A high-cellulase-producing Bacillus subtilis mutant and its application
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-03
- Publication Date
- 2026-08-14
AI Technical Summary
但自然筛选的芽孢杆菌普遍存在纤维素酶产量偏低、降解效率不足等问题,难以满足工业化应用需求
(1)本发明首次采用常压室温等离子体(ARTP)诱变技术与高通量筛选相结合的方法,成功获得了一株高产纤维素酶、遗传稳定性好、适配糟渣发酵的枯草芽孢杆菌突变株Bacillus subtilisA5;提供的筛选方法操作简单、效率高,可快速获得正向突变高产菌株;
Smart Images

Figure CN122563822A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a high-cellulase-producing Bacillus subtilis mutant strain and its applications. Background Technology
[0002] The annual output of brewing residues such as baijiu (Chinese liquor) lees and vinegar lees is enormous. Rich in crude protein, crude fat, amino acids, and various minerals, these residues have high feed value and represent a significant unconventional feed resource. However, most of these residues are disposed of in the open through dumping, landfilling, or incineration, resulting in a severe waste of renewable biological resources such as protein and cellulose, as well as generating large amounts of greenhouse gases and leachate, polluting soil, water sources, and the atmosphere. In the context of ecological civilization construction, how to efficiently convert these abundant residue resources into feed and achieve the resource utilization of waste biomass has become an urgent industrial challenge.
[0003] Because brewing residues such as baijiu lees and vinegar lees generally have a high crude fiber content, the abundant fiber can provide a feeling of fullness and stimulate intestinal peristalsis in animals, but excessive content can reduce palatability. These residues also contain anti-nutritional factors such as non-starch polysaccharides, which hinder the digestion and absorption of other nutrients by animals. Furthermore, residual methanol and ethanol can cause poisoning in animals, damaging their health and reproductive capacity. Microbial fermentation can effectively degrade these anti-nutritional factors, toxic substances, and crude fiber through microbial metabolism, converting them into usable nutrients, achieving a detoxification effect and significantly improving feed safety.
[0004] Bacillus species possess advantages such as rapid growth, strong resistance to adverse conditions, and stable enzyme production, making them widely used in the field of cellulose degradation. However, naturally selected Bacillus species generally suffer from low cellulase yield and insufficient degradation efficiency, making it difficult to meet the demands of industrial applications. Therefore, actively developing / screening Bacillus mutant strains with high cellulase production, good genetic stability, and suitability for fermentation of brewing waste is of great significance for improving the resource utilization rate of brewing waste and promoting cost reduction and efficiency improvement of feed raw materials. Summary of the Invention
[0005] The purpose of this invention is to provide a Bacillus subtilis mutant strain with high cellulase production and its application, providing a new Bacillus subtilis mutant strain with higher cellulase activity, better genetic stability, and suitability for fermentation of lees.
[0006] To achieve the above objectives, the present invention provides a Bacillus subtilis mutant strain that produces high levels of cellulase. Bacillus subtle A5 was deposited on April 20, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No:68128, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0007] The above-mentioned high-cellulase-producing Bacillus subtilis mutant strain Bacillus subtilis Application of A5 in the degradation of waste residue.
[0008] Preferably, the residue includes corn vinegar residue and liquor residue.
[0009] A residue degradation agent, wherein the residue degradation agent contains the above-mentioned high-cellulase-producing Bacillus subtilis mutant strain. Bacillus subtilis A5; lees include corn vinegar lees and liquor lees.
[0010] Preferably, the residue degradation agent further includes one of Bacillus subtilis, yeast, and enzyme.
[0011] Preferably, the enzyme is cellulase Cellic CTec3 HS.
[0012] Preferably, the yeast is Meyerozyma caribbica XX2120, strain number GDMCC No:67777, was deposited on February 2, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0013] The method for degrading sludge using the sludge degradation agent described above is as follows: fermentation in a shaker at 37°C, pH 5-7, and 150-200 r / min for 2-5 days.
