A Bacillus thuringiensis, an insecticidal protein and its application

Abstract

This invention relates to the field of biological pest control technology, and particularly to a Bacillus thuringiensis, an insecticidal protein, and their applications. The Bacillus thuringiensis CZ437 provided by this invention can produce a protein with high insecticidal activity against Coleoptera insects. Its cell crystal mixture can efficiently kill Coleoptera insects such as the two-spotted leaf beetle, and can be used as an insecticide or for the preparation of insecticides. The Vpb4Ea1 protein provided by this invention can effectively kill Coleoptera insects, showing particularly excellent insecticidal activity against the two-spotted leaf beetle. The Bacillus thuringiensis and insecticidal protein provided by this invention offer an insecticide with application value for the biological control of Coleoptera insects, and the encoding gene of the insecticidal protein provides an effective genetic resource for the breeding of insect-resistant plants.

Description

Technical Field

[0001] This invention relates to the field of biological pest control technology, and in particular to a Bacillus thuringiensis, an insecticidal protein, and their applications. Background Technology

[0002] Bacillus thuringiensis (Bt) is widely found in natural environments such as soil, water, insects, and plant leaves. It is a Gram-positive bacterium belonging to the Bacillus cereus group. This bacterium exhibits insecticidal activity against a variety of insects, including Lepidoptera, Coleoptera, Hymenoptera, and Diptera, as well as mites and nematodes (Luo et al., 2013; Jouzani et al., 2017), making it valuable for pest control. During its growth, Bt produces insecticidal proteins, which can be categorized according to different growth stages: insecticidal crystal proteins (ICPs) produced during the stable late-stage spore formation, including Cry and Cyt proteins (Schnepf et al., 1998); and Vip (Vegetative Insecticidal Proteins) proteins (Estruch et al., 1996) and secreted Sip proteins (Donovan et al., 2006) produced during the vegetative growth stage. Currently, Bt proteins Cry3 (Yu et al., 2016), Cry5, Cry7, Cry8 (Park et al., 2014), the Vip1 / Vip2 protein family (Bi et al., 2015), and Vpb4 have been reported to have insecticidal activity against Coleoptera pests.

[0003] There are currently few reports on Vpb4 proteins. The Vpb4Da2 protein has four domains: a PA14 domain; and Binary_toxB, toxB_2, and toxB_3 domains. Yin et al. found that Vpb4Da2 has specific insecticidal activity against the maize root leaf beetle (Diabrotica virgifera), with a protein concentration of 31.25 μg / cm³. 2At the same time, this protein exhibits strong growth inhibition and high insecticidal activity against the larvae of the maize root leaf beetle. Planting Vpb4Da2 transgenic maize reduced root damage caused by the maize root leaf beetle larvae and decreased the survival and emergence rates of the beetle (Yin et al., 2020). Studies by Kouadio et al. found that feeding Vpb4Da2 protein caused pathological damage to the midgut epithelial cells of the maize root leaf beetle, resulting in the breakage of microvilli at the cell apex, vacuolation of the cytoplasm, and the detachment of intestinal wall cells into the intestinal lumen (Kouadio et al., 2021).

[0004] Coleoptera (coleoptera) include many important pests in agriculture, forestry, fruit trees, and horticulture, causing damage to a variety of plants, including corn, vegetables, and fruits. The two-spotted firefly beetle (Monoleptahieroglyphica (Motschulsky)) is one such Coleoptera insect. In recent years, the area and extent of damage caused by the two-spotted firefly beetle have continued to expand, making it one of the most important pests of crops such as corn in many regions (Feng et al., 2020). This insect is widely distributed and is a polyphagous pest with a broad host range, mainly damaging plants of the Poaceae, Brassicaceae, and Leguminosae families. It is characterized by its diverse species, gregarious behavior, long period of damage, rapid reproduction, and short-distance migration. Both the larvae and adults of the two-spotted leaf beetle cause serious damage to corn. The larvae live in the soil and feed on the corn roots. The adults tend to cluster together and feed on the corn leaves, generally from top to bottom, forming white net-like spots and holes, which affects the corn's photosynthesis. After the corn tassels emerge and silks are produced, they gather on the ears and feed on the silks and tender kernels, seriously affecting the normal pollination and grain filling of the corn. In severe cases, the damage can cause large-scale yield reduction or even crop failure.

[0005] Currently, chemical control remains the primary method for controlling the two-spotted leaf beetle. Effective chemical pesticides include lambda-cyhalothrin, thiamethoxam, chlorpyrifos, and fipronil. However, long-term overuse of chemical pesticides carries risks such as environmental pollution and the development of pesticide resistance in target pests. There are few reports on biological control of the two-spotted leaf beetle. Effective biological pesticides include abamectin and Metarhizium anisopliae CQMa421 (Chang et al., 2022; Chen et al., 2021). No effective insecticidal genes have yet been reported. Summary of the Invention

[0006] This invention provides Bacillus thuringiensis, an insecticidal protein, and their applications.

[0007] This invention isolates a Bacillus thuringiensis strain, named IPPBiotCZ437. This strain produces an insecticidal protein with highly effective killing effect against Coleoptera insects (especially the two-spotted leaf beetle). This strain, its produced protein, or a mixture of the strain and the protein can be used as an insecticidal active ingredient for the control of Coleoptera insects (especially the two-spotted leaf beetle). Furthermore, this invention isolates a highly active insecticidal protein from this strain and constructs a protein mutant with significantly enhanced insecticidal activity based on this insecticidal protein.

[0008] Specifically, the present invention provides the following technical solutions.

[0009] This invention provides Bacillus thuringiensis IPPBiotCZ437, which was deposited on January 17, 2025, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), classified and named Bacillus thuringiensis, with accession number CGMCC No. 33455.

[0010] The secretory protein of Bacillus thuringiensis IPPBiotCZ437 (hereinafter referred to as CZ437) has highly efficient insecticidal activity and can effectively control Coleoptera insects. It is particularly effective against the two-spotted leaf beetle. The culture (cell crystal mixture) obtained by culturing Bacillus thuringiensis CZ437 can be used as an insecticidal active ingredient to control Coleoptera insects such as the two-spotted leaf beetle.

[0011] Based on Bacillus thuringiensis CZ437, the present invention also provides a derivative strain of this strain, specifically a derivative strain of Bacillus thuringiensis CZ437 obtained by genetic modification.

[0012] The aforementioned genetic modification refers to improving the Bacillus thuringiensis CZ437 strain by altering its genetic material. This genetic modification includes gene engineering; preferably, it involves introducing functional genes into the Bacillus thuringiensis CZ437.

[0013] The aforementioned functional genes include at least one of the following: insecticide gene, pathogen resistance gene, insecticidal synergistic gene, and pathogen resistance synergistic gene.

