A strain of Avian bacillus paragallinarum and its immunoprotective antigen protein, a vaccine for infectious coryza in chickens, its preparation method and application

Abstract

This invention provides a strain of *Avianobacter paragallinarum* and its immunoprotective antigen protein, a vaccine against infectious coryza in chickens, its preparation method, and its application, specifically belonging to the field of animal vaccine technology. This invention provides a strain of *Avianobacter paragallinarum* LDL-01, which is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2021142 and deposit date of January 22, 2021. The vaccine prepared from *Avianobacter paragallinarum* LDL-01 of this invention can effectively prevent infection with *Avianobacter paragallinarum* type B, with a high protection rate, and can effectively protect chicken flocks against different prevalent *Avianobacter paragallinarum* types. The subunit vaccine prepared from the recombinant strain constructed based on the protective antigen of LDL-01 has no endotoxins removed after antigen purification, resulting in no adverse reactions in chickens after immunization, and eliminating the biosafety risks caused by incomplete inactivation.

Description

Technical Field

[0001] This invention belongs to the field of animal vaccine technology, specifically relating to a strain of Avianella paragallinarum and its immunoprotective antigen protein, a chicken infectious coryza vaccine, its preparation method, and its application. Background Technology

[0002] avian parafowl cholera ( Avibacterium paragallinarum *Avianobacterium paragallinarum* (Apg) is a Gram-negative bacterium belonging to the Pasteuraceae family. It is non-motile, and virulent strains often have capsules. This bacterium is facultatively anaerobic; it does not require CO2 supplementation in liquid culture, but requires an anaerobic environment or 3-10% CO2 by volume for growth on solid media. *Avianobacterium paragallinarum* has high nutritional requirements and cannot grow on general culture media, and its growth rate is slow. In vitro culture generally requires the addition of factor V (nicotinamide adenine dinucleotide, NAD), but factor V-independent strains of *Avianobacterium paragallinarum* have also been reported. When cultured on chicken broth agar for 18-24 hours, it forms round, smooth, grayish-white, semi-transparent dew-like colonies. When cross-streaked with *Staphylococcus aureus* on blood agar, a "satellite phenomenon" can be observed.

[0003] Avian bacillus can cause infectious coryza (IC) in chickens, an acute upper respiratory tract infection. Clinical manifestations in infected chickens include facial swelling, tearing, runny nose, and reduced feed intake. Because this disease slows chicken growth and reduces egg production in laying hens, it has a significant impact on the global poultry industry.

[0004] Vaccination is the most effective measure for preventing and controlling this disease. Currently, the main vaccines used on the market are bivalent or trivalent inactivated vaccines for infectious coryza in chickens, whose immunizing effect is closely related to the number of live bacteria during fermentation. Therefore, sufficient antigen is needed to provide adequate protection to the flock. During the preparation of whole-cell inactivated vaccines, if the harvest time is not properly controlled, bacterial death can release large amounts of endotoxins, causing a series of side effects in chickens after vaccination, such as decreased appetite, lethargy, and swelling at the injection site. To address these issues, research is needed to develop a safer and more effective infectious coryza vaccine for chickens. Summary of the Invention

[0005] The purpose of this invention is to provide a strain of *Avianobacterium paragallinarum* and its immunoprotective antigen protein, a chicken infectious coryza vaccine, its preparation method, and its application. The chicken infectious coryza vaccine prepared using *Avianobacterium paragallinarum* or its immunoprotective antigen protein of this application does not cause stress in chickens and provides good protection for the flock.

[0006] This invention provides a strain of *Avianobacterium paragallinarum* (… Avibacterium paragallinarumLDL-01, the *Avianobacterium paragallinarum* LDL-01, is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2021142 and deposit date of January 22, 2021.

[0007] The present invention also provides the application of the above-described avian bacillus paragallinarum LDL-01 in the preparation of a vaccine for infectious coryza in chickens.

[0008] Preferably, the infectious coryza vaccine for chickens includes a whole-cell inactivated vaccine or a subunit vaccine.

[0009] The present invention also provides an immunoprotective antigen protein of Avian bacillus paragallinarum LDL-01, the amino acid sequence of which is shown in SEQ ID NO.2.

[0010] The present invention also provides a gene encoding an immunoprotective antigen protein of Avian bacillus paragallinarum LDL-01, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0011] The present invention also provides a recombinant plasmid containing the coding gene described in the above technical solution.

