Lactobacillus gasseri CC214, a strain that can inhibit bacterial growth and alleviate apoptosis of reproductive tract epithelial cells, and its application.

Abstract

This invention discloses a strain of *Lactobacillus gasseri* CC214 that can inhibit bacteria and alleviate apoptosis of reproductive tract epithelial cells, and its applications. *Lactobacillus gasseri* CC214 is deposited at the China Center for Type Culture Collection (CCTCC) on November 20, 2025, with accession number CCTCC NO: M 20252628. This invention provides a novel strain of *Lactobacillus gasseri* CC214. First, this strain can effectively inhibit bacteria, especially *Aeromonas coli*, *Streptococcus agalactiae*, *Enterobacter cloacae*, and / or *Escherichia coli*. Second, *Lactobacillus gasseri* CC214 of this invention can specifically increase the expression of the sirtuin1 gene in the vaginal mucosa, reduce the apoptosis rate of vaginal and cervical epithelial cells, promote epithelial cell proliferation, maintain the morphology and elasticity of reproductive organs, and simultaneously alleviate symptoms such as vaginal dryness and painful intercourse, achieving a dual effect of "atrophy intervention + lubrication improvement," without the side effects of estrogen replacement therapy.

Description

Technical Field

[0001] This invention belongs to the field of Lactobacillus gasseri technology, and particularly relates to a strain of Lactobacillus gasseri CC214 that can inhibit bacterial growth and alleviate apoptosis of reproductive tract epithelial cells and its applications. Background Technology

[0002] Perimenopause is a crucial physiological stage in a woman's transition from reproductive to old age, marked by a gradual decline in ovarian function and a significant decrease in estrogen levels. These endocrine changes have a profound impact on multiple systems throughout a woman's body, with symptoms in the reproductive and urinary systems being particularly prominent and widespread, severely affecting women's quality of life and overall well-being.

[0003] In healthy women of reproductive age, the vaginal microecological system is dominated by lactobacilli. Lactobacilli maintain the acidic environment of the vagina through acid production (mainly lactic acid), the production of antibacterial substances (such as bacteriocins and hydrogen peroxide), and competitive site occupation mechanisms, effectively inhibiting the excessive growth of pathogenic microorganisms (such as bacterial vaginosis-associated bacteria, Candida, and Trichomonas), thus forming an important biological barrier. However, after entering perimenopause, due to estrogen deficiency, the glycogen content of vaginal mucosal epithelial cells decreases, resulting in insufficient substrates for lactobacilli metabolism. This leads to a significant decrease in the number and diversity of lactobacilli and an increase in vaginal pH. This microecological imbalance weakens the local defense capabilities of the vagina, making it easier for pathogens to colonize and multiply. This leads to a sharp increase in the risk of recurrent vaginitis (such as atrophic vaginitis, bacterial vaginosis, and vulvovaginal candidiasis), causing symptoms such as dryness, itching, burning, abnormal discharge, and odor. In addition, studies have confirmed that perimenopausal women experience a decline in estrogen levels, leading to abnormal expression of sirtuin1 in the vaginal and cervical tissues. This results in accelerated epithelial cell apoptosis, tissue atrophy, and decreased elasticity, causing problems such as vaginal dryness, painful intercourse, and cervical atrophy.

[0004] Lactobacillus gasseri is an important species in the genus Lactobacillus. It is a commensal bacterium isolated from the human body (especially the oral cavity, intestines, and vagina) and is recognized as a key member of the human core microbiota. Due to its health benefits to the host, it is widely studied and applied, and is considered an important probiotic species.

[0005] In existing technologies, most techniques for alleviating perimenopausal reproductive system atrophy rely on estrogen replacement therapy. Although existing Lactobacillus gasseri usually has the effect of relieving vaginitis, its function is limited, only improving vaginal lubrication disorders during perimenopause, and none of them involve intervention for vaginal and cervical reproductive organ atrophy. Summary of the Invention

[0006] Purpose of the invention: In view of the problems existing in the prior art, the present invention provides a strain of Lactobacillus gasseri CC214 that can inhibit bacteria and alleviate apoptosis of reproductive tract epithelial cells and its application.