[0014] Existing technologies include examples of constructing genetically engineered strains by introducing functional genes into Bacillus thuringiensis, which possesses insecticidal activity. For instance, to expand the insecticidal spectrum of Bacillus thuringiensis, insecticidal proteins not naturally present in the strain are introduced. Ensuring the activity of the introduced functional genes using conventional techniques such as genetic engineering is easily achievable. Therefore, obtaining derivative strains of the aforementioned introduced functional genes based on the Bacillus thuringiensis CZ437 of this invention presents no obstacle, and their effects are predictable. Exemplary insecticidal genes include the Vip gene and the Cry gene.

[0015] This invention provides a microbial preparation comprising any one or more of the following: (1) Bacillus thuringiensis CZ437 or the Bacillus thuringiensis mentioned above; (2) Bacillus thuringiensis CZ437 or the freeze-dried cells, bacterial solution, supernatant after centrifugation of the bacterial solution, or the precipitate resuspension after centrifugation of the bacterial solution as described above; (3) The formulation prepared by (1) and / or (2) above.

[0016] Preferably, in the microbial preparation, the Bacillus thuringiensis CZ437 or its derivative strains exist in the form of vegetative cells or spores.

[0017] Preferably, the microbial preparation comprises one or more selected from the Bacillus thuringiensis CZ437, the derived strain, its extracellular secretions, and culture supernatant.

[0018] The microbial preparation may be a liquid or solid formulation. Depending on the type of formulation, the microbial preparation may also contain excipients permitted in the field of microbial preparations, such as lyophilization protectants.

[0019] The present invention also provides a composition comprising any one or more of the following: Bacillus thuringiensis CZ437, the derived strain, lyophilized cells of Bacillus thuringiensis CZ437, bacterial suspension, supernatant after centrifugation of bacterial suspension or precipitate resuspension after centrifugation of bacterial suspension, lyophilized cells of the derived strain, bacterial suspension, supernatant after centrifugation of bacterial suspension or precipitate resuspension after centrifugation of bacterial suspension; (1) Nutrient cells; (2) At least one Vpb4 protein; (3) Secretory proteins, which are not bactericidal crystal proteins; (4) Crystal; (5) Crystalline proteins; (6) Bacterial cells containing spores; (7) Spores.

[0020] These vegetative cells, unlike buds, are vegetative bodies with normal growth and metabolic functions.

[0021] In some specific embodiments of the present invention, the composition comprises the vegetative cells and amorphous secretory proteins of the Bacillus thuringiensis.

[0022] In some specific embodiments of the present invention, the composition comprises vegetative cells of the Bacillus thuringiensis and at least one Vpb4 protein.

[0023] The above composition has high activity in killing Coleoptera insects, especially the two-spotted leaf beetle.

[0024] Based on the above-mentioned Bacillus thuringiensis, the present invention provides an insecticide comprising an insecticidal active ingredient and excipients, wherein the insecticidal active ingredient comprises the microbial preparation or the composition.

[0025] The insecticidal active ingredient may also include other insecticidal proteins, insecticidal microorganisms, or chemical insecticides.

[0026] The excipients in the above-mentioned insecticides can be any excipient permitted in the field of insecticides. The required excipients can be selected based on the formulation of the insecticide, which can be a powder, granule, pill, pellet, spray, emulsion, colloid, or solution, etc.

[0027] The present invention provides a method for preparing a mixture of cell crystals of Bacillus thuringiensis CZ437 or its derivative strains, the method comprising: culturing the Bacillus thuringiensis to bring it into the vegetative growth phase, and collecting the culture.

[0028] Preferably, the cellular mixture comprises bacterial cells and extracellular secreted proteins of the Bacillus thuringiensis. The cellular mixture may also contain culture medium components used for culturing.

[0029] Preferably, the culture is performed using a solid culture medium. For example, 1 / 2 LB solid culture medium is used. The culture time is 40-55 hours. The culture temperature is 28-32°C.

[0030] In some embodiments of the present invention, the method includes: (1) The Bacillus thuringiensis was cultured in LB liquid medium at 28-32℃ and 200-220 rpm / min for 8-14 h; (2) Inoculate the bacterial culture obtained in step (1) onto 1 / 2 LB solid medium and incubate at 28-32℃ and 200-220 rpm / min for 40-55 h; (3) Collect the culture from the solid culture medium in step (2) and resuspend it in water.

[0031] Based on the function of Bacillus thuringiensis CZ437, the present invention provides any one of the following applications of Bacillus thuringiensis CZ437 or its derivative strains, or the microbial preparation, or the composition, or the insecticide: (1) Control of Coleoptera insects; (2) Kill Coleoptera insects; (3) Prepare products for the control of Coleoptera insects; (4) Prepare products for killing Coleoptera insects.

[0032] In the above applications, the products include, but are not limited to, biological control agents such as insecticides.

[0033] The present invention further isolated an insecticidal protein from Bacillus thuringiensis CZ437 and named it Vpb4Ea1 protein. This protein has high killing activity against Coleoptera insects (especially the two-spotted leaf beetle). The amino acid sequence of this protein has only 63.80% similarity to the previously reported Vpb4Da2 protein.

[0034] This invention provides any of the following applications of the Vpb4Ea1 protein, a nucleic acid molecule encoding the Vpb4Ea1 protein, or biological materials containing said nucleic acid molecule: (1) Control of Coleoptera insects; (2) Kill Coleoptera insects; (3) Prepare products for the control of Coleoptera insects; (4) Prepare products for killing Coleoptera insects; (5) Prepare insect-resistant transgenic plants, wherein the insect is a Coleoptera insect; The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

[0035] In the above applications, the products include, but are not limited to, biological control agents such as insecticides.

[0036] In the above applications, the insect-resistant transgenic plants exhibited improved or enhanced resistance to Coleoptera insects. These insect-resistant transgenic plants were obtained by introducing a nucleic acid molecule encoding the Vpb4Ea1 protein.

[0037] The nucleic acid molecule encoding the Vpb4Ea1 protein can be DNA or RNA. Given the known amino acid sequence of the Vpb4Ea1 protein, the nucleotide sequence of the nucleic acid molecule encoding the Vpb4Ea1 protein can be obtained according to codon rules. For example, the nucleic acid molecule is DNA, and its nucleotide sequence is shown in SEQ ID NO.2. This sequence is a gene sequence derived from Bacillus thuringiensis. When introducing this gene into other host cells, the gene sequence can be codon-optimized according to the codon preferences of that host.

[0038] In the above applications, the biomaterial is any one of the following (1)-(5): (1) A DNA construct containing a nucleic acid molecule encoding the Vpb4Ea1 protein; (2) A vector containing a nucleic acid molecule encoding the Vpb4Ea1 protein or the DNA construct described in (1); (3) Microorganisms containing a nucleic acid molecule encoding the Vpb4Ea1 protein or the DNA construct described in (1) or the vector described in (2); (4) A plant cell containing a nucleic acid molecule encoding the Vpb4Ea1 protein or the DNA construct described in (1) or the vector described in (2); (5) A plant tissue, plant organ or plant containing a nucleic acid molecule encoding the Vpb4Ea1 protein or the DNA construct described in (1) or the vector described in (2).