[0014] Therefore, the present invention provides a high-cellulase-producing Bacillus subtilis mutant strain and its application, the specific technical effects of which are as follows: (1) This invention is the first to use a combination of ambient pressure room temperature plasma (ARTP) mutagenesis technology and high-throughput screening to successfully obtain a Bacillus subtilis mutant strain that produces high cellulase, has good genetic stability, and is suitable for fermentation of lees. Bacillus subtilis A5; The screening method provided is simple to operate and highly efficient, and can quickly obtain high-yield strains of positive mutation; (2) The Bacillus subtilis mutant strain with high cellulase production provided by the present invention Bacillus subtilis A5 was deposited on April 20, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 68128, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. (3) The Bacillus subtilis mutant strain with high cellulase production provided by the present invention Bacillus subtilis A5 showed a 39% increase in cellulase activity compared to the starting strain, resulting in a significant improvement in enzyme production efficiency. It can also significantly degrade neutral detergent fiber (NDF) in corn vinegar residue and liquor residue, thereby increasing the level of true protein. (4) The Bacillus subtilis mutant strain with high cellulase production provided by the present invention Bacillus subtilis A5 exhibits stable traits after five consecutive generations of subculturing. It can also collaborate with other strains / creatures and cellulases to significantly enhance reducing sugar release, cellulase activity, and true protein levels. It has flexible application scenarios, is easy to use, environmentally friendly, and can achieve efficient resource utilization, making it suitable for industrial production and application.
[0015] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0017] Figure 1 This is the lethality curve during ARTP mutagenesis in Embodiment 1 of the present invention; Figure 2 It is the Bacillus subtilis mutant strain in Example 1 of this invention. Bacillus subtilis A5 size colony photograph; Figure 3 It is the Bacillus subtilis mutant strain in Example 1 of this invention. Bacillus subtilis Gram staining results for A5; Figure 4 This refers to the phylogenetic tree and functional gene analysis constructed in Embodiment 1 of the present invention; where A is the evolutionary tree; and B is the result of the functional gene analysis. Figure 5 It is the Bacillus subtilis mutant strain in Example 2 of this invention. Bacillus subtilis Results of the genetic stability study of A5; Figure 6 These are the results of the enzymatic property investigation in Example 4 of the present invention; where A represents the enzyme activity at different culture temperatures; B represents the enzyme activity at different culture times; and C represents the enzyme activity at different pH values. Figure 7 This is the glucose standard curve plotted in Example 5 of the present invention. Detailed Implementation
[0018] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0019] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0020] The instruments, equipment, reagents and materials used in the embodiments were all obtained through commercial means; the methods and steps not described in detail in the embodiments are all conventional techniques in the art.
[0021] The information on the culture medium and reagent components used in the examples is as follows: CMC-Na liquid medium: Dissolve 10g CMC-Na, 5g tryptone, 1g yeast extract, 0.2g MgSO4, 1.0g KH2PO4, 0.1g CaCl2, and 0.2g (NH4)2SO4 in deionized water, bring the volume to 1L, and sterilize at 121℃ for 20min; CMC-Na solid medium is the CMC-Na liquid medium with 10g agar added. YPD liquid (solid) culture medium: Dissolve 20g peptone, (20g agar), 20g glucose, and 10g yeast extract in deionized water, bring the volume to 1L, and sterilize at 115℃ for 20min. Inorganic salt culture medium: Dissolve 1g KH2PO4, 0.3g MgSO4·7H2O, 0.1g NaCl, 2.5g NaNO3, 0.01g FeCl3, and 0.1g CaCl2 in deionized water and bring the volume to 1L. Sterilize at 121℃ for 20min. Slant culture medium: Dissolve 5g beef extract, 5g peptone, 3g NaCl and 10g agar powder in deionized water, bring the volume to 1L, and sterilize at 121℃ for 20min; LB liquid medium: Dissolve 10g tryptone, 5g yeast extract, and 5g NaCl in deionized water, bring the volume to 1L, and sterilize at 121℃ for 20min; LB solid medium is LB liquid medium with 10g agar added. DNS: Add 3.15g of 3,5-dinitrosalicylic acid to 500mL of deionized water, and slowly add 100mL of 20g / L NaOH solution while stirring. After it is completely dissolved, add 91g of potassium sodium tartrate, 2.5g of phenol and 2.5g of sodium sulfite. Stir until completely dissolved and bring the volume to 1L. Filter in the dark and store in a brown bottle. Let stand in the dark for one week before use.
