISR). This multidimensional function of promoting growth and protecting the environment makes the soil microbial community a key hub for maintaining soil fertility and crop health.

[0004] Although ridging and mulching and microbial inoculants each demonstrate their advantages in dryland agriculture, they are often applied separately. On the one hand, ridging and mulching technology mainly focuses on the physical functions of rainwater harvesting and moisture retention, without fully considering the targeted regulation of soil functional microbial communities. On the other hand, most commercially available microbial fertilizers are developed for general farmland environments and are difficult to adapt to the special hydrothermal microecological environment formed by ridging and mulching, resulting in unstable application effects and even failure to achieve the expected growth-promoting function.

[0005] Therefore, providing compound microbial agents suitable for rain-fed agriculture ridge-mulching models and their applications is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a compound microbial agent suitable for rain-fed agriculture ridge-mulching mode and its application.

[0007] This invention starts with the high abundance of microorganisms that are significantly enriched in the rhizosphere and roots under the ridge-mulching cultivation mode of dryland rainfed maize. It aims to overcome the limitations of the insufficient compatibility between existing inoculants and ridge-mulching mode, and thus provide a special composite microbial community that can efficiently adapt to and utilize the water environment optimized by ridge-mulching.

[0008] This invention further provides a method for screening and constructing the aforementioned composite microbial community. This method utilizes high-throughput sequencing data to screen for differentially expressed microbial groups under ridge-mulched and flat cultivation conditions. Combined with cultinomycology technology, it directionally isolates and screens dominant strains with growth-promoting and drought-resistant functions. The functions of the screened strains are verified through greenhouse and field trials to ensure their adaptability under ridge-mulched cultivation, guarantee stable maize yields under drought conditions, and achieve increased yields under conditions of sufficient rainfall.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] A compound microbial agent suitable for the ridge-mulching model of rain-fed agriculture in arid areas, containing equal volumes of strain YCMR11 bacterial suspension, which is significantly enriched in the rhizosphere, and strain MR464 bacterial suspension, which is significantly enriched in the roots. Klebsiella sp . YCMR11 bacterial suspension and Pseudomonas sp . OD of MR464 bacterial suspension 600 All are 0.6-0.8.

[0011] Among them, the strain YCMR11, which was significantly enriched in the rhizosphere, is Klebsiella pneumoniae ( Klebsiella sp . The accession number is CCTCC NO: M2026620, and it has been deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China. The deposit date is April 8, 2026, and it is classified as follows: Klebsiella sp . YCMR11.

[0012] The strain MR464, which was significantly enriched in the roots, is a Pseudomonas aeruginosa (…). Pseudomonas sp . The accession number is CCTCCNO: M2026619, and it has been deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China. The deposit date is April 8, 2026. The classification name is... Pseudomonas sp . MR464.

[0013] Furthermore, the compound microbial agent is applied to promote maize growth, root development, and water use efficiency in arid regions.

[0014] The compound microbial agent can promote the growth of corn in dryland areas, specifically by increasing agronomic traits such as plant height, stem diameter, ear length, and yield.

[0015] The compound microbial agent optimizes the root development of dryland maize, specifically by increasing the dry weight of maize roots, the diameter of aerial roots, and the number of aerial roots embedded in the soil.

[0016] The improvement of crop water use efficiency is specifically reflected in increasing the water use efficiency of corn.

[0017] Furthermore, a method for improving maize yield and water use efficiency in dryland rainfed agriculture involves inoculating the compound microbial agent near the maize root system under a ridging and mulching model.

[0018] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a compound microbial agent suitable for rain-fed agriculture ridge-mulching mode and its application, which has the following beneficial effects: (1) Highly targeted and adaptable: This invention targets the changes in soil microenvironment caused by the ridge-mulching model of dryland rain-fed agriculture. It takes the rhizosphere and root microorganisms that are induced and enriched as the core, prioritizes the selection of the most comprehensive strains for combination, and constructs a compound microbial agent, thereby effectively solving the problem of insufficient adaptability of existing commercially available microbial agents to this planting model.

[0019] (2) The construction method is scientific and efficient: The construction method of the compound microbial agent of the present invention is based on the strategy of combining high-throughput sequencing and culture omics. The process is simple and efficient, and can construct a compound microbial agent with excellent function and stability.