[0039] In this invention, the DNA construct comprises a nucleic acid molecule encoding the Vpb4Ea1 protein and a 5' and / or 3' regulatory sequence effectively linked thereto, wherein the regulatory sequence includes a promoter, transcription start site, activator, enhancer, other regulatory elements, ribosome binding site, start codon, termination signal, etc. The DNA construct may also contain at least one additional gene or sequence fragment to be co-transformed into an organism. Exemplarily, the DNA construct is an expression cassette.

[0040] In this invention, the vector includes plasmids, viruses, artificial chromosomes, transposons, etc. The microorganisms include, but are not limited to, *Escherichia coli*, *Agrobacterium*, etc. The microorganisms include bacteria, algae, and fungi. Exemplary bacteria include Enterobacteriaceae, such as *Escherichia*, *Salmonella*, and *Proteus*; Bacillaceae; Rhizobiaceae, such as *Rhizobium*; Pseudomonadaceae, such as *Pseudomonas* and *Acetobacter*; and *Agrobacterium*, such as *Agrobacterium tumefaciens* and *Agrobacterium rhizogenes*. Exemplary fungi include yeasts, such as *Pichia pastoris*. By using existing methods, nucleic acid molecules encoding the Vpb4Ea1 protein are introduced into microbial hosts under conditions that allow for stable maintenance and expression of the gene (e.g., by constructing expression cassettes).

[0041] In this invention, the plants are plants of the Poaceae family (e.g., corn, wheat, rice, barley, oats, rye, sorghum, Job's tears, Sudan grass, foxtail grass, foxtail grass, miscanthus, reed, bamboo, sugarcane), Brassicaceae family (e.g., Chinese cabbage, radish, cabbage, broccoli, rapeseed, woad), or Leguminosae family (e.g., soybean, mung bean, red bean, black bean, broad bean, pea, alfalfa, clover, wisteria, licorice, astragalus, cassia seed, kudzu root, albizia, soapberry).

[0042] In this invention, the Coleoptera insects include Chrysomelidae, Scarabaeidae, Cerambycidae, Curculionidae, Coccinellidae, Elateridae, Meloidae, Hispidae, Rutelidae, Scolytidae, and Cerophytidae. Chrysomelidae insects are preferred, and more preferably, the two-spotted leaf beetle, the corn root leaf beetle, the potato beetle, the ten-spotted ladybug, the yellow-striped flea beetle, or the malignant leaf beetle.

[0043] This invention has found that Vpb4Ea1 protein exhibits particularly strong insecticidal effects against the two-spotted leaf beetle. Treatment of adult two-spotted leaf beetles with Vpb4Ea1 protein (40 μg / mL) resulted in a corrected mortality rate as high as 85.2%, LC50. 50The LC50 concentration for the two-spotted leaf beetle larvae was 9.93 μg / mL. 50 It is 6.05 μg / g.

[0044] Based on the wild-type Vpb4Ea1 protein provided above, the present invention also provides a Vpb4Ea1 protein mutant, which, compared with the wild-type Vpb4Ea1 protein, contains one or more amino acid mutations; the insecticidal activity of the Vpb4Ea1 protein mutant is thus enhanced; wherein the wild-type Vpb4Ea1 protein has the amino acid sequence shown in SEQ ID NO.1.

[0045] Preferably, the mutant contains a mutation of 1 to 20 amino acids relative to the wild-type Vpb4Ea1 protein. For example, it contains mutations of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0046] Based on the mutant, the present invention also provides a fusion protein comprising the Vpb4Ea1 protein mutant described above.

[0047] In addition to containing the Vpb4Ea1 protein mutant, the fusion protein also contains other polypeptides directly or indirectly linked to the Vpb4Ea1 protein mutant. These polypeptides can be protein tags (e.g., easily purified tag peptides), linker peptides (e.g., flexible linkers), or other polypeptides with insecticidal or antibacterial activity. Exemplarily, for ease of purification, a fusion protein is obtained by fusing the Vpb4Ea1 protein mutant of the present invention with a protein tag; or, to improve insecticidal activity or expand the range of insecticides, a fusion protein is obtained by fusing the Vpb4Ea1 protein mutant of the present invention with other proteins with insecticidal activity; or, to simultaneously impart antifungal activity, a fusion protein is obtained by fusing the Vpb4Ea1 protein mutant of the present invention with a protein with antifungal activity. Maintaining the original activity of the Vpb4Ea1 protein mutant in the fusion protein is easily achievable using known techniques or methods.

[0048] The present invention also provides a nucleic acid molecule encoding the Vpb4Ea1 protein mutant or the fusion protein.

[0049] The nucleic acid molecules described in this invention include DNA or RNA. Given the known amino acid sequence of the Vpb4Ea1 protein mutant or the fusion protein, the nucleotide sequence of the nucleic acid molecule encoding the aforementioned protein can be obtained based on codon rules. Due to codon degeneracy, the nucleotide sequence encoding a single amino acid sequence is not unique; all nucleic acid molecules capable of encoding the Vpb4Ea1 protein mutant or the fusion protein are within the scope of protection of this invention.

[0050] This invention provides biomaterials related to Vpb4Ea1 protein mutants, wherein the biomaterials are any one of the following (1)-(3): (1) A DNA construct containing the nucleic acid molecule; (2) A vector containing the nucleic acid molecule or the DNA construct described in (1); (3) A host cell containing the nucleic acid molecule or the DNA construct of (1) or the vector of (2).

[0051] The host cells mentioned above include microbial cells or plant cells. Preferably, the plant cells are plant cells that cannot develop into individual plants.

[0052] This invention provides a recombinant microorganism containing a nucleic acid molecule encoding Vpb4Ea1 protein, a Vpb4Ea1 protein mutant, or the fusion protein, or expressing Vpb4Ea1 protein, the Vpb4Ea1 protein mutant, or the fusion protein; wherein the Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 that has been substituted, deleted, and / or added to one or more amino acids and has similar activity.

[0053] The recombinant microorganisms described above are obtained by introducing nucleic acid molecules encoding the Vpb4Ea1 protein mutant or the fusion protein into microorganisms. Exemplarily, the nucleic acid molecule encoding the Vpb4Ea1 protein mutant or the fusion protein is placed on an expression vector and introduced into microorganisms. The microorganisms can be any microorganism suitable for protein expression, such as *Escherichia coli*, yeast, etc.

[0054] In some embodiments of the present invention, a recombinant Escherichia coli is provided that expresses the Vpb4Ea1 protein mutant or the fusion protein.

[0055] Based on the function of the Vpb4Ea1 protein mutant, the present invention provides any one of the following applications of the Vpb4Ea1 protein mutant, the fusion protein, the nucleic acid molecule, the biological material, or the recombinant microorganism: (1) Control of Coleoptera insects; (2) Kill Coleoptera insects; (3) Prepare products for the control of Coleoptera insects; (4) Prepare products for killing Coleoptera insects; (5) Prepare insect-resistant transgenic plants, wherein the insect is a Coleoptera insect.

[0056] Preferably, the Coleoptera insect is a Chrysomelidae insect, more preferably a two-spotted leaf beetle, a corn root leaf beetle, a potato beetle, a ten-spotted ladybug, a yellow-striped flea beetle, or a malignant leaf beetle.

