A hyperglycemic injury model of human vascular organoids based on PAX4 gene editing and its evaluation method

Abstract

This invention belongs to the field of biomedicine and organoid technology, and discloses a method for constructing a high-glucose injury model of human vascular organoids based on PAX4 gene editing and its application. The vascular organoids constructed by this invention can form a three-dimensional vascular network with a lumen-like structure and express the endothelial cell marker CD31 and vascular-related marker molecules. Compared with wild-type controls, vascular organoids derived from PAX4 gene deficiency exhibit reduced vascular network branching complexity and altered lumen structure under basic culture conditions. Under high-glucose stimulation, the organoids further show changes such as loosened vascular structure, lumen dilation, and increased deposition of basement membrane-related components, accompanied by changes in the composition ratio of vascular-related cells. This invention is the first to introduce PAX4 gene deficiency into the vascular organoid system, constructing a vascular injury model combining genetic factors and metabolic stress, providing a new in vitro research platform for studying diabetic vascular complications.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and organoid technology, and more specifically, relates to a high-glucose injury model of human vascular organoids based on PAX4 gene editing and its evaluation method. Background Technology

[0002] Diabetic vascular complications are a significant cause of multi-organ damage, but their mechanisms are complex, and there is a lack of in vitro models that can stably simulate vascular injury under high glucose conditions. Current methods for constructing vascular organoids primarily focus on vascular structure formation, lacking injury sensitivity models based on genetic background regulation. The role of PAX4, an important transcription factor, in non-pancreatic tissues remains unclear. Currently, there is a lack of research combining PAX4 gene editing with vascular organoids to create diabetic injury models. Therefore, it is necessary to establish a vascular organoid model that combines genetic factors and metabolic stress to better simulate the process of diabetes-related vascular injury. Summary of the Invention

[0003] Based on the aforementioned deficiencies in existing technologies, this invention first provides a method for constructing a high-glucose injury model of human vascular organoids based on PAX4 gene editing.

[0004] A second objective of this invention is to provide an application of the model obtained by the above method.

[0005] The objective of this invention is achieved through the following technical solution:

[0006] A method for constructing a high-glucose injury model of human vascular organoids based on PAX4 gene editing includes the following steps:

[0007] (1) Gene editing of human induced pluripotent stem cells to obtain cell lines with PAX4 gene mutation;

[0008] (2) Three-dimensional vascular organoids were formed by inducing differentiation of PAX4 gene mutant cell lines;

[0009] (3) The vascular organoids are placed under high glucose culture conditions for treatment, which is a high glucose damage model of human vascular organoids based on PAX4 gene editing.

[0010] Preferably, the high-glucose culture conditions in step (2) of the above method refer to the addition of 35-75 mM glucose to the culture medium.

[0011] The present invention also provides the application of the high glucose damage model obtained by the above method in non-disease diagnosis and treatment purposes.

[0012] Preferably, the above applications include the following aspects:

[0013] (1) Construction of an in vitro model of diabetic vascular complications;

[0014] (2) Drug screening;

[0015] (3) Research on the mechanism of vascular injury.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] This invention discloses a method for constructing a high-glucose injury model of human vascular organoids based on PAX4 gene editing and its application. The method uses human induced pluripotent stem cells (hiPSCs) as starting material, obtains PAX4 gene-deficient cell lines through gene editing technology, and induces the formation of three-dimensional vascular organoids using a directed differentiation method. Based on this, an in vitro diabetes-related vascular injury model is constructed through high-glucose conditioned stimulation.

[0018] The vascular organoids constructed in this invention can form three-dimensional vascular networks with lumen-like structures and express the endothelial cell marker CD31 and vascular-related marker molecules. Compared with wild-type controls, vascular organoids derived from PAX4 gene deficiency exhibit reduced complexity of vascular network branching and altered lumen structure under basal culture conditions. Under high glucose stimulation, the organoids further show changes such as loosening of vascular structure, luminal dilation, and increased deposition of basement membrane-related components, accompanied by changes in the composition ratio of vascular-related cells.

[0019] This invention is the first to introduce PAX4 gene defects into the vascular organoid system, constructing a vascular injury model that combines genetic factors with metabolic stress, providing a new in vitro research platform for studying diabetic vascular complications. Attached Figure Description

[0020] Figure 1 This is a flowchart illustrating the high-glucose injury model of human vascular organoids based on PAX4 gene editing, as described in this invention.