[0012] The present invention also provides a recombinant expression strain, comprising the recombinant plasmid described in the above technical solution.

[0013] The present invention also provides the application of the LDL-01 immunoprotective antigen protein of *Avianobacterium paragallinarum* described in the above technical solution, or the encoding gene described in the above technical solution, or the recombinant plasmid described in the above technical solution, or the recombinant expression strain described in the above technical solution, in the preparation of a vaccine for infectious coryza in chickens.

[0014] The present invention also provides a vaccine for infectious coryza in chickens, comprising a whole-cell inactivated vaccine or a subunit vaccine; the whole-cell inactivated vaccine is prepared from inactivated *Avianobacterium paragallinarum* LDL-01 as described in the above-mentioned technical solution and pharmaceutically acceptable excipients; the subunit vaccine is prepared from the *Avianobacterium paragallinarum* LDL-01 immunoprotective antigen protein as described in the above-mentioned technical solution and pharmaceutically acceptable excipients.

[0015] This invention also provides a method for preparing the infectious coryza vaccine for chickens described in the above technical solution. When the infectious coryza vaccine for chickens is a whole-bacterial inactivated vaccine, the preparation method includes the following steps: The *Avian bacillus paragallinarum* LDL-01 cultured according to the above technical solution was inactivated to obtain inactivated antigen; the inactivated antigen was mixed with pharmaceutically acceptable excipients to obtain whole-cell inactivated vaccine; When the chicken infectious coryza vaccine is a subunit vaccine, the preparation method includes the following steps: A recombinant plasmid expressing the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01 as described in the above technical solution was constructed; the recombinant plasmid was transformed into a host bacterium to obtain a recombinant expression strain; the recombinant expression strain was cultured, induced to express, and purified to obtain the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01; the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01 was mixed with pharmaceutically acceptable excipients to obtain a subunit vaccine for infectious coryza in chickens.

[0016] This invention provides a strain of *Avianobacterium paragallinarum* LDL-01. The vaccine prepared from *Avianobacterium paragallinarum* LDL-01 of this invention can effectively prevent infection with *Avianobacterium paragallinarum* type B, with a high protection rate, and can effectively protect chicken flocks against different prevalent *Avianobacterium paragallinarum* types.

[0017] This invention further provides an immunoprotective antigen protein for *Avianobacter paragallinarum* LDL-01. Subunit vaccines prepared using this protein do not cause adverse reactions in chickens and provide good protection against various *Avianobacter paragallinarum* variants. The antigen is purified to remove endotoxins, resulting in no adverse reactions in chickens after immunization, and eliminating any biosafety risks caused by incomplete inactivation. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 Figure showing the results of molecular phylogenetic analysis; Figure 2 The nucleic acid map of the PCR amplification product of the region2 gene of type B HA protein provided by this invention; Figure 3 The SDS-PAGE analysis results of the recombinant protein P2 expression product provided by this invention are shown in the figure. Figure 4 The Western blotting analysis results of recombinant protein P2 provided by this invention are shown in the figure. Figure 5 The image shows the SDS-PAGE analysis results of each collected fraction of the recombinant protein P2 obtained by affinity chromatography purification according to the present invention.

[0020] Biological Preservation Information avian parafowl cholera ( Avibacterium paragallinarumLDL-01 (serum type B) is deposited at the China Center for Type Culture Collection (CCTCC) on January 22, 2021. The address is Wuhan University, Wuhan, China, and the accession number is CCTCC NO: M 2021142. Detailed Implementation

[0021] This invention provides a strain of *Avianobacterium paragallinarum* (… Avibacterium paragallinarum LDL-01, the *Avianobacter paragallinarum* LDL-01 strain described in this invention, is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2021142, and the deposit date is January 22, 2021. When cultured on chicken broth agar or tryptone-soybean agar, the *Avianobacter paragallinarum* LDL-01 colonies are round, smooth, grayish-white, and translucent like dewdrops. Under low magnification at 45 degrees refractive index, they exhibit strong fluorescence. When crossed with *Staphylococcus aureus*, satellite colonies grow. Microscopic examination reveals that it is Gram-negative, a short bacillus or coccus. Biochemical identification of the strain culture showed negative results for catalase and glucosidase tests, and positive results for oxidase and nitrate reduction tests. It can ferment maltose and sorbitol, but does not ferment D-galactose, trehalose, ONPG, or mannitol, consistent with the biochemical characteristics of *Avianobacter paragallinarum*.