[0057] The present invention provides an insecticidal composition comprising at least one selected from the following: the Vpb4Ea1 protein mutant, the fusion protein, the recombinant microorganism, Bacillus thuringiensis CZ437 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension, a derivative strain of Bacillus thuringiensis CZ437 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension.

[0058] This invention provides an insecticide comprising an insecticidal active ingredient and excipients. The insecticidal active ingredient comprises at least one selected from the following: the Vpb4Ea1 protein mutant, the fusion protein, the recombinant microorganism, Bacillus thuringiensis CZ437 or its freeze-dried cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension, or a derivative strain of Bacillus thuringiensis CZ437 or its freeze-dried cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension.

[0059] The insecticidal active ingredient may also include other insecticidal proteins, insecticidal microorganisms, or chemical insecticides.

[0060] The excipients in the above-mentioned insecticides can be any excipient permitted in the field of insecticides. The required excipients can be selected based on the formulation of the insecticide, which can be a powder, granule, pill, pellet, spray, emulsion, colloid, or solution, etc.

[0061] The above-mentioned insecticidal composition and insecticide are products targeting Coleoptera insects, and have excellent insecticidal activity, especially against the two-spotted firefly beetle.

[0062] This invention provides a method for controlling Coleoptera insects, the method comprising: bringing Coleoptera insects into contact with an effective amount of insecticidal active ingredient, or feeding Coleoptera insects an effective amount of insecticidal active ingredient; The insecticidal active ingredient comprises at least one selected from Vpb4Ea1 protein, the Vpb4Ea1 protein mutant, the fusion protein, Bacillus thuringiensis CZ437 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension or resuspension of precipitate after centrifugation of bacterial suspension, a derivative strain of Bacillus thuringiensis CZ437 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension or resuspension of precipitate after centrifugation of bacterial suspension, the microbial preparation, the composition, and the recombinant microorganism; The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

[0063] This invention provides a method for killing coleopteran insects, the method comprising: bringing the coleopteran insects into contact with an effective amount of an insecticidal active ingredient, or feeding the coleopteran insects an effective amount of an insecticidal active ingredient; The insecticidal active ingredient comprises at least one selected from Vpb4Ea1 protein, the Vpb4Ea1 protein mutant, the fusion protein, Bacillus thuringiensis CZ437 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension or resuspension of precipitate after centrifugation of bacterial suspension, a derivative strain of Bacillus thuringiensis CZ437 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension or resuspension of precipitate after centrifugation of bacterial suspension, the microbial preparation, the composition, and the recombinant microorganism; The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

[0064] The Vpb4Ea1 protein, Vpb4Ea1 protein mutant, fusion protein, Bacillus thuringiensis CZ437, its derivative strains, and recombinant microorganisms expressing Vpb4Ea1 protein, Vpb4Ea1 protein mutant, and fusion protein described in this invention all have the activity of killing Coleoptera insects, especially killing the two-spotted leaf beetle. Therefore, they can be used alone to control or kill Coleoptera insects. Mixtures of at least two of these proteins or strains can also be used to control or kill Coleoptera insects. For example, a mixture of cell crystals is used to control or kill Coleoptera insects.

[0065] In the above method, the Coleoptera insect is a Chrysomelidae insect, preferably a two-spotted leaf beetle, a corn root leaf beetle, a potato beetle, a ten-spotted ladybug, a yellow-striped flea beetle, or a malignant leaf beetle.

[0066] This invention provides a method for constructing an insect-resistant plant, the method comprising: causing the plant to express Vpb4Ea1 protein, the Vpb4Ea1 protein mutant, or the fusion protein; The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 that has been substituted, deleted, and / or added to one or more amino acids and has similar activity; the insect is a Coleoptera insect.

[0067] The Vpb4Ea1 protein and Vpb4Ea1 protein mutant genes provided by this invention can be used as effective insect-resistant genes to construct transgenic plants, thereby endowing the plants with enhanced insect resistance.

[0068] Preferably, the method includes: introducing a nucleic acid molecule encoding the Vpb4Ea1 protein, a mutant of the Vpb4Ea1 protein, or the fusion protein into a plant.

[0069] The aforementioned nucleic acid molecules can be introduced into plants alone or constructed into vectors for introduction into plants. Methods for introducing nucleic acid molecules or vectors containing said nucleic acid molecules into plants can be implemented using conventional methods in the art, including but not limited to Agrobacterium-mediated transformation, gene guns, microinjection, and electroporation.

[0070] The aforementioned plants are host plants for Coleoptera insects. The Coleoptera insects are preferably Chrysomelidae insects, more preferably *Dystrophus spp.*, *Cephalotaxus fortunei*, *Potato beetle*, *Cephalotaxus fortunei*, *Cephalotaxus fortunei*, *Cephalotaxus fortunei*, or *Cephalotaxus fortunei*.

[0071] Preferably, the plant is a member of the Poaceae, Brassicaceae, or Leguminosae family. The Poaceae family includes corn, sorghum, millet, wheat, rice, oats, Job's tears, Sudan grass, foxtail grass, foxtail grass, miscanthus, reeds, bamboo, and sugarcane; the Brassicaceae family includes Chinese cabbage, radish, cabbage, broccoli, rapeseed, and woad; the Leguminosae family includes soybean, mung bean, red bean, black bean, broad bean, pea, alfalfa, clover, wisteria, licorice, astragalus, cassia seed, kudzu root, albizia, and soapberry.

[0072] This invention provides a method for protecting plants from beetle insects, the method comprising: applying an insecticidally effective amount of an insecticidal active ingredient to the plant; the insecticidal active ingredient comprising at least one selected from Vpb4Ea1 protein, the Vpb4Ea1 protein mutant, the fusion protein, Bacillus thuringiensis CZ437 or its freeze-dried cells, bacterial suspension, supernatant after centrifugation of bacterial suspension or resuspension of the precipitate after centrifugation of bacterial suspension, a derivative strain of Bacillus thuringiensis CZ437 or its freeze-dried cells, bacterial suspension, supernatant after centrifugation of bacterial suspension or resuspension of the precipitate after centrifugation of bacterial suspension, the microbial preparation, the composition, and the recombinant microorganism; or, causing the plant to express Vpb4Ea1 protein, the Vpb4Ea1 protein mutant, or the fusion protein. The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

[0073] The present invention provides an insect-resistant plant that expresses Vpb4Ea1 protein, a mutant of the Vpb4Ea1 protein, or the fusion protein; or, the plant contains a nucleic acid molecule encoding Vpb4Ea1 protein, a mutant of the Vpb4Ea1 protein, or the fusion protein. The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

[0074] The present invention provides a non-viable biological sample obtained from a plant, plant tissue or plant seed; the biological sample contains a nucleic acid molecule encoding the Vpb4Ea1 protein, a mutant of the Vpb4Ea1 protein or the fusion protein; The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

[0075] Preferably, the non-viable biological sample is a processed plant product, such as a processed product of the insect-resistant plant. The processed product can be a product obtained by processing the whole or part of it.