[0007] Technical solution: To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a strain of Lactobacillus gasseri that can inhibit bacteria and alleviate apoptosis of reproductive tract epithelial cells. The Lactobacillus gasseri is Lactobacillus gasseri CC214, which is deposited at the China Center for Type Culture Collection on November 20, 2025, with accession number CCTCC NO: M 20252628.

[0009] In a second aspect, the present invention provides a composition comprising the aforementioned Lactobacillus gasseri CC214.

[0010] As a specific embodiment, the composition is a lyophilized powder containing Lactobacillus gasseri CC214; preferably, the activity of the strain in the lyophilized powder is 1×10⁻⁶. 10 ~1×10 12 CFU / g.

[0011] Thirdly, the present invention provides the application of the Lactobacillus gasseri CC214 and the composition thereon in the preparation of antibacterial agents.

[0012] Preferably, the antibacterial agent is capable of inhibiting Molybditis laparos, Streptococcus agalactiae, Enterobacter cloacae, and / or Escherichia coli.

[0013] Fourthly, the present invention provides the use of the aforementioned Lactobacillus gasseri CC214 and the aforementioned composition in the preparation of products that enhance the expression of the sirtuin1 gene in the vaginal mucosa.

[0014] Fifthly, the present invention provides the use of the aforementioned Lactobacillus gasseri CC214 and the aforementioned composition in the preparation of products that reduce the apoptosis rate of vaginal epithelial cells.

[0015] In a sixth aspect, the present invention provides the use of the aforementioned Lactobacillus gasseri CC214 and the aforementioned composition in the preparation of products that alleviate vaginal tissue atrophy.

[0016] In a seventh aspect, the present invention provides the use of the aforementioned Lactobacillus gasseri CC214 and the aforementioned composition in the preparation of products for relieving vaginal dryness.

[0017] As a specific implementation plan, the above-mentioned products contain live Lactobacillus gasseri CC214, or contain postbiotics containing inactivated Lactobacillus gasseri CC214.

[0018] Beneficial Effects: Compared with existing technologies, this invention provides a novel *Lactobacillus gasseri* strain CC214. First, this strain can effectively inhibit bacteria, especially *Aeromonas coli*, *Streptococcus agalactiae*, *Enterobacter cloacae*, and / or *Escherichia coli*. Second, the *Lactobacillus gasseri* CC214 of this invention can specifically increase the expression of the sirtuin1 gene in the vaginal mucosa, reduce the apoptosis rate of vaginal and cervical epithelial cells, promote epithelial cell proliferation, maintain the morphology and elasticity of reproductive organs, and at the same time relieve symptoms such as vaginal dryness and painful intercourse, achieving the dual effect of "atrophy intervention + lubrication improvement," without the side effects of estrogen replacement therapy (such as the risk of breast cancer). Attached Figure Description

[0019] Figure 1 Gram staining results for strain CC214.

[0020] Figure 2 The relative expression levels of the sirtuin1 gene in the vaginal mucosa of mice in each group.

[0021] Figure 3 The apoptosis rate of vaginal epithelial cells in mice of each group.

[0022] Figure 4 The ratio of uterus to body weight is given after the experiment in each group of mice.