[0022] This invention also provides the application of *Avianobacterium paragallinarum* LDL-01 described in the above-mentioned technical solution in the preparation of a vaccine for infectious coryza in chickens. In a specific embodiment, the infectious coryza vaccine for chickens includes a whole-cell inactivated vaccine or a subunit vaccine. Experimental results show that the whole-cell inactivated vaccine and subunit vaccine of this invention have protective effects against chicken flocks infected with different types of *Avianobacterium paragallinarum*, and can effectively prevent infection by *Avianobacterium paragallinarum*.

[0023] This invention also provides an immunoprotective antigen protein for *Avianobacter paragallinarum* LDL-01, the amino acid sequence of which is shown in SEQ ID NO.2. The vaccine prepared from the immunoprotective antigen protein of this invention can effectively prevent infection with *Avianobacter paragallinarum* type B, with a high protection rate. It can effectively protect chicken flocks against different prevalent *Avianobacter paragallinarum* types. Furthermore, the antigen is purified to remove endotoxins, resulting in no adverse reactions in chickens after immunization, and eliminating any biosafety risks caused by incomplete inactivation.

[0024]

[0025] This invention also provides a recombinant plasmid containing the coding gene described in the above-described technical solution. In a specific embodiment, the recombinant plasmid is constructed using a basic plasmid. In a specific embodiment, the basic plasmid includes pET-32a.

[0026] This invention also provides a recombinant expression strain, comprising the recombinant plasmid described in the above-described technical solution. In a specific embodiment, the recombinant bacterium is constructed from a host bacterium. In a specific embodiment, the host bacterium includes *Escherichia coli*.

[0027] The present invention also provides the application of the LDL-01 immunoprotective antigen protein of *Avianobacterium paragallinarum* described in the above technical solution, or the encoding gene described in the above technical solution, or the recombinant plasmid described in the above technical solution, or the recombinant expression strain described in the above technical solution, in the preparation of a vaccine for infectious coryza in chickens.

[0028] This invention also provides a vaccine for infectious coryza in chickens, comprising a whole-cell inactivated vaccine or a subunit vaccine: the whole-cell inactivated vaccine is prepared from inactivated *Avianobacterium paragallinarum* LDL-01 as described in the above-mentioned technical solution and pharmaceutically acceptable excipients; the subunit vaccine is prepared from the *Avianobacterium paragallinarum* LDL-01 immunoprotective antigen protein as described in the above-mentioned technical solution and pharmaceutically acceptable excipients. In a specific embodiment, the excipients include white oil adjuvants. In a specific embodiment, the white oil adjuvants include Marcol 52 white oil and Total white oil.

[0029] This invention also provides a method for preparing the infectious coryza vaccine for chickens described in the above technical solution. When the infectious coryza vaccine for chickens is a whole-bacterial inactivated vaccine, the preparation method includes the following steps: The *Avian bacillus paragallinarum* LDL-01 cultured according to the above technical solution was inactivated to obtain inactivated antigen; the inactivated antigen was mixed with pharmaceutically acceptable excipients to obtain whole-cell inactivated vaccine; When the chicken infectious coryza vaccine is a subunit vaccine, the preparation method includes the following steps: A recombinant plasmid expressing the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01 as described in the above technical solution was constructed; the recombinant plasmid was transformed into a host bacterium to obtain a recombinant expression strain; the recombinant expression strain was cultured, induced to express, and purified to obtain the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01; the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01 was mixed with pharmaceutically acceptable excipients to obtain a subunit vaccine for infectious coryza in chickens.

[0030] When the chicken infectious coryza vaccine is a whole-cell inactivated vaccine, the present invention inactivates the *Avian bacillus paragallinarum* LDL-01 cultured according to the above-mentioned technical solution to obtain inactivated antigen. The present invention does not have specific limitations on the culture method; fermentation is sufficient. The viable bacterial concentration is 8 × 10⁻⁶. 9 When CFU / ml or higher, this invention performs inactivation. This invention does not specifically limit the inactivation method; formaldehyde can be used for inactivation. Specifically, formaldehyde at a final concentration of 3‰ can be used for inactivation at 37°C for 24 hours.