[0076] For example, the plant is corn, and the processed products include corn flour, corn cob meal, corn syrup, corn oil, corn starch, etc.

[0077] The beneficial effects of this invention include at least the following: The Bacillus thuringiensis CZ437 provided by this invention can produce proteins with high insecticidal activity against Coleoptera insects. Its cell crystal mixture can efficiently kill Coleoptera insects such as the two-spotted leaf beetle, and can be used as an insecticide or for the preparation of insecticides. The Vpb4Ea1 protein provided by this invention can effectively kill Coleoptera insects, showing particularly excellent insecticidal activity against the two-spotted leaf beetle. The Bacillus thuringiensis and insecticidal protein provided by this invention offer an insecticide with application value for the biological control of Coleoptera insects, and the encoding gene of the insecticidal protein provides an effective genetic resource for the breeding of insect-resistant plants. Attached Figure Description

[0078] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0079] Figure 1 The results show the insecticidal activity of the Bacillus thuringiensis cell crystal mixture against the two-spotted leaf beetle in Example 1 of this invention.

[0080] Figure 2 The results of the insecticidal activity assay of Vpb4Ea1 (Vpb4-CZ437) protein against the two-spotted leaf beetle in Example 2 of this invention are shown. Detailed Implementation

[0081] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0082] Example 1: Isolation and Bioactivity Analysis of Bacillus thuringiensis This invention involves the isolation and screening of several Bacillus thuringiensis strains. Preliminary screening revealed a strain with high insecticidal activity against the two-spotted leaf beetle, which was named CZ437. Further preparation of a cell crystal mixture of this strain and determination of its insecticidal activity against the two-spotted leaf beetle are described below.

[0083] 1. Preparation of Bacillus thuringiensis colony plate counting and cell crystal mixture (1) Take 5 μL of bacterial culture into 5 mL LB and incubate at 30℃ and 220 rpm / min for 12 h; (2) Take 1 mL and 2 mL of bacterial culture into 1 / 2 LB solid medium and incubate at 30℃ and 220 rpm / min for 24 h; (3) Take bacterial solutions from different treatments and measure them according to 10 5 10 6 10 7 10 8 Perform serial dilutions and spread 100 μL of each dilution onto 1 / 2 LB plates, incubate overnight at 30°C; (4) Count the number of colonies; (5) Ensure that the CFU count is within 10 based on the colony count results. 8 When cfu / mL, scrape off 1 / 2 LB of the cell crystal mixture from the medium.

[0084] 2. Bioactivity determination of a mixture of cell crystals from five wild-type Bacillus thuringiensis strains The bioactivity assay for larvae and adults of the two-spotted leaf beetle is as follows: Prepare an artificial feed containing yeast powder and sucrose, add 5%–10% water, and stir well. Add the test cell crystal mixture and mix well. Add the mixed feed to a 9 cm petri dish and let it stand at room temperature for 1–2 hours until the surface of the feed is slightly dry. Take 15 two-spotted leaf beetle adults of uniform size and high activity and place them in a plastic container. Place a layer of gauze inside and cover the top. Place the larvae in a petri dish for bioactivity assay. Place the apparatus in an artificial climate incubator with a temperature of (26±2)℃, relative humidity of 50–70%, and a photoperiod of 16L:8D. After 7 days, count the number of live insects and calculate the mortality rate and corrected mortality rate.

[0085] Based on the results of bioactivity assays ( Figure 1 A mixture of cell crystals of Bacillus thuringiensis CZ226, CZ227, CZ435, CZ436, and CZ437 (10 8 The cfu / mL concentration showed high insecticidal activity against adult two-spotted leaf beetles, with corrected mortality rates of 66.7%, 69.4%, 80.5%, 69.4%, and 75% after 7 days, respectively. The mortality rate and corrected mortality rate were calculated using the following formulas: Mortality rate = Number of dead insects / Total number of infested insects; Corrected mortality rate = (treatment mortality rate - control mortality rate) / (1 - control mortality rate) × 100%.

[0086] The treatment group, in which the test sample was replaced with Tris buffer, served as a control.

[0087] Example 2: Preparation of Vpb4Ea1 (Vpb4-CZ437) protein and determination of its bioactivity against the two-spotted firefly beetle. 1. Construction of the recombinant strain vpb4Ea1-28a (vpb4-CZ437-28a) 1.1 Amplification of the target gene vpb4Ea1 (vpb4-CZ437) The PCR system (20 μL) is as follows: Primestar 10 μL, template 0.5 μL, F 0.5 μL, R 0.5 μL, ddH2O 8 μL.

[0088] The primer sequences used are as follows: F:gtggtggtgctcgagtgcggccgcaagcttAATGTTGAAGTTAAAAAGTGTATATAAAG (SEQ IDNO.5); R:gcaaatgggtcgggatccgaattcgagctcctggcgaatgggacgcgccctgtagc (SEQ ID NO. 6).

[0089] Enzyme cleavage sites: Sac I, Hind III.

[0090] The PCR program was as follows: 98℃, 10 min; 98℃, 1 min, 55℃, 30 s, 72℃, 3 min 10 s, 30 cycles; 72℃, 10 min.

[0091] 1.2 Target Gene Gel Recovery DNA fragments are separated by agarose gel electrophoresis. Once the desired DNA is completely separated, the gel is transferred to a UV lamp to cut out the desired DNA fragment as quickly as possible. The fragment is then purified and recovered using a HiBind® DNA Mini binding column.

[0092] 1.3 Enzyme digestion The enzyme digestion reaction system (20 μL) is as follows: Pet-28a / vpb4Ea1-CZ437 2 μL, 10×H 2 μL, Sac I 1 μL, Hind III 1 μL, and ultrapure water 14 μL.

[0093] The enzyme digestion reaction conditions were: 37℃, reaction time 35 min.

[0094] 1.4 Seamless Cloning The seamless cloning reaction system (10 μL) is as follows: 2×Basic Assembly Mix 5 μL, Pet-28a x μL. vpb4Ea1 -CZ437 y μL, Nuclease-free Water to bring the total to 10 μL. Where x and y are calculated based on the optimal molar ratio of carrier to fragment of 1:1-1:3.

[0095] The seamless cloning reaction conditions were: 50°C for 50 min, followed by a few seconds on ice.

[0096] 1.4 Transformation (1) The ligation product was added to Escherichia coli Trans1-T1 competent cells; (2) Gently mix and then in an ice bath for 30 minutes; (3) 42℃ metal bath for 90 s, then immediately place on ice for 2 min; (4) Add 500 μL LB to the centrifuge tube, incubate at 37℃ and 220 rpm for 45 min; (5) Take 200 μL and spread it on the corresponding resistance LB plate, and incubate at 37°C overnight.

[0097] 1.5 Identification of positive clones The PCR system (20 μL) is as follows: Taq 10 μL, template 1 μL, F 0.5 μL, R 0.5 μL, ddH2O 8 μL.

[0098] The PCR program was as follows: 94℃, 10 min; 94℃, 1 min, 55℃, 1 min, 72℃, 3 min 10 s, 30 cycles; 72℃, 10 min.