[0023] Figure 5 The endometrial thickness of each group of mice after the experiment. Detailed Implementation

[0024] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0025] Example 1: Screening of Beneficial Human Strains and Construction of a Strain Library

[0026] To obtain beneficial human bacterial strains for related functional evaluation experiments and screening of fermentable strains, a human beneficial bacterial strain library was first constructed. Forty-eight samples of reproductive tract secretions were collected from healthy women. The criteria for healthy samples were: no oral or vaginal application of antibiotics within the past month, no use of probiotic preparations, immunomodulators, hormones, or alcohol; regular and reasonable diet, no long-term dieting, no long-term smoking, no menstrual irregularities (avoiding menstruation), no intrauterine device (IUD), sexual activity and vaginal douching within the past three days, vaginal pH ≤ 4.5, and cleanliness grade I-II. Three samples were collected from each sample using sterile swabs, immediately placed in an anaerobic bag, then stored in an ice box, and promptly returned to the laboratory for subsequent freezing. One sample from each case was selected, 5 ml of MRS medium was added, and after thorough vortexing, glycerol solution was added to achieve a final glycerol concentration of 15%-20%. The mixture was then aliquoted into EP tubes (1 ml per tube) and frozen at -80°C for subsequent strain screening.

[0027] Frozen glycerol-protected samples were serially diluted 1:10. After each serial dilution, the samples were spread onto MRS, TPY, Rogosa, and Columbia blood agar plates, with two spreads for each gradient and four parallel serial dilutions for each sample. The plates were incubated in anaerobic and 5% oxygen environments at 37°C. After 48 hours of incubation, single colonies showing good growth were selected from each gradient plate. MALDI-TOF mass spectrometry was used for rapid preliminary identification of the selected colonies. Known pathogens and opportunistic pathogens were discarded. Probiotics or second-generation probiotics were inoculated into 5 ml of MRS liquid medium for scale-up culture. After 48 hours of incubation at 35-37°C, the OD of the fermentation broth was measured. 600 The bacterial count in the fermentation broth was observed by comparison with a microscope. 2 ml of the strain with a fermentation OD value greater than 0.3 and good growth was added to 2 ml of 30%-40% glycerol solution, pre-cooled, and then frozen at -80℃ for further isolation, purification, and screening. Strains with poor fermentation effect or no obvious bacterial amplification were discarded. A candidate library of beneficial strains was constructed, and a total of 86 candidate strains were screened.

[0028] Example 2 Screening of highly acid-resistant strains

[0029] After purifying the strains screened in Example 1 by streak plating on agar medium, single colonies were selected and inoculated into 15 ml of liquid MRS medium. The pH was measured every 4 hours after fermentation, and every 12 hours after 24 hours. Fermentation continued for 72 hours, yielding a final fermentation broth with a pH as low as 3.2. The strains with the fastest pH decrease and highest OD during fermentation were selected. 600 Samples with higher pH values ​​and final fermentation pH values ​​between 3.2 and 4.0 were selected as candidate strains, totaling 18 strains, numbered CC201-CC218.

[0030] Example 3 Screening of in vitro antibacterial strains

[0031] To screen for strains capable of inhibiting pathogenic bacteria, the strains screened in Example 2 were streaked and purified. *Lactobacillus plantarum* 229v was used as a control strain. Both strains were inoculated into 50 ml of MRS liquid medium and cultured at 37°C for 16 h. The fermentation broth was then centrifuged at 10000 rpm for 10 min, and the supernatant and bacterial cells were collected separately. The bacterial cells were washed twice with 0.9% sterile saline, and then OD was prepared using 0.9% sterile saline. 600The bacterial suspension was prepared at a concentration of 0.5-0.8 μL and stored at 4°C for future use. *Aeromonas coli* BNCC377479, *Streptococcus agalactiae* BNCC 357545, *Enterobacter cloacae* ATCC 23355, and *Escherichia coli* 8099 were selected as test strains for in vitro antibacterial experiments. The inhibition zone test was performed on the fermentation supernatant and bacterial suspension of each strain using the agar perforation method. The pH of the MRS culture medium was adjusted to be the same as that of the supernatant using lactic acid as a blank control. A 0.05 mg / mL levofloxacin solution served as a positive control for inhibiting *Aeromonas coli* BNCC 377479, *Streptococcus agalactiae* BNCC 357545, *Enterobacter cloacae* ATCC 23355, and *Escherichia coli* 8099. The size of the inhibition zone was measured; a zone with a radius larger than the MRS control was considered to have antibacterial activity. Excluding some strains with insignificant antibacterial effects, the evaluation results of strains with significant antibacterial effects are shown in Table 1.