[0022] Example 1 Bacillus subtilis mutant strain Bacillus subtilis The breeding of A5 is as follows: (1) Initial screening. Take 10g of soil sample (taken from a sparsely populated humus layer in Chuxiong City, Yunnan Province) and add 90mL of deionized water to prepare a sample suspension. Treat the suspension in a water bath at 80℃ for 30min. After the water bath, allow it to cool naturally to room temperature. Take 2mL of the suspension and inoculate it into 100mL of CMC-Na liquid medium. Incubate the suspension at 37℃ and 200r / min for 48h. Take 100μL of the bacterial culture after the incubation and mix it with 900μL of sterile water to prepare a 10% concentration. -1 The bacterial suspension was repeated to obtain 10. -3 10 -4 10 -5 The bacterial suspension was prepared by spreading 100 μL of the suspension evenly onto CMC-Na solid medium plates in triplicate. All plates were incubated at 37°C for 24 h. Single colonies from plates with 50-300 CFU were then inoculated onto slant agar plates and stored at 4°C.
[0023] (2) Congo red staining for rescreening. Strains preserved on slant agar were inoculated onto CMC-Na solid medium and cultured at 37℃ for 24 h. After culture, a certain amount of 1 g / L Congo red staining solution was added to cover the plates for staining for 30 min, and 1 mol / L NaCl was used to elute the stain. The colony diameter (d) and the diameter of the clear zone (D) were measured, and the ratio (D / d) was calculated. The D / d ratio was used to preliminarily determine the cellulose degradation ability of the strains. Strains with larger ratios were selected for preservation, yielding the starting strain Bacillus subtilis Ba.1, classified as Bacillus subtilis, with accession number GDMCC No: 65229. It was deposited on September 29, 2024, at the Guangdong Provincial Microbial Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0024] (3) ARTP mutagenesis. Bacillus subtilis Ba.1 was inoculated into LB medium and cultured at 37℃ and 200 r / min for 24 h to obtain a bacterial suspension. 1 mL of the bacterial suspension was diluted with sterile water to a final concentration of 10. -5 Centrifuge at 10000 rpm and 4°C for 10 min, discard the supernatant, and resuspend in 5% glycerol to a final volume of 10. 6 -10 8CFU / mL. Using an ARTP mutagen (10 SLM gas flow, 120 W power), 10 μL of bacterial culture spread on slides was treated for 0, 40, 55, 70, 85, and 100 s, respectively. After mutagenesis, the culture was placed in 1 mL of sterile water and shaken for 1 min. 150 μL of the culture was spread onto CMC-Na solid medium and incubated at 37°C for 48 h. The lethality rate was calculated using Formula I. The strain with the highest lethality rate was selected and inoculated into 50 mL of CMC-Na liquid medium, incubated at 37°C and 200 rpm for 48 h for MISS cell screening. The lethality rate curve is shown below. Figure 1 As shown.
[0025] Mortality rate = (AB) / A × 100% (Formula I); Where A represents the number of colonies on the unmutated plate, and B represents the number of colonies grown on the plate by the mutant strain.
[0026] (4) MISS Cell screening. Mutagenic strains with a lethality of approximately 95% were inoculated into CMC-Na liquid medium and cultured at 37°C and 200 rpm for 48 h. The optimal cell count was determined by serial dilution. -5 After achieving the appropriate dilution, droplets were generated using the MISS cell system and incubated at 37°C for 48 hours. Following incubation, the droplets were sorted based on their absorbance at 600 nm, and the OD values were collected. 600nm Droplets with a concentration between 2 and 10 were selected. The sorted droplets were transferred to deep-well plates containing CMC-Na liquid medium and cultured at 37°C and 200 r / min for 48 h. Cellulase activity was determined using the DNS method (method referred to Sumner JB, Graham V A. Dinitrosalicylic acid: a reagent for the estimation of sugar in normal and diabetic urine[J]. Journal of Biological Chemistry, 1921, 47(1): 5-9.). The enzyme activity unit was defined as: the amount of enzyme that hydrolyzes to produce 1 μmol of glucose per 1 min is defined as 1 unit (U). Enzyme activity was calculated using the following formula II: Enzyme activity (U / mL) = [(C-C0)×Vtotal×n×1000] / M / t / Venzyme (Formula II). Where C is the glucose concentration in the sample tube (mg / mL); C0 is the glucose concentration in the control tube (mg / mL); Vtotal is the total volume of the reaction system (mL); n is the dilution factor; M is the molar mass of glucose (180.16 g / mol); t is the reaction time (min); and Venzyme is the volume of enzyme solution added (mL).