[0099] The F and R primer sequences are the same as those in 1.1 above.

[0100] 2. Expression and extraction of Vpb4Ea1 (Vpb4-CZ437) protein (1) E. coli carrying the target gene vpb4Ea1 were spread on culture dishes by streak plating and cultured overnight at 37°C. (2) Pick a single colony and inoculate it into 5 mL of LB liquid medium (containing 1% of the corresponding antibiotic), and incubate at 37℃ and 220 rpm / min for about 8 h; (3) Inoculate 1% into 300 mL of liquid LB medium, incubate at 37℃ and 220 rpm / min for 2 h, then add IPTG to a final concentration of 0.5 mmol / L, and induce at 16℃ and 150 rpm / min for 36 h; (4) After induction, centrifuge at 8,000×g for 10 min, discard the supernatant, collect the precipitate, and suspend the collected bacterial precipitate in 30 mL of 20 mM Tris-HCl; (5) Disrupt cells with ultrasound for 10 min; (6) Centrifuge at 8,000×g for 10 min at 4℃, collect the supernatant, and suspend the precipitate in 30 mL of 20 mM Tris-HCl; (7) Take a portion of the supernatant and precipitate suspension and use SDS-PAGE to analyze the location of the extracted protein.

[0101] 3. Vpb4Ea1 protein purification (1) Centrifuge the protein sample expressed by Escherichia coli in 1.6 above at 4 ℃, 8,000×g for 10 min, and collect the supernatant; (2) Add 1.5 mL of affinity column stock containing nickel (Ni) to the purification column (10 mL). (3) Use 5 column volumes of ultrapure water to remove ethanol from the column feed; (4) Add 5 column volumes of binding buffer (20 mM Tris-HCl, 500 mM NaCl, 50 mM imidazole) to equilibrate the column stock; (5) Slowly load the prepared 15 mL sample and collect the flow-through sample; (6) Elute the flow-through sample again, and repeat the elution process three times; (7) Add 5 column volumes of binding buffer to elute impurities and collect the flow-through sample; (8) Add 5 mL of elution buffer (20 mM Tris-HCl, 500 mM NaCl, 250 mM imidazole) to elute the target protein and collect it; (9) Elute the collected solution eluted with elution buffer again and collect it; (10) 15 column volumes of ultrapure water flushing column stock; (11) Wash with 5 column volumes of 20% ethanol, then store in 20% ethanol at 4°C; (12) Perform SDS-PAGE analysis on the samples collected in the above steps.

[0102] 4. Desalting and purification of Vpb4Ea1 protein (1) Install the desalination column and start the instrument and computer. Place the collection tube into the collection tank and put the pump head (A1) into pure water. Then turn on the system wash with pure water. Set the pressure warning: the pressure before the column (PreC) is 0.5 MPa and the pressure after the column (Delt) is 0.15 MPa. Select the column position and adjust the flow rate to 10 mL / min to wash the column 3 times the volume. Set the flow path to bypass. (2) During the cleaning process, when loading the sample into the manual load flow path, inject pure water into the sample column with a syringe. After completion, switch the sample loading to injection to clean the sample column. After completion, switch back to the corresponding column position. Clean the sample column several times. (3) After rinsing with pure water, adjust the flow rate to 1 mL / min, quickly remove the pump head from the pure water and place it in 20 mL Tris-HCl, change the flow rate to 10 mL / min, and adjust the flow path to the corresponding path of the desalting column. Equilibrate the column with Tris-HCl buffer until the conductivity (Cond) rises to the same level as the conductivity of Tris-HCl and stabilizes. During this period, wash the loading column several times with Tris-HCl; (4) During manual load, inject 10 mL of eluted protein solution into the column, then switch to inject mode and simultaneously enable peak fractionation. Set the peak fractionation conditions so that collection begins when UV 280 is 15 mAU above the baseline. After loading, switch back to manual load. Observe the peak diagram and stop peak fractionation before the conductivity rises after UV 280 drops back to 15 mAU above the baseline. (5) Continue washing the column with buffer solution for at least 2 column volumes until the UV stabilizes, and then continue loading the sample; (6) After all desalination is completed, wash with water until Cond drops to 0, then wash with 20% ethanol and store the desalination column in 20% ethanol.

[0103] 5. Bioactivity assay of recombinant Vpb4Ea1 protein The Vpb4Ea1 expressed by recombinant Escherichia coli vpb4Ea1-28a shares 52.54% amino acid similarity with the Vpb4Fa1 protein isolated from Bacillus thuringiensis strain CGMCC No. 20447 (sequence shown in SEQ ID NO. 3) and 63.80% amino acid similarity with the previously reported Vpb4Da2 (sequence shown in SEQ ID NO. 4).

[0104] The bioactivity assay for larvae and adults of the two-spotted leaf beetle is as follows: Prepare an artificial feed containing yeast powder and sucrose, add 5%–10% water, and stir well. Add the protein solution to be tested and mix well. Add the mixed feed to a 9 cm petri dish and let it stand at room temperature for 1–2 hours until the surface of the feed is slightly dry. Take 15 adults of similar size and high activity and place them in a plastic container, line it with a layer of gauze, and then cover it. Place the larvae in a petri dish for bioactivity assay. Place the apparatus in an artificial climate incubator with a temperature of (26±2)℃, a relative humidity of 50–70%, and a photoperiod of 16L:8D. After 5 days, count the number of live insects and calculate the mortality rate and corrected mortality rate using the following formula: Mortality rate = Number of dead insects / Total number of infested insects; Corrected mortality rate = (treatment mortality rate - control mortality rate) / (1 - control mortality rate) × 100%.

[0105] The treatment group, in which the protein solution to be tested was replaced with Tris buffer, served as a control.

[0106] The results show that ( Figure 2 The insecticidal activity of Vpb4Ea1 protein (40 μg / mL) against adult two-spotted leaf beetle was significantly higher than that of Vpb4Fa1 (Vpb4-B14D2) protein, with a corrected mortality rate of 85.2% and LC-12. 50 The concentration was 9.93 μg / mL (95% confidence limit: 4.94–19.67). The LC50 of Vpb4Ea1 protein against the larvae of the two-spotted leaf beetle was... 50 The value was 6.05 μg / g (95% confidence interval: 3.204–18.327).

[0107] The same method described above was used to test the insecticidal activity of Vpb4Da2 (SEQ ID NO. 4), which has been reported to have insecticidal activity against the corn leaf beetle, against both adults and larvae of the two-spotted leaf beetle. The results showed that the corrected mortality rate of Vpb4Da2 against adults was 6.26% ± 10.47%, and the corrected mortality rate against larvae was 2.60% ± 4.43%, which was not significantly different from the control. Therefore, Vpb4Da2 has no insecticidal activity against either adults or larvae of the two-spotted leaf beetle.