[0032] The bacterial suspension and supernatant of strain CC214 showed significant inhibitory effects on BNCC 377479, BNCC357545, ATCC 23355, and Escherichia coli 8099, and the antibacterial ability was significantly better than that of Lactobacillus plantarum 229v.

[0033] Table 1 Evaluation of antibacterial effect

[0034]

[0035] Note: "-" indicates no obvious inhibition zone, "+" indicates inhibition zone diameter is between 3mm and 5mm, "++" indicates inhibition zone diameter is between 5mm and 10mm, and "+++" indicates inhibition zone diameter is >10mm. a is significantly different from CC058, b is significantly different from CC017, and c is significantly different from 229v.

[0036] Example 4: Preservation, identification, and strain of strains

[0037] Based on the CC214 strain screened in Example 3, which has the ability to resist acid and inhibit pathogenic bacteria, it was selected as the target strain.

[0038] (1) Preservation of strains

[0039] After streaking the selected CC214 strain onto MRS agar medium for 48 h, single colonies were selected and placed in 10 ml of MRS liquid medium. This medium was then incubated at 37°C for 16 h, and the OD of the culture solution was measured. 600When the value is ≥1.2, add glycerol solution to the culture medium at a volume ratio of 1:1. The concentration of the glycerol solution is 30%-40%. Mix well by pipetting and dispensing into 2ml sterile cryovials. Pre-cool at 4℃ for 2h, then pre-freeze at -20℃ for 4h, and finally transfer to a -80℃ freezer or liquid nitrogen for storage.

[0040] (2) Further morphological identification

[0041] Microscopic observation of the purified bacterial solution revealed that the bacteria were short rod-shaped, appearing singly or in pairs, or in short chains, and without spores. On agar medium, single colonies were round, grayish-white colonies with regular or slightly diffuse edges, smooth, translucent surfaces, and a raised center.

[0042] (3) Gram staining

[0043] Gram staining result is Gram positive, such as Figure 1 As shown.

[0044] (4) Molecular biological identification of 16S rRNA

[0045] The 16S rDNA gene sequence of strain FMM01 was amplified and sequenced using published universal 16S primers (primer sequences: 8F: 5'-AGAFTTTGATCCTGGCTCA-3'; 1510R: 5'-GGTTACCTTGTTACGACTT-3'). The nucleotide sequence of the 16S rDNA of strain CC214 is sequence 1 in the sequence listing. After 16S rDNA gene alignment, the similarity rate with Lactobacillus gasseri in Genebank reached 99%. Combined with microbial systematic identification, strain CC214 was identified as a Lactobacillus gasseri strain and named Lactobacillus gasseri CC214, whose 16S rDNA is shown in SEQ ID NO.1.

[0046] Lactobacillus gasseri CC214, which has been identified by scientific methods, has been deposited at the China Center for Type Culture Collection (CCTCC) on November 20, 2025, with accession number CCTCC NO: M20252628. The deposit address is Wuhan University, Wuhan, Hubei Province, People's Republic of China.

[0047] Example 5 Cell adhesion assay of Lactobacillus gasseri CC214

[0048] Add 1.0 × 10⁻⁶ cells to each cell culture dish. 8Lactobacillus gasseri CC214 (CFU) was cultured in serum- and antibiotic-free culture dishes for 4 hours under specific conditions. The cell membranes were then washed with saline solution to remove any non-adhering bacteria. The cells were then lysed, and the lysate was diluted and cultured for another 48-72 hours. Adhesion ability was expressed as the percentage of adherent bacteria (log CFU) relative to the total number of cells. For the GES-1 cell line, Lactobacillus gasseri CC214 showed an adhesion rate of 95%, demonstrating strong adhesion ability.