[0031] After obtaining the inactivated antigen, the present invention mixes the inactivated antigen with a pharmaceutically acceptable excipient to obtain a whole-strain inactivated vaccine. In a specific embodiment, the excipient may be a white oil adjuvant. When the excipient is a white oil adjuvant, the volume ratio of the inactivated antigen to the white oil adjuvant may be 1:3.

[0032] When the chicken infectious coryza vaccine is a subunit vaccine, this invention constructs a recombinant plasmid expressing the LDL-01 immunoprotective antigen protein of *Avianobacter paragallinarum* described in the above technical solution. In a specific embodiment, pET-32a is used to construct the recombinant plasmid. This invention does not impose any special limitations on the construction method; conventional methods can be used.

[0033] After obtaining the recombinant plasmid, the present invention transforms the recombinant plasmid into a host bacterium to obtain a recombinant expression strain. In a specific embodiment, the host bacterium is *Escherichia coli*. The present invention does not specifically limit the transformation method; a conventional heat shock transformation method is sufficient.

[0034] After obtaining the recombinant expression strain, the present invention cultured, induced expression, and purified the recombinant expression strain to obtain the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01. In a specific embodiment, the culture temperature was 35-40℃, specifically 37℃. In a specific embodiment, OD... 600 To achieve a concentration of 0.4–0.6, IPTG is used for induction. In a specific embodiment, the final IPTG concentration for induction is 0.5–2.0 mmol / L, specifically 0.5 mmol / L; the induction temperature is 25–35°C, specifically 30°C; the induction rotation speed is 150–220 r / min, specifically 180 r / min; and the induction time is 8–16 h, specifically 12 h. In a specific embodiment, the purification method includes purification using nickel column affinity chromatography. In a specific embodiment, the purification uses imidazole elution. In a specific embodiment, the concentration of the eluting imidazole is 200–500 mM, specifically 500 mM.

[0035] After obtaining the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01, this invention mixes the *Avianobacter paragallinarum* LDL-01 immunoprotective antigen protein with pharmaceutically acceptable excipients to obtain a subunit vaccine for infectious coryza in chickens. In a specific embodiment, the excipients include white oil adjuvants. In a specific embodiment, the white oil adjuvants include Marcol 52 white oil and Total white oil. In a specific embodiment, the final concentration of recombinant protein in the vaccine is 25-50 μg / ml, specifically 45 μg / ml.

[0036] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a strain of Avianella paragallinarum and its immunoprotective antigen protein, a chicken infectious coryza vaccine, its preparation method, and its application. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0037] Example 1 Isolation and Identification of Avian bacillus paragallinarum LDL-01 strain 1.1 Isolation and Cloning Culture of Strains The sick chickens were euthanized, the infraorbital sinus was aseptically cut open, and the contents of the infraorbital sinus were collected with a sterile cotton swab and streaked on tryptone soy agar (TSA) plates. The plates were incubated at 37°C and 5% CO2 for 24-48 hours. Single colonies were picked and streaked again on TSA plates. This operation was repeated twice to obtain purer single colonies. The cloned strain was named LDL-01.

[0038] 1.2 PCR identification and sequencing analysis of the strain Single colonies from TSA plates were inoculated into tryptone soybean broth (TSB) medium and cultured at 37°C with shaking at 180 rpm for 10 h. Total nucleic acid was extracted from the strain using a nucleic acid extraction kit, and PCR amplification was performed using universal 16S rDNA primers. The amplified products were purified and recovered, and then sent for sequencing analysis. BLAST alignment results showed that the strain was *Bacillus paragallinarum*.

[0039] Based on this, phylogenetic analysis was performed on 24 HMTp2 nucleotide sequences (including HMTp210 region 1 and HMTp210 HVR tandem sequences) of *Avianobacter paragallinarum* using MEGA 7.0 software to clarify the genotype classification of strain LDL-01. The results showed that strain LDL-01 clustered with the B1 genotype reference strain Spross (ON937744.1) in the same evolutionary branch, with a node bootstrapping support rate of 96%, indicating high homology between the two. Simultaneously, this strain formed an independent subgroup with B1 XI subtype strains (such as 2671 and 0222), showing significant genetic differentiation from genotypes A and C, confirming its B1 genotype and its unique evolutionary branching characteristics within the B1 subtype. Figure 1 (Results of molecular phylogenetic analysis).

[0040] In addition, serotyping of LDL-01 strain using the hemagglutination inhibition method showed that its serotype was B, which was consistent with the results of molecular phylogenetic analysis.