[0027] The enzyme activity assay results are shown in Table 1. A mutant strain A5 with significantly enhanced cellulase activity was obtained, with an enzyme activity of 1.39 U / mL, which is 39% higher than that of the original strain. The mutant strain A5 was mixed with an equal volume of 50% glycerol and stored at -80℃.
[0028] Table 1. Results of enzyme activity assay of mutant strains
[0029] (5) Strains were identified. The mutant strain A5 obtained from screening was streaked on LB solid medium and incubated upside down at 37°C for 24 hours. Colony photographs are shown below. Figure 2 As shown, the colonies are milky white to light yellow and opaque. Most individual colonies are nearly round, with obvious raised areas, a rough and slightly wrinkled surface, and are moist and sticky.
[0030] Staining and identification were performed according to the basic Gram staining method, and the results are as follows: Figure 3 As shown, the bacteria are stained purple (blue-purple), indicating they are Gram-positive bacilli. The bacteria are regular straight rods with blunt, rounded ends. The cells are uniform in size, and some cells show oval spores.
[0031] DNA was extracted from mutant strain A5 using a bacterial genomic DNA purification kit. Using the extracted DNA as a template, the 16S rDNA sequence of mutant strain A5 was amplified using universal bacterial primers 27F (sequence shown in SEQ ID NO.1) and 1492R (sequence shown in SEQ ID NO.2). The PCR product was sent to a biotechnology company for sequencing, and the results showed that the 16S rDNA sequence of mutant strain A5 is shown in SEQ ID NO.3.
[0032] The 16S rDNA sequence of mutant strain A5 was BLAST aligned to the NCBI database, and a phylogenetic tree was constructed using Mega software. The phylogenetic tree and functional gene analysis results are as follows: Figure 4 As shown, mutant strain A5 exhibits 99.73% sequence similarity with multiple Bacillus subtilis reference strains, with 100% sequence coverage and an E value of 0, indicating extremely high homology matching. Phylogenetic tree results show that mutant strain A5 and... Bacillus velezensis CBMB205 clustered into a lineage belonging to the genus *Bacillus*, and is most closely related to several *Bacillus subtilis* type strains. Based on physiological, biochemical, and morphological characteristics, strain A5 was determined to be taxonomically *Bacillus subtilis*. Therefore, in the following text, mutant strain A5 will be named *Bacillus subtilis* mutant strain. Bacillus subtle A5.
[0033] Bacillus subtilis mutant strain Bacillus subtilisA5 was deposited on April 20, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 68128, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0034] SEQ ID NO.1: AGAGTTTGATCCTGGCTCAG SEQ ID NO.2: TACGGCTACCTTGTTACGACTT SEQ ID NO.3: Example 2 Investigating Bacillus subtilis mutant strains Bacillus subtilis The genetic stability of A5 is as follows: The mutant strain A5 was streaked on LB solid medium, and a single colony was picked and inoculated into 100 mL of CMC-Na liquid medium for 48 h, which was recorded as the first generation. After the culture was completed, 1 mL of bacterial solution was centrifuged at 10000 r / min for 10 min at 4 °C, and the supernatant was used to determine the enzyme activity. The bacterial solution after 48 h of culture was then shaken well, and 2 mL was transferred to a new 100 mL of CMC-Na liquid medium for 48 h of culture to obtain the second generation. This operation was repeated 5 times. The enzyme activity of each generation was determined by the method in (4) of Example 1, and the changes in enzyme activity were observed.
[0035] The results are as follows Figure 5 As shown, after five consecutive generations of subculturing, the Bacillus subtilis mutant strain... Bacillus subtilis The enzyme activity of A5 remained at 1.36~1.39 U / mL, indicating that the high cellulase activity trait of the strain was stably inherited.
[0036] Example 3 Using Bacillus subtilis mutant strain Bacillus subtilis The specific steps for A5 degradation of waste residue are as follows: (1) Bacillus subtilis mutant strain Bacillus subtilis A5 and Bacillus subtilis Ba.1 were activated by streaking on CMC-Na solid medium plates. After activation, single colonies were picked and inoculated into 100 mL of CMC-Na medium and cultured on a shaker at 37 °C and 200 r / min for 48 h.
[0037] (2) Mix 20g of lees (corn vinegar lees or liquor lees, both of which are commercially available products. The neutral detergent fiber content of each lees was measured before the experiment) with 4mL of ammonia water, adjust the moisture content to about 30%, seal and ammonify at 65℃ for 62h, then leave it open and stand for 4h to remove ammonia, and obtain ammonified lees.