[0049] Example 6: Stimulation experiment of reproductive tract mucosal cells

[0050] Based on the vaginal mucosal irritation test standards in the former Ministry of Health's "Disinfection Technical Specifications," healthy, newly adult female New Zealand rabbits in their non-estrus period were selected. Before the test, the vaginal opening of the animals was examined for discharge, congestion, edema, and other damage. Lactobacillus gasseri CC214 bacterial suspension (1.2 × 10⁻⁶) was used. 8 (CFU / ml) Three female New Zealand rabbits were randomly selected for treatment with the test solution, 2 ml each time. Control group animals were treated with physiological saline in the same way. Treatments were administered at 24-hour intervals for 5 consecutive days. Twenty-four hours after the last treatment, the animals were euthanized using the air embolization method. The vagina was completely removed and longitudinally incised. The mucosa was visually inspected for edema, congestion, etc., and then fixed in 10% formaldehyde solution for histopathological examination.

[0051] According to the vaginal mucosal translocation scoring criteria and irritation intensity grading in the "Disinfection Technical Specifications," Lactobacillus gasseri CC214 has a vaginal mucosal irritation index of 0.85 < 1, indicating it is non-irritating to the vaginal mucosa. It can be used as a biological agent for direct vaginal microecological intervention.

[0052] Example 7: Intervention of Lactobacillus gasseri CC214 in regulating sirtuin1 gene expression in perimenopausal vaginal mucosa

[0053] Fifty 6-week-old female C57BL / 6 mice, weighing 20±2g, were randomly divided into 5 groups: blank control group (CK), model control group (PC), low-dose Lactobacillus gasseri CC214 group (CC214-L), high-dose Lactobacillus gasseri CC214 group (CC214-H), and inactivated Lactobacillus gasseri CC214 intervention group (CC214-D). Ovariectomy was performed on mice in the PC, CC214-L, CC214-H, and CC214-D groups. After intraperitoneal anesthesia, an abdominal incision was made, both ovaries were removed, and the incision was sutured. Postoperative antibiotics were administered to prevent infection. One week after recovery, serum estrogen (E2) levels in each group were measured using ELISA. Compared with the CK group, the E2 level in the PC group was significantly lower, indicating that the perimenopausal model was successfully established and could proceed to subsequent intervention experiments. The intervention treatments for each group were as follows: Blank control group (CK): Normal mice, without ovariectomy, without any intervention, routinely fed, and with the vagina wiped once a week using sterile saline; Model control group (PC): Ovariectomized mice, routinely fed, and with the vagina wiped once a week using sterile saline; Low-dose Lactobacillus gasseri CC214 group (CC214-L): Ovariectomized mice, treated with a low dose of Lactobacillus gasseri CC214 (concentration 5×10⁻⁶). 7 CFU / mL), administered vaginally, 50 μL each time, 3 times a week, with routine feeding; High-dose Lactobacillus gasseri CC214 group (CC214-H): Ovariectomized mice were given high-dose Lactobacillus gasseri intervention (concentration 1×10⁻⁶ CFU / mL), 8 CFU / mL), administered vaginally, 50 μL each time, once every 2 days, with routine feeding. Inactivated Lactobacillus gasseri CC214 intervention group (CC214-D): Ovariectomized mice were treated with inactivated Lactobacillus gasseri (heat-inactivated Lactobacillus gasseri, concentration 1×10⁻⁶). 8 TFU / mL), administered vaginally, 50 μL each time, once every 2 days, with routine feeding.

[0054] After 4 weeks of continuous intervention, mice were euthanized, rapidly dissected, and the mid-vaginal tissue was collected and placed in RNA preservation solution at -80°C for RT-qPCR detection of sirtuin1 mRNA levels. The lower vaginal tissue was collected, washed with sterile PBS, digested with trypsin, and vaginal epithelial cells were collected, centrifuged and washed twice, and used for flow cytometry detection of cell apoptosis rate. The uterus was removed and its wet weight was measured, and its body weight and uterus / body weight ratio were observed. The vaginal tissue was then subjected to pathological analysis.