[0041] 1.3 Biological characteristics of the strain The strain, after being cultured at 37°C for 24 hours in 5% CO2, formed round, smooth, grayish-white, semi-transparent dew-like colonies approximately 0.3 mm in diameter on TSA agar plates. These colonies exhibited strong fluorescence under low magnification at a 45-degree refractive index. Single colonies from the TSA plates were streaked with Staphylococcus aureus on NAD-free blood agar plates and cultured at 37°C for 24 hours in 5% CO2. Satellite colonies grew around the Staphylococcus aureus. Gram staining of the colony cultures revealed Gram-negative results, indicating short or cocci. Biochemical identification of the strain showed negative results for catalase and glucosidase tests, but positive results for oxidase and nitrate reduction tests. The strain can ferment maltose and sorbitol, but not D-galactose, trehalose, ONPG, or mannitol, consistent with the biochemical characteristics of *Bacillus paragalacti*. The results are as follows: Table 1 Biochemical reaction results of Apg LDL-01 strain

[0042] Note: "+" indicates positive, and "-" indicates negative.

[0043] 1.4 Establishment of the pathogenesis model Fresh culture medium of Avian bacillus paragallinarum LDL-01 strain was subjected to 10 mol / L in physiological saline. 2 times, 10 3 times, 10 4 Multiplied by 10 5 The bacterial solution was diluted 10 times, and each diluted solution was injected into the infraorbital sinus of 10 65-day-old SPF chickens. 0.1 ml was injected into each of the two infraorbital sinuses of each SPF chicken. A control group of 10 SPF chickens without challenge was also included, and all were isolated and raised under the same conditions. After challenge, clinical symptoms such as nasal discharge and swelling of the infraorbital sinus and surrounding face were observed daily for 7 consecutive days. Results showed that 10 4 When diluted and challenged with a dose of 22,500 CFU / bird or higher, the morbidity rate in chickens was 10 / 10.

[0044] Fresh bacterial culture of *Avianobacter paragallinarum* strain LDL-01 was cultured again and serially diluted 10-fold to millions of times with physiological saline, followed by 4-fold serial dilutions. Ten 70-day-old SPF chickens were injected intraorbitally into each infraorbital sinus (0.1 ml on each side) at each dilution. A control group of ten SPF chickens without challenge was also included, and all were isolated and housed under the same conditions. Clinical symptoms such as nasal discharge and swelling of the infraorbital sinus and surrounding face were observed daily for 7 consecutive days after challenge. Results showed that 10 out of 10 chickens in the 52,000 CFU / bird and 13,000 CFU / bird dose groups developed the disease, 8 out of 10 chickens in the 3,250 CFU / bird dose group developed the disease, and 7 out of 10 chickens in the 813 CFU / bird dose group developed the disease.

[0045] Table 2. Statistical analysis of disease incidence after challenge with 10-fold serially diluted bacterial suspensions.

[0046] Table 3. Statistical analysis of disease outcomes after challenge with bacterial suspensions diluted 10-fold and then 4-fold.

[0047] The results of the two challenge experiments showed that the minimum challenge dose for 10 / 10 chickens to develop the disease was 13,000 CFU / bird. For later challenge experiments and immune challenge protection experiments, a dose close to five times the minimum disease-causing dose (i.e., 50,000 CFU / bird) could be selected for challenge.

[0048] Example 2 1. Protein Design The coding gene for region 2 of the HA protein of B-type Avian bacillus paragallinarum strain LDL-01 was sequenced, and the corresponding nucleotide sequence was obtained, as shown in SEQ ID NO.1. The nucleotide sequence was amplified, and the target gene fragment was ligated into the pET-32a vector by BamHI and HindIII restriction enzyme sites to obtain a recombinant protein that is easy to express in prokaryotes and has strong immunogenicity, called recombinant protein P2, whose amino acid sequence is shown in SEQ ID NO.2.

[0049] The nucleotide sequence of the gene encoding region2 (1608 bp) of the HA protein is shown in SEQ ID NO.1:

[0050] The amino acid sequence of recombinant protein P2 (536aa) is shown in SEQ ID NO.2: .

[0051] 2. Carrier Construction 2.1 Primer Synthesis Upstream and downstream primers (P2-F and P2-R) were designed based on the target gene sequence, and BamHI and HindIII restriction sites were introduced into the upstream and downstream primers for amplification of the target gene.