[0108] Example 3: Screening of Vpb4Ea1 (Vpb4-CZ437) mutants 1. Experimental Methods 1.1 Establishment of the mutant library 1.1.1 Exploration of Mutation Conditions (1) The number of cycles for saturation amplification of the mutant library when mutated by 2 bases is determined to be 26 according to the following formula: ; (2) The plasmid containing the vpb4Ea1 gene was extracted and diluted to different concentrations for PCR amplification; (3) Based on the calculated cycle number, adjust the PCR cycle number to different numbers (24, 25, 26, 27, 28) and then perform amplification; The PCR system (20 μL) is as follows: Taq 10 μL, vpb4Ea1 plasmid 0.5 μL, primer F 0.5 μL, primer R 0.5 μL, ddH2O 8 μL.

[0109] The PCR program is as follows: 94℃, 10 min; 94℃, 1 min, 55℃, 1 min, 72℃, 3 min 15 s, 24-28 cycles; 72℃, 10 min.

[0110] 1.1.2 Carrier Construction After the PET-28a vector was digested with Sal I and Xho I, the expression vector ligation product was constructed using a seamless cloning method and added to E. coli Trans1-T1 competent cells.

[0111] 1.2 Extraction of mutant proteins (1) E. coli carrying the vpb4Ea1 mutant gene were spread on culture dishes by streak plating and cultured overnight at 37°C. (2) Pick a single colony and inoculate it into 5 mL of LB liquid medium (containing 1% of the corresponding antibiotic), and incubate at 37℃ and 220 rpm / min for about 8 h; (3) Inoculate 1% into 300 mL of liquid LB medium, incubate at 37℃ and 220 rpm / min for 2 h, then add IPTG to a final concentration of 0.5 mmol / L, and induce at 16℃ and 150 rpm / min for 36 h; (4) After induction, centrifuge at 8,000×g for 10 min and collect the supernatant; (5) Take a portion of the supernatant, perform SDS-PAGE detection, and quantify the Vpb4Ea1 mutant protein.

[0112] The above-mentioned Vpb4Ea1 random mutant library yielded mutants with altered amino acid sequences, and their proteins were successfully extracted. Initial screening for bioactivity assays in adult two-spotted leaf beetles was conducted, and mutants with significantly enhanced insecticidal activity compared to wild-type Vpb4Ea1 protein were obtained.

[0113] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Bacillus thuringiensis IPPBiotCZ437, characterized in that, It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 33455.

2. A Bacillus thuringiensis, characterized in that, It is a genetically modified derivative strain of Bacillus thuringiensis IPPBiotCZ437 as described in claim 1.

3. The Bacillus thuringiensis according to claim 2, characterized in that, The genetic modification includes genetic engineering modification; the genetic engineering modification is preferably the introduction of a functional gene into the Bacillus thuringiensis IPPBiotCZ437.

4. The Bacillus thuringiensis according to claim 3, characterized in that, The functional genes include at least one of the following: insecticidal genes, pathogen-resistant genes, insecticidal synergistic genes, and pathogen-resistant synergistic genes.

5. A microbial preparation, characterized in that, It includes any one or more of the following: (1) Bacillus thuringiensis IPPBiotCZ437 as described in claim 1 or Bacillus thuringiensis as described in any one of claims 2 to 4; (2) Bacillus thuringiensis IPPBiotCZ437 as described in claim 1 or Bacillus thuringiensis as described in any one of claims 2 to 4, lyophilized bacterial cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension; (3) The formulation prepared by (1) and / or (2) above.

6. A composition, characterized in that, It comprises any one or more of the following: Bacillus thuringiensis IPPBiotCZ437 as described in claim 1; Bacillus thuringiensis as described in any one of claims 2 to 4; lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or resuspension of the precipitate after centrifugation of said bacterial suspension, or lyophilized cells, bacterial suspension, supernatant after centrifugation of said bacterial suspension, or resuspension of the precipitate after centrifugation of said bacterial suspension, derived from any one or more of the following: (1) Nutrient cells; (2) At least one Vpb4 protein; (3) Secretory proteins; the secretory proteins are not insecticidal crystal proteins; (4) Paracell crystals; (5) Insecticidal crystal proteins; (6) Bacterial cells containing spores; (7) Spores.

7. An insecticide, characterized in that, The insecticide comprises an insecticidal active ingredient and excipients, wherein the insecticidal active ingredient comprises the microbial preparation of claim 5 or the composition of claim 6.

8. A method for preparing a mixture of Bacillus thuringiensis IPPBiotCZ437 as described in claim 1 or Bacillus thuringiensis as described in any one of claims 2-4, characterized in that, The method includes: culturing the Bacillus thuringiensis to bring it into a vegetative growth phase, and collecting the culture.

9. The method according to claim 8, characterized in that, The culture was performed using a solid culture medium.

10. Any of the following applications of Bacillus thuringiensis IPPBiotCZ437 as claimed in claim 1, or Bacillus thuringiensis as claimed in any one of claims 2-4, or the microbial preparation as claimed in claim 5, or the composition as claimed in claim 6, or the insecticide as claimed in claim 7: (1) Control of Coleoptera insects; (2) Kill Coleoptera insects; (3) Prepare products for the control of Coleoptera insects; (4) Prepare products for killing Coleoptera insects.

11. Any of the following applications of the Vpb4Ea1 protein, a nucleic acid molecule encoding the Vpb4Ea1 protein, or biological material containing said nucleic acid molecule: (1) Control of Coleoptera insects; (2) Kill Coleoptera insects; (3) Prepare products for the control of Coleoptera insects; (4) Prepare products for killing Coleoptera insects; (5) Prepare insect-resistant transgenic plants, wherein the insect is a Coleoptera insect; in, The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 that contains one or more amino acids substituted, deleted, and / or added to the amino acid sequence shown in SEQ ID NO.1 and has similar activity.

12. The application according to claim 11, characterized in that, The biomaterial is any one of the following (1)-(5): (1) A DNA construct containing a nucleic acid molecule encoding the Vpb4Ea1 protein; (2) A vector containing a nucleic acid molecule encoding the Vpb4Ea1 protein or the DNA construct described in (1); (3) Microorganisms containing a nucleic acid molecule encoding the Vpb4Ea1 protein or the DNA construct described in (1) or the vector described in (2); (4) A plant cell containing a nucleic acid molecule encoding the Vpb4Ea1 protein or the DNA construct described in (1) or the vector described in (2); (5) A plant tissue, plant organ or plant containing a nucleic acid molecule encoding the Vpb4Ea1 protein or the DNA construct described in (1) or the vector described in (2).

13. The application according to claim 11 or 12, characterized in that, The beetles are Chrysomelidae, preferably two-spotted leaf beetles, corn root leaf beetles, potato beetles, ten-spotted ladybugs, yellow-striped flea beetles, or malignant leaf beetles.

14. A Vpb4Ea1 protein mutant, characterized in that, The mutant contains one or more amino acid mutations compared to the wild-type Vpb4Ea1 protein; the insecticidal activity of the Vpb4Ea1 protein mutant is thus enhanced. The wild-type Vpb4Ea1 protein has the amino acid sequence shown in SEQ ID NO.

1.