[0020] (3) Significant synergistic effect: The compound microbial agent of the present invention is composed of two fully functional strains in equal proportions. Under drought conditions, it can exert a synergistic effect, which is better than that of a single strain.

[0021] (4) Broad application prospects: This invention has good potential for promotion in dryland farming areas. It can significantly improve crop water use efficiency and yield by optimizing the rhizosphere microecology and promoting plant root development, thus contributing to green and efficient agricultural production. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0023] Figure 1This invention is based on the screening of microorganisms that are significantly enriched in the rhizosphere and root system under flat planting and ridging mulching modes.

[0024] Figure 2 The selected for this invention Klebsiella sp. YCMR11 (left image) and Pseudomonas A plate colony morphology diagram of sp. MR464 (right figure).

[0025] Figure 3 The selected for this invention Klebsiella sp. YCMR11 (Figure a) and Pseudomonas Phylogenetic tree of sp. MR464 (Figure b).

[0026] Figure 4 The selected for this invention Klebsiella sp. YCMR11 and Pseudomonas Plate observation results of the growth-promoting traits of sp. MR464, used to verify its ability to solubilize organophosphates (OP), inorganic phosphorus (IP), and iron-producing (Fe). 3+ It has functions such as decomposing cellulose (Cel) and producing glutenin (IAA).

[0027] Figure 5 The selected for this invention Klebsiella sp. YCMR11 and Pseudomonas sp. MR464 nifH Gene amplification bands.

[0028] Figure 6 The selected for this invention Klebsiella sp . YCMR11 and Pseudomonas sp . Image showing the growth-promoting effect of MR464 on potted corn.

[0029] Figure 7 The selected for this invention Klebsiella sp . YCMR11 and Pseudomonas sp . MR464 has the ability to produce biofilms.

[0030] Figure 8 The selected for this invention Klebsiella sp . YCMR11 and Pseudomonas sp . MR464's antifungal activity against typical plant pathogenic fungi.

[0031] Figure 9 The selected for this invention Klebsiella sp . YCMR11 andPseudomonas sp . Figure showing the results of the antagonistic experiment of MR464.

[0032] Figure 10 The selected for this invention Klebsiella sp . YCMR11 and Pseudomonas sp . Blood plate test results of MR464; left (MR464), right (YCMR11).

[0033] Figure 11 This is a comparative diagram showing the effects of single-strain inoculation and compound inoculum on the diameter and number of xylem vessels in maize roots.

[0034] Figure 12 This is a comparative diagram showing the effects of the compound microbial inoculant constructed in this invention on the growth of maize ears in the field. Detailed Implementation

[0035] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] Example 1 Klebsiella pneumoniae ( Klebsiella sp.) YCMR11 and Pseudomonas ( Pseudomonas The specific screening and identification process for MR464 (sp.) is as follows: 1) Obtaining root zone, rhizosphere soil samples and root samples At the experimental field base in Ganjing Town, Heyang County, Shaanxi Province, two tillage modes were established: conventional flat cultivation and ridge-mulching (ridge-to-furrow ratio of 70cm:40cm, ridge height of 15cm). Each mode had four replicate plots. Maize was sown at the end of April 2024 (maturing in October). The total rainfall during the entire growth period of maize (Lidan 22) was 282 mm, and no additional irrigation was provided. At the tasseling stage of maize, soil samples were collected at a depth of 5-20 cm between two maize plants in each plot using a soil auger as root zone soil. At the same time, roots from two maize plants in the corresponding plot were collected. After gently shaking off the loose soil attached to the root surface, 2-3 root segments were cut from each plant and mixed together as root samples. The root samples were placed in 30 mL of PBS buffer and vortexed for 1 min, then fixed on a shaker and shaken at 100 r / min for 20 min. Root samples were removed by filtration, and the filtered soil suspension was centrifuged at 4000 r / min and 4℃ for 10 min to obtain rhizosphere soil samples. The shaken root samples were rinsed with 70% (v / v) ethanol for 2 min, then with 1% (w / w) sodium hypochlorite solution for 5 min, and finally rinsed three times with sterile water for 15 min each time. The rhizosphere soil, rhizosphere soil, and root samples were divided into two parts: one part was stored at -80℃ for high-throughput sequencing, and the other part was stored at 4℃ for subsequent microbial isolation and purification.