[0055] RNA was reverse transcribed into cDNA using an RT-qPCR kit. Sirtuin1-specific primers were designed (Forward (5'-3): CGGCTACCGAGGTCCATATAC, Reverse (5'-3): CAGCTCAGGTGGAGGAATTGT). The results are as follows: Figure 2 As shown.

[0056] The results showed that the relative expression level of the sirtuin1 gene in the model control group (PC) mice was significantly lower than that in the blank control group (CK), while the relative expression level of the sirtuin1 gene in the vaginal mucosa of mice in the high-dose Lactobacillus gasseri CC214 group (CC214-H) was significantly higher than that in the model control group (PC). The relative expression level of the sirtuin1 gene in the vaginal mucosa of mice in the low-dose Lactobacillus gasseri CC214 group (CC214-L) and the inactivated Lactobacillus gasseri CC214 intervention group (CC214-D) mice was increased. This indicates that vaginal supplementation with Lactobacillus gasseri CC214 in perimenopausal mice can increase the relative expression level of the sirtuin1 gene in the vaginal mucosa. Inactivated Lactobacillus gasseri CC214 also has the same effect. Both live Lactobacillus gasseri CC214 and inactivated postbiotics can be used as microbial preparations to intervene in the expression of the sirtuin1 gene in the vaginal mucosa.

[0057] Example 8: Lactobacillus gasseri CC214 intervention to regulate apoptosis in perimenopausal vaginal epithelial cells

[0058] Based on mouse vaginal epithelial cells collected in Example 7, the cells were washed twice with PBS, then incubated with Annexin V-FITC and PI staining solution for 15 min in the dark. Flow cytometry was used for detection, with control tubes (blank tubes and single-stained tubes). Instrument parameters were adjusted, cell signals were collected, and the apoptosis rate (early apoptosis rate + late apoptosis rate) of each group was calculated. The results are as follows: Figure 3 As shown in the figure. The results showed that the apoptosis rate of vaginal epithelial cells in the model control group (PC) mice was significantly higher than that in the blank control group (CK), while the apoptosis rate of vaginal epithelial cells in the high-dose group of Lactobacillus gasseri CC214 (CC214-H), the low-dose group of Lactobacillus gasseri CC214 (CC214-L), and the intervention group of inactivated Lactobacillus gasseri CC214 (CC214-D) mice was significantly lower than that in the model control group (PC). This indicates that vaginal supplementation with Lactobacillus gasseri CC214 in perimenopausal mice can reduce the apoptosis rate of vaginal epithelial cells, and inactivated Lactobacillus gasseri CC214 has the same effect. Both live Lactobacillus gasseri CC214 and inactivated post-biotics can be used as microbial preparations to intervene in vaginal epithelial cell apoptosis.

[0059] Example 9: Lactobacillus gasseri CC214 on perimenopausal vaginal tissue atrophy

[0060] Based on the mouse uterus collected in Example 7, and the wet weight and body weight were recorded, the uterus / body weight ratio of each group of mice was as follows: Figure 4 As shown. Vaginal and uterine tissues fixed for 24 hours were collected and dehydrated stepwise with ethanol solution; cleared twice with xylene, 1 hour each time; then immersed in paraffin in a 60°C oven for 30 minutes, followed by embedding and sectioning, with a section thickness of 5 μm. Partial vaginal and uterine tissue sections were taken, and the endometrial thickness was measured as shown. Figure 5 As shown in the image. HE staining results of vaginal tissue revealed that the vaginal epithelium of the blank control group (CK) mice was covered by squamous epithelial cells with a relatively dense lamina propria; the vaginal epithelium of the model control group (PC) mice was composed of flattened cells, with no squamous epithelial cells observed, and the lamina propria was relatively loose, indicating vaginal atrophy. Simultaneously... Figure 4 , Figure 5 It was found that, compared with the blank control group (CK) and mice, the uterus / body weight ratio of the ovariectomized model control group (PC) mice was significantly lower, and the endometrial thickness was significantly reduced, indicating that the model group mice after ovariectomy developed uterine degenerative lesions. However, the mice in each group supplemented with Lactobacillus gasseri CC214 showed significant improvement in the uterus / body weight ratio and endometrial thickness. At the same time, vaginal mucosal tissue sections showed that the vaginal mucosa of mice in the high-dose Lactobacillus gasseri CC214 group (CC214-H) and the inactivated Lactobacillus gasseri CC214 intervention group (CC214-D) was composed of 7-10 layers of basal cells and squamous epithelial cells, with some keratinized cells and increased vaginal epithelial folds, which also showed a significant improvement compared with the model control group (PC). This indicates that supplementing with Lactobacillus gasseri CC214 can reduce vaginal tissue atrophy, and inactivated Lactobacillus gasseri CC214 has the same effect. Both live Lactobacillus gasseri CC214 and inactivated postbiotics can be used as microbial preparations to intervene in vaginal tissue atrophy.