15. A fusion protein, characterized in that, The fusion protein comprises the Vpb4Ea1 protein mutant of claim 14.

16. A nucleic acid molecule encoding the Vpb4Ea1 protein mutant of claim 14 or the fusion protein of claim 15.

17. Biomaterials associated with Vpb4Ea1 protein mutants, characterized in that, The biomaterial is any one of the following (1)-(3): (1) A DNA construct containing the nucleic acid molecule of claim 16; (2) A vector containing the nucleic acid molecule of claim 16 or the DNA construct of (1); (3) A host cell containing the nucleic acid molecule of claim 16 or the DNA construct of (1) or the vector of (2).

18. A recombinant microorganism, characterized in that, The recombinant microorganism contains a nucleic acid molecule encoding the Vpb4Ea1 protein or the nucleic acid molecule of claim 16, or expresses the Vpb4Ea1 protein or the Vpb4Ea1 protein mutant of claim 14 or the fusion protein of claim 15; The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

19. Any of the following applications of the Vpb4Ea1 protein mutant of claim 14, the fusion protein of claim 15, the nucleic acid molecule of claim 16, the biomaterial of claim 17, or the recombinant microorganism of claim 18: (1) Control of Coleoptera insects; (2) Kill Coleoptera insects; (3) Prepare products for the control of Coleoptera insects; (4) Prepare products for killing Coleoptera insects; (5) Prepare insect-resistant transgenic plants, wherein the insect is a Coleoptera insect.

20. The application according to claim 19, characterized in that, The beetles are Chrysomelidae, preferably two-spotted leaf beetles, corn root leaf beetles, potato beetles, ten-spotted ladybugs, yellow-striped flea beetles, or malignant leaf beetles.

21. An insecticidal composition, characterized in that, The composition comprises at least one selected from the Vpb4Ea1 protein mutant of claim 14, the fusion protein of claim 15, the recombinant microorganism of claim 18, Bacillus thuringiensis IPPBiotCZ437 of claim 1 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of said bacterial suspension, and Bacillus thuringiensis of any one of claims 2 to 4 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of said bacterial suspension, or precipitate resuspension after centrifugation of said bacterial suspension.

22. An insecticide, characterized in that, The insecticide comprises an insecticidal active ingredient and excipients. The insecticidal active ingredient comprises at least one selected from the following: the Vpb4Ea1 protein mutant of claim 14, the fusion protein of claim 15, the recombinant microorganism of claim 18, Bacillus thuringiensis IPPBiotCZ437 of claim 1 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension, and Bacillus thuringiensis of any one of claims 2 to 4 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension.

23. A method for controlling Coleoptera insects, characterized in that, The method includes: bringing coleopteran insects into contact with an effective amount of insecticidal active ingredient, or feeding coleopteran insects an effective amount of insecticidal active ingredient. The insecticidal active ingredient comprises at least one selected from Vpb4Ea1 protein, the Vpb4Ea1 protein mutant of claim 14, the fusion protein of claim 15, Bacillus thuringiensis IPPBiotCZ437 of claim 1 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension, Bacillus thuringiensis of any one of claims 2 to 4 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension, the microbial preparation of claim 5, the composition of claim 6, and the recombinant microorganism of claim 18. The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

24. A method for killing Coleoptera insects, characterized in that, The method includes: bringing coleopteran insects into contact with an effective amount of insecticidal active ingredient, or feeding coleopteran insects an effective amount of insecticidal active ingredient. The insecticidal active ingredient comprises at least one selected from Vpb4Ea1 protein, the Vpb4Ea1 protein mutant of claim 14, the fusion protein of claim 15, Bacillus thuringiensis IPPBiotCZ437 of claim 1 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension, Bacillus thuringiensis of any one of claims 2 to 4 or its lyophilized cells, bacterial suspension, supernatant after centrifugation of bacterial suspension, or precipitate resuspension after centrifugation of bacterial suspension, the microbial preparation of claim 5, the composition of claim 6, and the recombinant microorganism of claim 18. The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

25. The method according to claim 23 or 24, characterized in that, The beetles are Chrysomelidae, preferably two-spotted leaf beetles, corn root leaf beetles, potato beetles, ten-spotted ladybugs, yellow-striped flea beetles, or malignant leaf beetles.

26. A method for constructing an insect-resistant plant, characterized in that, The method includes: causing a plant to express Vpb4Ea1 protein, the Vpb4Ea1 protein mutant of claim 14, or the fusion protein of claim 15; The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity; The insect in question is a Coleoptera insect.

27. The method according to claim 26, characterized in that, The method includes introducing a nucleic acid molecule encoding the Vpb4Ea1 protein, a mutant of the Vpb4Ea1 protein, or the fusion protein into a plant.

28. The method according to claim 26 or 27, characterized in that, The plant is a host plant for Coleoptera insects; the Coleoptera insects are preferably Chrysomelidae insects, more preferably two-spotted leaf beetle, corn root leaf beetle, potato beetle, ten-spotted ladybug, yellow striped flea beetle or malignant leaf beetle.

29. The method according to claim 28, characterized in that, The plants in question are from the Poaceae, Brassicaceae, or Leguminosae families.

30. A method for protecting plants from damage by Coleoptera insects, characterized in that, The method comprises: applying an effective amount of an insecticidal active ingredient to the plant; wherein the insecticidal active ingredient comprises at least one selected from Vpb4Ea1 protein, the Vpb4Ea1 protein mutant of claim 14, the fusion protein of claim 15, Bacillus thuringiensis IPPBiotCZ437 of claim 1 or its freeze-dried cells, bacterial suspension, supernatant after centrifugation of bacterial suspension or the precipitate resuspension after centrifugation of bacterial suspension, Bacillus thuringiensis of any one of claims 2 to 4 or its freeze-dried cells, bacterial suspension, supernatant after centrifugation of bacterial suspension or the precipitate resuspension after centrifugation of bacterial suspension, the microbial preparation of claim 5, the composition of claim 6, and the recombinant microorganism of claim 18; Alternatively, the plant may be made to express the Vpb4Ea1 protein, the Vpb4Ea1 protein mutant of claim 14, or the fusion protein of claim 15. The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

31. An insect-resistant plant, characterized in that, The plant expresses the Vpb4Ea1 protein, the Vpb4Ea1 protein mutant of claim 14, or the fusion protein of claim 15; or, the plant contains a nucleic acid molecule encoding the Vpb4Ea1 protein, the Vpb4Ea1 protein mutant of claim 14, or the fusion protein of claim 15. The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

32. A non-living biological sample, characterized in that, The biological sample is obtained from plants, plant tissues, or plant seeds; the biological sample contains a nucleic acid molecule encoding the Vpb4Ea1 protein, the Vpb4Ea1 protein mutant of claim 14, or the fusion protein of claim 15; The Vpb4Ea1 protein contains the amino acid sequence shown in SEQ ID NO.1, or contains an amino acid sequence derived from the amino acid sequence shown in SEQ ID NO.1 by substitution, deletion and / or addition of one or more amino acids, and has similar activity.

33. The non-viable biological sample according to claim 32, characterized in that, The biological sample is a processed plant product.

Images