[0037] Rhizosphere soil, rhizosphere soil, and root samples stored at -80℃ were collected and analyzed using FastDNA. ® The Spin Kit (MPBiomedicals, Solon, OH, USA) is used to extract total DNA from soil and roots. Please refer to the kit's instructions for specific steps.

[0038] The concentration of extracted genomic DNA was detected using a Qubit 2.0 (Thermo Fisher, USA) to determine the amount of DNA template required for subsequent PCR reactions. The V5-V7 variable region of the 16S rRNA gene, suitable for plant endophyte research, was amplified using primer sequences 799F (5′-AACMGGATTAGATACCCKG-3′; SEQ ID NO.1) and 1193R (5′-ACGTCATCCCCACCTTCC-3′; SEQ ID NO.2). These primers minimize the influence of plant host DNA. After purification, the PCR amplification products were sequenced at both ends (PE 2×250 bp) using the Illumnia novaseq6000 sequencing platform by Beijing Biomarker Biotechnology Co., Ltd.

[0039] Amplicon sequences were analyzed using the "DADA2" package in R software (R Foundation for Statistical Computing, Vienna, Austria), and the quality of the amplicon sequences was detected using the "plotQualityProfile" command. Finally, the sequences were filtered, pruned, and truncated, and amplicon sequence variants (ASVs) were identified by reading at 210 bp in both the forward and reverse directions. Mitochondrial and chloroplast ASVs were removed before statistical analysis, and species annotation of ASVs was performed using the SILVA database.

[0040] Based on amplicon data, a comparative analysis was conducted on the microorganisms that significantly enriched in the rhizosphere and roots of maize under the raised-mulch and conventional flat-planting methods, and microorganisms with relative abundances below 1% were removed. The final determination was... Klebsiella and Pseudomonas Two key bacterial genera that significantly enriched in the rhizosphere and roots of maize ( Figure 1 The specific manifestations are as follows: (1) Compared with the root zone soil, the rhizosphere soil contains Klebsiella and Pseudomonas The relative abundance of [unclear] increased by 18.88% and 2.81% respectively, and the abundance in the rhizosphere increased by 24.05% and 10.76% respectively; (2) compared with flat planting, the abundance of [unclear] in the rhizosphere increased by 18.88% and 2.81% respectively under the ridge-mulching method. Klebsiella The relative abundance increased by 11.11%, root abundance Pseudomonas The relative abundance increased by 2.05%. Therefore, subsequent targeted screening from the rhizosphere and roots of maize was conducted using pure culture methods. Klebsiella and Pseudomonas .

[0041] 2) Screening of culturable strains in the rhizosphere and roots Weigh 5 g of rhizosphere soil sample and add sterile water at a water-to-soil ratio of 10:1. Shake at 30°C and 150 rpm for 30 min to ensure complete mixing of the soil sample with sterile water. Extract the soil suspension and perform serial dilutions to obtain 10... -3 -10 -7 Soil suspension with dilution gradient. Take 150 μL of soil suspension with a dilution gradient of 10. -3 10 -4 10 -5 10 -6 10 -7 Soil suspensions were spread onto cooled LB and Ashby agar plates, with each dilution gradient repeated three times.

[0042] To obtain root endophytic bacteria, cleaned and sterilized roots were placed in PBS buffer and crushed on ice using a sterile pestle. Root debris was then removed through a 70 μm cell filter, and the filtrate was diluted at a ratio of 10:10. -2 Up to 10 -4 Dilute according to the specified ratio. Take 150 μL of each dilution gradient and spread it onto cooled LB medium and Ashby medium plates, respectively. Repeat the spread for each dilution gradient 3 times.

[0043] LB medium: 10.0 g tryptone, 5.0 g yeast extract, 10 g sodium chloride, 20 g agar, distilled water to a final volume of 1 L, sterilized at 121°C for 20 min.

[0044] Ashby medium: 10.0 g glucose, 0.2 g potassium dihydrogen phosphate, 0.2 g calcium sulfate, 0.2 g sodium chloride, 0.2 g calcium carbonate, 0.2 g magnesium sulfate, 20 g agar, distilled water to a final volume of 1 L, sterilize at 121°C for 20 min.