[0061] Example 10: The intervention effect of Lactobacillus gasseri CC214 on vaginal dryness in perimenopausal women.

[0062] Thirty-six patients were selected based on clinical diagnostic criteria. These patients were perimenopausal, experiencing symptoms such as vaginal dryness, burning, and dyspareunia, accompanied by vaginitis. They had not used any medication within the past month and were able to cooperate with the test. They were randomly divided into an intervention group (PC) and a control group (CK), with 18 patients in each group. The intervention group received one tablet of *Lactobacillus gasseri* CC214 lyophilized powder (compliant with hygiene and safety requirements) inserted into the posterior fornix of the vagina after soaking in water, for 14 consecutive days. The control group received one placebo tablet, also soaked in water and inserted into the posterior fornix of the vagina, for 14 consecutive days. The *Lactobacillus gasseri* CC214 lyophilized powder tablet composition was: 1 part *Lactobacillus gasseri* CC214 lyophilized powder (viable count 5.0 × 10⁻⁶). 8The ingredients were: CFU (carboxylic acid sulfadiazine), 6.9 parts sorbitol, 0.5 parts microcrystalline cellulose, and 0.1 parts magnesium stearate. After thorough mixing, the mixture was directly compressed into 0.5g tablets. The placebo was: Lactobacillus gasseri CC214 lyophilized powder tablets, with the remaining ingredients after removing the Lactobacillus gasseri CC214 lyophilized powder, compressed into 0.5g tablets. The relief of vaginal dryness before and after treatment was compared. The results are shown in Table 2. According to the statistical results, the treatment group showed significant improvement, with an effective rate of 88.9%.

[0063] Table 2. Intervention effects on vaginitis in perimenopausal women (cases)

[0064]

[0065] Example 11 Industrial fermentation of Lactobacillus gasseri CC214

[0066] (1) Culture medium preparation.

[0067] The following is a formulation for industrial-scale high-density fermentation of Lactobacillus gasseri CC214 culture medium: 8 g / L soybean peptone, 12 g / L yeast extract, 8 g / L hydrolyzed whey protein, 12 g / L anhydrous glucose, 4 g / L lactose, 2 g / L dipotassium hydrogen phosphate, 2 g / L diamine hydrogen citrate, 5 g / L sodium acetate, 0.5 g / L manganese sulfate, 0.5 g / L L-cysteine ​​sulfate, and 1 ml / L Tween 80. All raw materials are food-grade.

[0068] (2) Liquid culture

[0069] After preparing the culture medium, adjust the pH to 6.5, sterilize at 115℃ for 30 minutes, and cool to 38℃-39℃. In this example, inoculate the culture medium at a rate of 3%-8%, preferably 5% in the fermenter. The culture temperature is 37℃, and the pH is 6.5. During fermentation, the fermenter is sealed and pressure is maintained using nitrogen, with slow stirring. After 18 hours of continuous culture, the viable cell count in the fermentation broth was measured to be 1.2 × 10⁻⁶ at 12 hours. 8 The viable cell count in the fermentation broth was measured to be 5.1 × 10⁻⁶ CFU / mL at 18 h. 8 The CFU / mL level indicates a relatively high level of viable fermentation cells, meeting the requirements for high-density industrial fermentation production.