[0052] The primer nucleotide sequences are as follows: P2-F: CGCGGATCCGGCACAATTACATTTACAAA (SEQ ID NO. 3).

[0053] P2-R: CGGAAGCTTACCTTGAGTGCTAGATGCTGTA (SEQ ID NO. 4).

[0054] 2.2 PCR amplification of the target gene Using *Avianella paragallinarum* DNA as a template, Taq polymerase and Mg2+ were added. 2+The dNTP mixture and upstream and downstream primers were used for PCR amplification according to the following procedure.

[0055] PCR procedure: Pre-denaturation: 95℃ for 10 min; Denaturation: 95℃ for 45s, Annealing: 65℃ for 45s, Extension: 72℃ for 45s, 35 cycles; Further extension: 72℃: 10min.

[0056] After the reaction was completed, the amplification products were detected by agarose gel electrophoresis.

[0057] Figure 2 This is a nucleic acid map of the PCR amplification product of the region2 gene of type B HA protein. Figure 2 As shown, the size of the amplification product is consistent with the size of the target gene fragment. The target gene fragment was recovered using a DNA gel recovery kit (OMEGA).

[0058] 2.3 Enzyme digestion of PET-32a empty vector and target gene fragment Enzyme digestion system: BamHI: 5 μl; HindⅢ: 5μl; Buffer: 2μl; PCR product: 200 ng or PET-32a empty vector: 1 μg; Water: 12 μl; Both systems were reacted in a 37°C water bath for 2 hours. The digested fragments were then recovered using a DNA gel extraction kit.

[0059] 2.4 Ligation of the target gene fragment with the vector The target gene fragment recovered after enzyme digestion was ligated with the pET-32a(+) linear vector using T4 DNA ligase to obtain the recombinant plasmid pET-32a-P2.

[0060] 2.5 Transformation and screening of positive clones Add 50 μl of *E. coli* DH5α competent cells to a 1.5 ml EP tube, add 2 μl of recombinant plasmid pET-32a-P2 and mix well. Incubate at 4°C for 30 min, then heat shock at 42°C for 1 min, and finally place on an ice box for 2 min. Add 600 μl of antibiotic-free LB medium and incubate at 37°C with shaking at 150 rpm for 45 min to revive the cells. Centrifuge the revived *E. coli* culture at 4°C and 6000 rpm for 10 min, discard 500 μl of supernatant, resuspend the bacterial pellet in the remaining 100 μl and spread it onto a solid plate containing ampicillin. Spread evenly with a glass rod and incubate overnight until colonies appear.

[0061] 2.6 Identification of recombinant plasmids by sequencing Several single colonies grown on the plates from step 2.5 were picked and inoculated into 5 ml of LB liquid medium containing ampicillin resistance, and incubated overnight at 37°C and 180 rpm. 2 ml of the bacterial culture was transferred to a 2 ml centrifuge tube and centrifuged at 4°C and 8000 rpm for 1 min. The remaining 3 ml of bacterial culture was then centrifuged again, the supernatant was discarded, and the recombinant plasmid was extracted using a plasmid extraction kit.

[0062] The extracted recombinant plasmid was sent to Sangon Biotech for sequencing and identification. The sequencing results confirmed the target gene sequence was correct, confirming it as the correct recombinant plasmid pET32a-P2.

[0063] 3. Construction of recombinant expression strains Add 50 μl of competent BL21(DE3) cells to a 1.5 ml EP tube. Add 2 μl of the correctly identified recombinant plasmid pET32a-P2 to the competent cells. Incubate at 4°C for 30 min, then heat shock at 42°C for 1 min, and finally place on an ice box for 2 min. Add 600 μl of antibiotic-free LB medium and incubate at 37°C with shaking at 150 rpm for 45 min to revive the cells. Centrifuge the revived E. coli culture at 4°C and 6000 rpm for 10 min, discard 500 μl of supernatant, and resuspend the bacterial pellet in the remaining 100 μl. Spread the pellet onto a solid plate containing ampicillin antibiotics, spread evenly with a glass rod, and incubate overnight until colonies appear, indicating successful transformation.