[0045] Plates were incubated upside down in a 30°C incubator for 48 h. Single colonies formed on LB and Ashby media were selected and purified using the streak plating method to obtain rapidly growing, morphologically diverse, single typical colonies. Through multiple subculturings, strains with good growth and stable morphology were screened for subsequent research experiments. The 16S rRNA gene of the strains was amplified and sequenced using universal primers 27F (5′-AGAGTTTGATCMTGGCTCAG-3′; SEQ ID NO.3) and 1492R (5′-GGTTACCTTGTTACGACTT-3′; SEQ ID NO.4) to clarify their taxonomic position. Five strains were ultimately obtained. Klebsiella Four plants, numbered D9, D10, L18, A9, and YCMR11. Pseudomonas The strains were numbered D49, D52, MR464, and MR487. The obtained strains were added to an appropriate amount of glycerol (final concentration 20–30%), mixed well, and stored at -80°C.

[0046] Klebsiella sp. YCMR11 and Pseudomonas sp . See the colony morphology of MR464 on LB agar plates. Figure 2 .

[0047] Klebsiella sp . YCMR11 and Pseudomonas sp . See the phylogenetic tree of MR464. Figure 3 .

[0048] Klebsiella sp . The 16S sequence of YCMR11 is shown in SEQ ID NO.5.

[0049]

[0050] Pseudomonas sp . The 16S sequence of MR464 is shown in SEQ ID NO.6.

[0051]

[0052] 3) Microbial functional identification and analysis Of the 5 selected plants Klebsiella and 4 strains Pseudomonas The functional identification analysis is performed as follows: The strain was inoculated into R2A liquid medium and grown in a shaker at 28°C and 180 rpm until the bacterial culture reached OD. 600 It is 1.0.

[0053] (1) Phosphorus solubilization function In a clean bench, 5 μL of bacterial suspension was dropped onto the prepared organic and inorganic phosphorus solid culture media of *Montagna montana*. This was repeated 4 times. The media were left to stand at room temperature for 10 min. Then, all the plates were inverted and incubated in a constant temperature incubator at 28°C for 7 days. During the incubation period, the growth of colonies in the plates and the presence or absence of phosphate-solubilizing zones were observed. The presence of phosphate-solubilizing zones indicated that the strain had phosphate-solubilizing ability. Figure 4 ).

[0054] (2) Iron-producing carrier In a clean bench, drop 5 μL of bacterial suspension onto the prepared CAS detection medium, repeat 4 times, and incubate at room temperature for 10 min. Then, invert all plates and incubate at 28℃ for 7 days. During the incubation period, observe the growth of colonies on the plates and whether a yellow halo appears. The appearance of a yellow halo indicates that the strain has the ability to produce siderophores. Figure 4 ).

[0055] (3) Dehydrocellulose Take 5 μL of bacterial suspension and drop it onto the prepared cellulose Congo red solid medium. Repeat 4 times. Incubate at room temperature for 10 min, then invert all plates and incubate at 28℃ for 7 days. After incubation, add 1 mg / mL Congo red staining solution to cover the entire plate. After staining for 20 min, discard the staining solution and add 1 mol / L sodium chloride solution to cover the entire plate. Elute for 10 min, then discard the NaCl solution. Repeat the elution step several times until a yellow halo can be observed. The presence of a yellow halo indicates that the strain has the ability to dissolve cellulose. Figure 4 ).

[0056] (4) Production of longin (IAA) function The bacterial culture was inoculated at a 1% inoculum in Kings medium supplemented with 0.2 g / L tryptophan, with three replicates for each strain. The cultures were incubated at 28°C and 180 rpm in a shaker. After 3 days of culture, the cultures were centrifuged at 12000 rpm for 10 min. 200 μL of the supernatant was transferred to a white porcelain plate, and an equal volume of Salkowski reagent was added. The plate was then covered with aluminum foil and reacted in the dark for 30 min. A positive result was observed as a pink color, indicating that the strain could secrete IAA. The deeper the pink color, the stronger the IAA secretion ability of the strain. Figure 4 ).

[0057] (5) Nitrogen fixation function By strain nifH Gene (sequence shown in SEQ ID NO.7) amplification is used to ensure that the strain has nitrogen-fixing ability. nifH The target DNA fragment is approximately 340 bp. The amplification primers are POLF (5′-TGCGAYCCSAARGCBGACTC-3′; SEQ ID NO.8) and AQER (5′-GACGATGTAGATYTCCTG-3′; SEQ ID NO.9).