[0070] (3) Centrifugation

[0071] To avoid prolonged fermentation leading to bacterial aging and affecting the activity of the freeze-dried powder, the viable cell count was increased to 10 after 18 hours of cultivation. 8 CFU / mL-10 9 CFU / mL, based on OD 600After the growth curve reached the plateau phase, the fermentation broth was quickly cooled to below 15°C and centrifuged at 5000 rpm using a tubular centrifuge to harvest the mycelium sludge.

[0072] (4) Protective agent emulsification

[0073] The harvested mushroom mud is diluted to a water content of 60%-80%, and an equal volume of mushroom mud protectant is added for emulsification. The ingredients of the mushroom mud protectant are: 70% water, 10% skim milk powder, 5% sucrose, 5% mannitol, 1% Tween-80, 3% betaine, and 0.5% monosodium glutamate.

[0074] (5) Vacuum freeze drying

[0075] After emulsification with a preservative, the material is placed in a freeze-drying tray with a bacterial solution thickness of 10 mm. The freeze-drying profile is as follows: the partition temperature is maintained at -50℃ for 4 hours, -48℃ for 2 hours, and -46℃ for 2 hours. Then, the temperature is increased by 4℃ every 2 hours until it reaches 2℃ at the 32nd hour. After that, the temperature is increased by 3℃ every 2 hours until the final maximum temperature of 23℃ remains constant. This temperature is maintained at 23℃ for 2 hours, at which point the vacuum valve is closed, ending the drying process.

[0076] The freeze-dried bacterial powder has an activity level of up to 1.5 × 10⁻⁶. 11 CFU / g can be used to prepare microecological intervention agents.

[0077] The embodiments of the present invention have been described in detail above with reference to specific examples. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention.

Claims

1. A strain of *Lactobacillus gasseri* that can inhibit bacterial growth and alleviate apoptosis of reproductive tract epithelial cells, characterized in that... The Lactobacillus gasseri mentioned is Lactobacillus gasseri CC214, which is deposited at the China Center for Type Culture Collection (CCTCC) on November 20, 2025, with accession number CCTCC NO: M 20252628.

2. A composition, characterized in that, The composition comprises Lactobacillus gasseri CC214 as described in claim 1.

3. The composition according to claim 2, characterized in that, The composition is a lyophilized powder containing *Lactobacillus gasseri* CC214 as described in claim 1; preferably, the activity of the strain in the lyophilized powder is 1 × 10⁻⁶. 10 ~1×10 12 CFU / g.

4. The use of Lactobacillus gasseri CC214 as described in claim 1, or the composition as described in claim 2 or 3, in the preparation of antibacterial agents.

5. The application according to claim 4, characterized in that, The antibacterial agent can inhibit Molybditis laparos, Streptococcus agalactiae, Enterobacter cloacae, and / or Escherichia coli.

6. The use of Lactobacillus gasseri CC214 as described in claim 1, or the composition as described in claim 2 or 3, in the preparation of products that enhance the expression of the sirtuin1 gene in the vaginal mucosa.

7. The use of Lactobacillus gasseri CC214 as described in claim 1, or the composition as described in claim 2 or 3, in the preparation of products that reduce the apoptosis rate of vaginal epithelial cells.

8. The use of Lactobacillus gasseri CC214 as described in claim 1, or the composition as described in claim 2 or 3, in the preparation of products that alleviate vaginal tissue atrophy.

9. The use of Lactobacillus gasseri CC214 as described in claim 1, or the composition as described in claim 2 or 3, in the preparation of products for relieving vaginal dryness.

10. The application according to any one of claims 6-9, characterized in that, The product contains live Lactobacillus gasseri CC214, or a metabiotic containing inactivated Lactobacillus gasseri CC214.

Images