[0038] (3) Take the ammonified residue obtained in step (2) and add it to a fermenter containing 100 mL of inorganic salt culture medium (solid-liquid ratio 1:5). Adjust the pH to 6.0 with 5 mol / L H3PO4 and NaOH. Inoculate with 0.4 mL of Ba.1 bacterial solution and A5 bacterial solution respectively. Ferment at 37℃ and 180 r / min for 3 days. After fermentation, determine the neutral detergent fiber (NDF) content of the residue (method refers to GB / T20806—2022).
[0039] Replace the Bacillus subtilis mutant strain with Bacillus subtilis Ba.1 Bacillus subtilis A5, the residue fermented using the same method, serves as a control.
[0040] The results are shown in Table 2. (The text appears to be incomplete and requires further context.) Bacillus subtilis After fermentation, the NDF content of corn vinegar residue decreased from 28.78% to 26.56%, and that of baijiu residue decreased from 54.99% to 49.50%, showing a significantly better degradation effect on NDF than the original strain Ba.1.
[0041] Table 2 Results of neutral detergent fiber content determination
[0042] Note: * indicates a significant difference compared to Ba.1 (Note: * indicates a significant difference compared to Ba.1) P <0.05).
[0043] Example 4 Investigating Bacillus subtilis mutant strains Bacillus subtilis The enzymatic properties of A5 are determined through the following steps: Bacillus subtilis mutant strain Bacillus subtilis A5 and Bacillus subtilis Ba.1 were streaked on CMC-Na solid medium for activation and then inoculated into CMC-Na liquid medium. The effects of different pH values (4.0~9.0, intervals of 1.0), different culture temperatures (30, 37, 42, 50℃), and different culture times (24, 48, 72, 96 h) on cellulase activity were investigated. After culture, the supernatant was centrifuged (10,000 r / min, 4℃) and cellulase activity was measured using the method in (4) of Example 1. Enzyme activity curves before and after mutagenesis were plotted to determine the optimal culture pH, optimal culture temperature, and optimal culture time.
[0044] The results are as follows Figure 6 As shown, Bacillus subtilis mutant strain Bacillus subtilis The optimal conditions for enzyme production of A5 are 37°C, 48 hours, and pH=6.0.
[0045] Example 5 Investigating Bacillus subtilis mutant strains Bacillus subtilis The specific steps for the synergistic fermentation effect of A5 on the residue by dual microorganisms are as follows: (1) Plotting the glucose standard curve.
[0046] Accurately weigh anhydrous glucose to prepare a 10.0 mg / mL standard solution, and dilute it to a series of concentrations from 0.00 to 0.60 mg / mL. Take 80 μL of each standard solution, add 80 μL of water and 200 μL of DNS reagent, boil in a water bath for 5 min, cool, and then dilute to 1 mL with deionized water. Measure the absorbance at 540 nm. Plot a glucose standard curve with the standard glucose solution concentration on the x-axis and the corresponding absorbance on the y-axis. Figure 7 As shown.
[0047] (2) Ammoniated baijiu lees were prepared using the method described in Example 3. The ammoniated baijiu lees were added to a fermenter containing 100 mL of inorganic salt culture medium (solid-liquid ratio 1:5), the pH was adjusted to 6.0, and raw material group, A5 group and A5+ Bacillus amyloliquefaciens (inoculation amount of 1:1) group were set up. 0.4 mL of bacterial solution was inoculated into each group, and fermentation was carried out at 37℃ and 180 r / min for 3 days. After fermentation, the absorbance at 540 nm was measured by collecting the fermentation broth. The reducing sugar concentration was calculated according to the glucose standard curve established in (1). Cellulase activity was measured using the method described in Example 1.
[0048] The results are shown in Table 3. The Bacillus subtilis mutant strain... Bacillus subtilis When A5 was mixed with Bacillus amyloliquefaciens in a 1:1 ratio, the reducing sugar concentration in the fermentation broth obtained from fermenting baijiu lees reached 2.12 mg / mL, and the enzyme activity reached 5.06 U / mL, which were significantly higher than those of the single-strain fermentation group.