[0058] TGCGATCCGAAAGCGGATTCCACCCGTCTGATCCTCCACGCTAAAGCCCAGAACACCATCATGGAGATGGCGGCGGAAGTGGGCTCGGTCGAGGATCTGGAGCTCGAAGACGTTCTGCAAATCGGCTATGGCGATGTCCGTTGCGCCGAATCCGGCGGCCCGGAGCCAGGC GTCGGCTGCGCCGGACGCGGGGTGATCACCGCCATCAACTTCCTCGAGGAAGAAGGCGCCTATGAAGAAGATTTGGATTTCGTCTTCTATGACGTCCTCGGCGACGTGGTCTGCGGCGGCTTCGCCATGCCGATCCGCGAAAACAAAGCCCAGGAGATCTACATCGTC; SEQ ID NO.7.

[0059] PCR amplification system: 12.5 μL 2×Taq MasterMix, 1 μL POLF, 1 μL AQER, 2.5 μL bacterial culture, 8 μL ddH2O. Amplification conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; final extension at 72℃ for 5 min; storage at 16℃.

[0060] Add 4S Red Plus nucleic acid staining agent to a 1% agarose gel and perform electrophoresis. If the target band is present at 340 bp, it can be preliminarily determined that the strain has nitrogen-fixing ability. Figure 5 ).

[0061] The results of the identification and analysis of the growth-promoting functions of candidate strains screened in the rhizosphere and roots of maize are shown in Table 1.

[0062] Table 1. Functional Identification and Analysis of Microorganisms in the Rhizosphere and Roots of Maize

[0063] Example 2: Pot experiment to verify the growth-promoting function of single-strain fungi (1) Preparation of bacterial culture The bacterial suspensions of each strain stored at -80℃ were inoculated into 100 mL of LB medium for activation. The culture was carried out at 28℃ and 180 rpm for 2–3 days. The bacterial cells were collected by centrifugation at 6000 r / min for 5 min at 4℃, resuspended in sterile water, and finally the OD of the bacterial suspension was adjusted. 600 A concentration of 0.8 was used for potted inoculation.

[0064] (2) Germination of corn seeds Corn seeds (Lidan 22) were disinfected with 75% (volume fraction) ethanol for 2 min, then with 0.5% (mass fraction) sodium hypochlorite for 20 min, and finally rinsed 4 times with sterile water. The seeds were wrapped in moistened sterile filter paper and placed in an incubator at 30℃ and 65% relative humidity in the dark until germination (approximately 36 h).

[0065] (3) Inoculate the corn root system with bacterial solution Farmland soil was sieved through a 2 mm sieve and placed in sterilized flowerpots with a diameter of 10 cm, each containing 0.5 kg of soil. The soil was incubated in the dark for 48 h to stabilize the soil microorganisms. Germinated maize seeds were sown in the flowerpots, with 3 seeds per pot and 6 replicates per inoculation treatment. 5 mL of bacterial solution was inoculated into the rhizosphere of each maize pot on days 3 and 7 of growth. Samples were collected after 20 days of growth, and chlorophyll content, plant height, stem diameter, root dry weight, and plant dry weight were measured. The results are shown in Table 2.

[0066] Table 2. Growth-promoting effects of single inoculation with the screened target strains on maize.

[0067] The results in Table 2 are combined with those in Table 1. Klebsiella sp . YCMR11 compared to others KlebsiellaWith a more comprehensive spectrum of growth-promoting functional traits, it may be able to meet the diverse nutrient requirements of crops at different growth stages in field applications. Therefore, it was selected as the preferred strain for field validation and subsequent development. Compared with the control (Ctrl: inoculated with an equal volume of sterile water), Klebsiella sp . YCMR11 significantly increased maize chlorophyll content, plant height, and stem diameter (Table 2 and ). Figure 6 ). Pseudomonas sp . Both MR464 and MR487 significantly increased maize chlorophyll content, plant dry weight, plant height, and stem diameter; given that Pseudomonas sp . MR464 has a faster growth rate, which is conducive to rapid establishment and stable survival in the field. Therefore, it was identified as a candidate strain for the subsequent construction of compound microbial agents.

[0068] Example 3: The target strain's ability to produce biofilm and inhibit plant pathogenic fungi. (1) Preparation of bacterial culture The bacterial culture was prepared in accordance with Implementation Case 2.