[0064] 4. Protein expression and antigenicity analysis 4.1 Induction of target gene expression The pET32a-P2 recombinant expression strain was inoculated into 5 ml of LB liquid medium containing 10 μg / ml ampicillin resistance and cultured overnight at 37°C with shaking. 2 ml of the cultured bacterial solution was then inoculated into 100 ml of fresh LB medium containing 10 μg / ml ampicillin resistance and cultured at 37°C with shaking for 3 hours until OD (digesterone) was observed. 600 After reaching the concentration range of 0.4-0.6, add IPTG to a final concentration of 0.5 mmol / L, and induce culture at 30℃ and 180 r / min for 12 h.

[0065] 4.2 SDS-PAGE analysis of the expression product The induced recombinant E. coli were centrifuged at 8000 rpm for 15 min, and the precipitate was resuspended in an equal volume of 20 mmol / L NaH2PO4 solution and homogenized using a high-pressure homogenizer. 100 μl of the lysed stock solution, supernatant, and precipitate were added to 25 μl of SDS loading buffer, vortexed to mix, boiled at 100 °C for 10 min, centrifuged at 12000 rpm for 5 min, and analyzed by SDS-PAGE. Figure 3 The image shows the SDS-PAGE analysis results of the recombinant protein P2 expression product. In the image, M represents the marker; 1 represents the original recombinant protein P2 homogenized solution; 2 represents the supernatant from the homogenized recombinant protein P2; and 3 represents the precipitate from the homogenized recombinant protein P2. Figure 3 As shown, lanes 1 and 2 have very thick bands at 70KD, while lane 3 has a very light band. This indicates that the target protein is almost entirely in the lysis supernatant, while very little protein is found in the lysis precipitate.

[0066] 4.3 Antigenicity analysis of recombinant proteins The fragmented recombinant protein P2 was analyzed by Western blotting. Figure 4 The results are from Western blotting analysis of recombinant protein P2; where M: Marker; 1: High-pressure homogenized recombinant protein P2 stock solution; 2: High-pressure homogenized supernatant of recombinant protein P2; 3: High-pressure homogenized precipitate of recombinant protein P2. Figure 4 As shown, lanes 1 and 2 have thick bands at 70KD, while lane 3 has a very light band. This indicates that the recombinant plasmid was accurately expressed, the protein size was as expected, and the recombinant protein P2 was mainly distributed in the lysate supernatant.

[0067] 5. Purification of recombinant proteins Based on the principle of nickel column affinity chromatography, the supernatant of bacterial cells after high-pressure homogenization was purified by gradient elution with imidazole at concentrations of 40mM, 80mM, 200mM and 500mM. Figure 5 SDS-PAGE analysis results of each collected fraction from affinity chromatography purification of recombinant protein P2; where 1: Marker; 2: Sample before purification; 3: Flow-through buffer; 4: 200 mM imidazole elution product; 5: 40 mM imidazole elution product; 6: 500 mM imidazole elution product; 7: 80 mM imidazole elution product. Figure 5 As shown, 40mM imidazole eluted contaminating proteins; 80mM imidazole eluted only a small amount of the target protein, which was still mixed with other proteins; 200mM and 500mM imidazole eluted the target protein as the main component. To obtain a higher concentration of the target protein, 500mM imidazole was ultimately chosen for elution, as this concentration yielded the best elution effect. Through this purification step, recombinant protein P2 with high purity was finally obtained.

[0068] 6. Immunogenicity test of recombinant protein in SPF chickens 6.1 Vaccine Preparation 6.1.1 Preparation of Recombinant Protein Vaccines Recombinant protein P2 was mixed with white oil adjuvant at a volume ratio of 1:3. The white oil adjuvant was a mixture of Marcol 52 white oil and Total white oil at a volume ratio of 1:1. The final concentration of recombinant protein P2 in the vaccine was 45 μg / ml.

[0069] 6.1.2 Preparation of whole-strain inactivated vaccine After fermentation culture of *Avianella paragallinarum* strain LDL-01 (culture preservation number: CCTCC NO: M 2021142) for 6 hours, the viable count was determined. The bacteria were then inactivated with formaldehyde at a final concentration of 3‰ at 37℃ for 24 hours. The inactivated antigen was harvested and then mixed with white oil adjuvant at a volume ratio of 1:3 to achieve a pre-inactivation viable count of 2 × 10⁻⁶ in the vaccine. 9 CFU / ml.