[0049] Table 3 Results of reducing sugar concentration and cellulase activity assay
[0050] Note: Different letters indicate significant differences. P <0.05, A5 is a Bacillus subtilis mutant strain Bacillus subtle A5 and Ba.2 are Bacillus amyloliquefaciens.
[0051] Example 6 Investigating Bacillus subtilis mutant strains Bacillus subtilis The synergistic effect of A5 bacteria and enzymes on fermented residue is demonstrated through the following steps: Ammonized corn vinegar residue was prepared using the method described in Example 3. The ammonized corn vinegar residue was added to a fermenter containing 100 mL of inorganic salt medium (solid-liquid ratio 1:5), and the pH was adjusted to 5.0. Two treatment groups were established: an enzyme + yeast treatment group (Group A) and an enzyme + Bacillus + yeast treatment group (Group B). Group A was enzymatically hydrolyzed on a shaker at 50℃ and 180 rpm for 6 days, then inoculated with 0.4 mL of YPD liquid medium and cultured for 48 hours. Meyerozyma caribbica Yeast culture of strain XX2120 (GDMCC No. 67777) was cultured at 30℃ and 180 rpm for 3 days. Group B was first inoculated with cellulase Cellic CTec3 HS and enzymatically digested on a shaker at 50℃ and 180 rpm for 3 days, and then inoculated with 0.8 mL of Bacillus subtilis mutant strain. Bacillus subtilis A mixture of A5 and Bacillus amyloliquefaciens in a 1:1 volume ratio was fermented in a shaker at 37°C and 180 rpm for 3 days, and finally inoculated with 0.4 mL of the mixture. Meyerozyme CaribbeanYeast culture of XX2120 (strain preservation number GDMCC No: 67777) was cultured at 30℃ and 180 r / min for 3 days. After fermentation, the contents of NDF and true protein (TP) in the residue were determined using the method described in Example 3 (the determination method refers to DB13 / T1098-2009). The raw material was corn vinegar residue that had been purchased but not subjected to any treatment.
[0052] The results are shown in Table 4. The NDF of group B was significantly lower than that of group A. P <0.05%. There was no significant difference in crude protein (CP) content between group A and group B. P <0.05). The true protein (TP) content in group B was significantly higher than that in group A ( P <0.05).
[0053] Table 4 Results of NDF and Protein Level Measurement
[0054] Note: * indicates a significant difference compared to group A. P <0.05).
[0055] Therefore, this invention provides a method for rapidly obtaining high-yield positively mutated strains, which is simple to operate and highly efficient; the Bacillus subtilis mutant strain obtained using this method Bacillus subtilis A5 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on April 20, 2026, with accession number GDMCC No: 68128. It exhibits significantly enhanced cellulase activity, good genetic stability, and suitability for fermentation of fermented grains. It significantly degrades neutral detergent fiber in corn vinegar residue and baijiu residue, increasing the level of true protein. It can also collaborate with other strains / creatures and cellulases to significantly increase the release of reducing sugars, cellulase activity, and the level of true protein. It has flexible application scenarios, is easy to use, environmentally friendly, and can achieve efficient resource utilization, making it suitable for industrial production and application.
[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A high-cellulase-producing Bacillus subtilis mutant strain Bacillus subtilis A5 was deposited on April 20, 2026 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 68128, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
2. The Bacillus subtilis mutant strain with high cellulase production as described in claim 1 Bacillus subtilis Application of A5 in the degradation of waste residue.
3. The Bacillus subtilis mutant strain with high cellulase production according to claim 2 Bacillus subtilis The application of A5 in the degradation of waste residue is characterized by: The residue includes corn vinegar residue and liquor residue.
4. A residue degradation agent, characterized in that: The waste degradation agent contains the high-cellulase-producing Bacillus subtilis mutant strain as described in claim 1. Bacillus subtilis A5; lees include corn vinegar lees and liquor lees.
5. The residue degradation agent according to claim 4, characterized in that: The waste degradation agent also includes one of Bacillus subtilis, yeast, and enzyme.
6. The residue degradation agent according to claim 4, characterized in that: The enzyme is cellulase CellicCTec3 HS.
7. The residue degradation agent according to claim 4, characterized in that: The yeast is Meyerozyma caribbica XX2120, strain preservation number is GDMCC No: 67777.
8. The method for degrading sludge using the sludge degradation agent according to any one of claims 4-7, characterized in that: The method involves fermentation at 37℃, pH 5-7, and 150-200 r / min on a shaker for 2-5 days.