[0069] (2) Bacterial biofilm production ability The bacterial culture was inoculated into eight-linked ELISA strips (UG008, Microk Biotechnology Co., Ltd., Xi'an) that had been soaked in alcohol, sterilized by ultraviolet light, and dried. The inoculation volume was as follows: bacterial culture: LB liquid medium = 1:2 (70 μL, 140 μL). The strips were placed in petri dishes, sealed, and incubated statically in an incubator. Subsequent experiments were conducted on days 2, 4, and 6 after inoculation. The culture medium was slowly aspirated from the wells of the ELISA strips using a disposable syringe and washed twice with purified water to remove unattached airborne bacteria and residual culture medium. 200 μL of 0.1% crystal violet staining solution was added to each well, and staining was performed for 30 minutes. The crystal violet staining solution was removed, and excess unbound staining agent was washed away with purified water. 200 μL of 33% glacial acetic acid was added to each well to dissolve the crystal violet bound to the biofilm. The absorbance at a specific wavelength (595 nm) was measured using a spectrophotometer to reflect the amount of biofilm. Figure 7 ).

[0070] (3) Preparation of pathogenic fungal spore liquid Five pathogenic fungi (Fusarium) were selected and inoculated into 100 mL of PDB medium. The cultures were incubated at 30°C and 180 rpm for 4–6 days. The spore suspension was collected by filtration through sterile gauze, and the fungal spore count was adjusted to 10-1. 6 -10 7 spores / mL.

[0071] (4) Plate confrontation between bacteria and pathogenic fungi In a clean bench, drop 5 μL of fungal spore suspension into the center of the prepared PDA medium. Place 5 μL of bacterial suspension on each side, 3 cm from the center of the plate. Incubate at 30°C for one week and record the fungal growth. Figure 8 ).

[0072] Figure 7 and Figure 8 show Klebsiella sp . YCMR11 and Pseudomonas sp . Both MR464 strains exhibit a strong ability to produce biofilms; furthermore, both strains can inhibit typical pathogenic fungi of gramineous crops, among which... Klebsiella sp . YCMR11 has stronger antibacterial properties.

[0073] Example 4 Field inoculation experiment of compound microbial agent Bacterial antagonism and blood agar plate test: Take samples stored at -80℃ Klebsiella sp . YCMR11 and Pseudomonas sp . MR464 was inoculated into 100 mL of LB medium for activation and cultured at 28°C and 180 rpm for 48 h in a shaker. The OD of the bacterial culture was then adjusted. 600 The concentration was 0.8. 5 μL of each strain was inoculated into the same LB solid medium, and the two strains were streaked perpendicularly to each other. Figure 9 As shown. Incubate at 28℃ for 24 h, and observe whether there is an inhibition zone on the plate. If an inhibition zone appears, it indicates that the two strains have an antagonistic effect.

[0074] Take 5 μL of bacterial suspension and inoculate it into a blood agar plate. Incubate at 28°C for 24 h and observe whether there is a hemolytic zone on the plate. If a transparent or translucent hemolytic zone appears, it indicates that the strain has hemolytic ability. When inoculating field crops, strains with hemolytic function should be avoided.

[0075] Through antagonistic experiments ( Figure 9 ) and blood plate test ( Figure 10 )right Klebsiella sp . YCMR11 and Pseudomonas sp . Evaluation of MR464 showed that there was no antagonistic effect between the two strains and neither had hemolytic function, which met the requirements for subsequent field inoculation experiments.

[0076] Stored at -80℃ Klebsiella sp . YCMR11 and Pseudomonas sp .The bacterial suspension of MR464 was inoculated into LB medium for activation, cultured at 28°C and 180 rpm for 2–3 days, centrifuged at 6000 r / min for 5 min to collect the bacterial cells, resuspended in sterile water, and finally the OD of the bacterial suspension was adjusted. 600 0.8 is used for subsequent field intercropping.