[0070] 6.2 Immunogenicity assay of vaccine Sixty 8-week-old SPF chickens were randomly divided into three groups of 20 each: a recombinant protein P2 immunization group, a whole-cell inactivated vaccine immunization group, and a challenge control group. Each chicken in the immunization group received a subcutaneous injection of 0.5 ml of vaccine in the neck, while the challenge control group received no immunization. Twenty-eight days later, all chickens received an injection of bacterial solution via the infraorbital sinus, 0.1 ml per side (0.2 ml / chicken total). Ten chickens in each group received HN5 strain bacterial solution (challenge dose: 10,000 CFU / chicken), and ten chickens received LDL-01 strain bacterial solution (challenge dose: 50,000 CFU / chicken). Chickens were observed for seven consecutive days after challenge, and the appearance of either facial swelling or nasal discharge was considered indicative of disease. As shown in Table 4, the recombinant protein P2 immunization group and the whole-cell inactivated vaccine immunization group showed the same protective effect, with a protection rate of 10 / 10 against LDL-01 strain and a protection rate of 9 / 10 against HN5 strain.

[0071] Table 4. Immunogenicity assays for recombinant protein P2 vaccine and whole-cell inactivated vaccine.

[0072] In this invention, both the vaccine prepared from recombinant protein P2 and the whole-cell inactivated vaccine can effectively protect chicken flocks against multiple prevalent strains of Avianobacterium type B, such as HN5 and LDL-01, thereby effectively preventing infection with Avianobacterium type B. Furthermore, the subunit vaccine antigen is purified to remove endotoxins, resulting in no adverse reactions in chickens after immunization, and there are no biosafety risks arising from incomplete inactivation.

[0073] Although the above embodiments have provided a detailed description of the present invention, they are only some, not all, embodiments of the present invention. Other embodiments obtained by those skilled in the art based on these embodiments without inventive effort are all within the scope of protection of the present invention.

Claims

1. A strain of avian parafowlctomyces ( Avibacterium paragallinarum LDL-01, characterized in that, The *Avianobacter paragallinarum* LDL-01 strain is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2021142 and deposit date of January 22, 2021.

2. The use of the *Avianobacterium paragallinarum* LDL-01 as described in claim 1 in the preparation of a vaccine for infectious coryza in chickens.

3. The application according to claim 2, characterized in that, The infectious coryza vaccine for chickens includes whole-cell inactivated vaccines or subunit vaccines.

4. An immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01, characterized in that, The amino acid sequence of the antigen protein is shown in SEQ ID NO.

2.

5. A gene encoding an immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

1.

6. A recombinant plasmid, characterized in that, It contains the encoding gene as described in claim 5.

7. A recombinant expression strain, characterized in that, Includes the recombinant plasmid as described in claim 6.

8. The use of the LDL-01 immunoprotective antigen protein of *Avianobacterium paragallinarum* according to claim 4, or the encoding gene according to claim 5, or the recombinant plasmid according to claim 6, or the recombinant expression strain according to claim 7 in the preparation of a vaccine for infectious coryza in chickens.

9. A vaccine for infectious coryza in chickens, characterized in that, This includes whole-cell inactivated vaccines or subunit vaccines; the whole-cell inactivated vaccine is prepared from inactivated *Avianobacterium paragallinarum* LDL-01 as described in claim 1 and pharmaceutically acceptable excipients; the subunit vaccine is prepared from the *Avianobacterium paragallinarum* LDL-01 immunoprotective antigen protein as described in claim 4 and pharmaceutically acceptable excipients.

10. The method for preparing the infectious coryza vaccine for chickens according to claim 9, characterized in that, When the infectious coryza vaccine for chickens is a whole-bacterial inactivated vaccine, the preparation method includes the following steps: The cultured *Avian bacillus paragallinarum* LDL-01 as described in claim 1 was inactivated to obtain an inactivated antigen; the inactivated antigen was mixed with pharmaceutically acceptable excipients to obtain a whole-cell inactivated vaccine; When the chicken infectious coryza vaccine is a subunit vaccine, the preparation method includes the following steps: A recombinant plasmid expressing the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01 as described in claim 4 was constructed; the recombinant plasmid was transformed into a host bacterium to obtain a recombinant expression strain; the recombinant expression strain was cultured, induced to express, and purified to obtain the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01; the immunoprotective antigen protein of *Avianobacter paragallinarum* LDL-01 was mixed with pharmaceutically acceptable excipients to obtain a subunit vaccine for infectious coryza in chickens.

Images