[0077] Field experiments were conducted in Ganjing Town, Heyang County, Weinan City, Shaanxi Province (where the rainfall during the maize growing season was 135.1 mm, classified as extreme drought) and Wujinshan Town, Yuci District, Jinzhong City, Shanxi Province (where the rainfall during the maize growing season was 385.7 mm). Both experimental sites were planted in early May 2025 and matured in early October. All treatments were carried out under a raised-furrow tillage pattern (ridge-to-furrow ratio of 70 cm:40 cm, ridge height: 15 cm). Basal fertilizer was applied before tillage at a rate of 50 kg / mu (the fertilizer application rate was consistent with local farmers' practices: Ganjing Town, Heyang County: N: 2.5 kg / mu, P: 2.5 kg / mu, K: 5 kg / mu; Wujinshan Town, Yuci District: N: 9 kg / mu, P: 9 kg / mu, K: 9 kg / mu). No additional irrigation was administered during the maize's growth period. The control group (Ctrl) was inoculated with an equal volume of sterile water and a single inoculation... Klebsiella sp . YCMR11 and Pseudomonas sp . MR464 and inoculation with compound microbial agents were used in a randomized block design with four replicates in each treatment plot. The planting density of maize (Heyang: Lidan 22; Yuci: Qiangsheng 370) in the experimental plots was 4500 plants / mu. After planting, 5 mL of sterile water, single-strain suspension, and an equal volume of mixed bacterial solution were inoculated at the root of each maize plant at the seedling stage (about 25 days after emergence) and the jointing stage (about 60 days after emergence). After the maize matured, it was harvested, and root-related indicators, yield, and water use efficiency were measured.

[0078] (1) Effects of compound microbial agents on maize root growth Compared with the control group (Ctrl), Klebsiella sp . YCMR11 Pseudomonas sp . Both MR464 and the compound microbial inoculant increased the dry weight of maize roots, the diameter of aerial roots, and the number of aerial roots embedded in the soil (Table 3). The results indicate that the application of the compound microbial inoculant significantly promoted maize root growth, optimized root architecture, and significantly increased the number and diameter of aerial roots, thereby effectively improving the plant's lodging resistance. Furthermore, inoculation with the compound microbial inoculant significantly increased the number and diameter of xylem vessels in the aerial roots (Table 4). Figure 11 This enhances the corn plant's ability to transport water and nutrients.

[0079] Table 3. Effects of compound microbial inoculants on maize root growth in the field.

[0080] Table 4. Effects of compound microbial inoculants on the development of aerial root structure during the silking stage of maize in the field.

[0081] (2) Effects of compound microbial agents on maize yield and water use efficiency The yield and soil moisture content of each treatment were measured, and the water use efficiency of maize was calculated based on precipitation during the growth period (Table 5). The results showed that under extreme drought conditions without supplemental irrigation and with sufficient precipitation, maize ears inoculated with the compound microbial agent exhibited more uniform and better ear growth compared to the control group. Figure 12 Furthermore, the yield of corn increased by 28.78% (Ganjing Town, Heyang County) and 35.48% (Wujinshan Town, Yuci District), respectively, and the water use efficiency increased by 0.55 kg / mm / mu (Ganjing Town, Heyang County) and 0.57 kg / mm / mu (Wujinshan Town, Yuci District), respectively. Inoculation with two strains of microorganisms alone also significantly improved water use efficiency and yield, but still lagged behind the effect of the compound microbial agent. Under drought conditions, it is difficult to improve water use efficiency by 0.2-0.3 kg / mm / mu, indicating that the compound microbial agent has great potential in improving corn water use efficiency. In contrast, the control group showed poor growth due to water shortage, resulting in uneven ear growth. Corn inoculated with the compound microbial agent exhibited a more balanced and healthy growth under these conditions, indicating that the compound microbial agent can effectively improve corn water use efficiency and drought resistance, thereby increasing overall yield. In conclusion, corn inoculated with the compound microbial agent achieved stable yields under drought conditions and further increased yields when rainfall was abundant.

[0082] Table 5. Effects of compound microbial inoculants on maize yield and water use efficiency in the field.

[0083] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A compound microbial inoculant suitable for rain-fed agriculture's ridging and mulching model, characterized in that, Depend on Klebsiella sp . YCMR11 bacterial suspension and Pseudomonas sp . It was prepared by mixing equal volumes of MR464 bacterial suspension; The Klebsiella sp . YCMR11 bacterial suspension and Pseudomonas sp . OD of MR464 bacterial suspension 600 All are 0.6-0.8; The Klebsiella sp . YCMR11 has the accession number CCTCC NO: M2026620; The Pseudomonas sp . The accession number for MR464 is CCTCC NO: M2026619.

2. The application of the compound microbial agent according to claim 1 in promoting maize growth, root development and water use efficiency in arid areas.

Images