[0021] Figure 2 This is a schematic diagram of the PAX4 gene mutation sites, where E5-PAX4... - / - and E72-PAX4 - / - These represent different gene-edited cell lines;

[0022] Figure 3 The diagram shows the structures of vascular organoids of different PAX4 genotypes, where WT-hBVOs are wild-type vascular organoids, and E72-hBVOs and E5-hBVOs are vascular organoids derived from the corresponding mutant cell lines.

[0023] Figure 4 The expression of CD31, an endothelial cell marker, and PDGFRβ, an immune marker, in vascular organoids;

[0024] Figure 5 Quantitative analysis results of vascular diameter in different groups of vascular organoids;

[0025] Figure 6 qRT-PCR of vascular organoids under PAX4 gene mutation conditions;

[0026] Figure 7 This diagram shows the structural changes of vascular organoids after high glucose treatment. WT-hBVOs, E72-hBVOs, and E5-hBVOs represent the mannitol control group. H-WT-hBVOs, H-E72-hBVOs, and H-E5-hBVOs represent the high glucose-induced group.

[0027] Figure 8 Immunofluorescence staining images of CD31, a marker of vascular organoid endothelial cells, PDGFRβ, a marker of pericytes, and Coliv staining of the basement membrane after high glucose treatment.

[0028] Figure 9 Changes in the coliv of the vascular organoid basement membrane after high glucose treatment:

[0029] Figure 10 This study describes RT-PCR of vascular organoids under PAX4 gene mutation conditions after high glucose treatment. The control group was a mannitol control group, and HG was a high glucose treatment group. Detailed Implementation

[0030] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific drawings and embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0031] Example 1: Construction of PAX4 gene-edited hiPSCs

[0032] hiPSCs cell culture: hiPSCs were cultured in E8 medium under Matrigel coating conditions. When the cell confluence reached 80%~90%, they were used for subsequent experiments.

[0033] 2. Gene editing methods

[0034] 2.1 Construction of sgRNA cell expression vector

[0035] PAX4 gene editing was performed using the CRISPR / Cas9 system. Based on the human PAX4 gene sequence, sgRNAs targeting exon regions were designed, specifically targeting exons 5 and 7 of PAX4. Four sgRNAs were designed using the online sgRNA design website benchling. The sgRNA sequences were synthesized after off-target risks were predicted using online tools and then cloned into Cas9-containing expression vectors. PAX4 gene mutation locations in the PAX4 gene-edited cell lines were obtained through screening. Figure 2 The pluripotency and tri-germ layer differentiation capacity of hiPSCs were verified, and the results were consistent with the characteristics of stem cells.

[0036] PAX4 target sequence: Ccttttcagctgttttggctccagctgtcctcactccccatagtggctctgagactccccggggtacccacccagggaccggccaccggaatcggactatcttctccccaagccaagcagaggcactggagaaaggtgctgggctgggacagatggagggtcagagagtcctcagtgtgacacagggacagtggccctgaggcctgtgggcaaaggctgagaggtgcaggtgtgagtggccctgccttgaggaggaaggtagtttggggttgtagcaggtggggagtgttgcctaaggggagacccatgccttgctcctctcccggtgcccttactttgtgagactcgatctccgcagagttccagcgtgggcagtatcctgattcagtggcccgtggaaagctggctactgccacctctctgcctgaggacacggtgagggtgagtgagctctgcaacactgtacaaaccacaaggaggaagagtctgggccggccagggctttgggttccaatgaggtggagaggggaggtgagaaattggaagcaaatttgtttggagcaacaatcagagatgagatcctccttgttcaccttctgctgactgctctcctctcttccccaacccaaacctttgagttgaggaaggggccagagagcaaaagctagagcagggagggaggatgtcaggcccaaggaagggtcaacattctgagttcaggctaggaacatgtggtgagatcagcaggtgacaggcagcataaagtacagccagctgcattgtccctgtcctcgctcaggtctggttttccaacagaagagccaaatggcgtcggcaagagaagctcaagtgggaaatgcagctgccaggtg

[0037] sgRNA1: AGTGGCTCTGAGACTCCCCG; (2) sgRNA2: TCGGCAAGAGAAGCTCAAGT.

[0038] Example 2 Construction of Gene-Edited Vascular Organoids

[0039] After inducing hiPSCs to form cell spheroids, mesodermal differentiation was induced sequentially with 30 ng / mL BMP4 and 12 mM CHIR99021, followed by the addition of pro-angiogenic differentiation factors. On day 5, the cell spheroids were embedded in a three-dimensional matrix formed by Matrigel and collagen I in a 9:1 ratio, and cultured for 20-25 days to form vascular organoid structures. Figure 3 Under PAX4 gene editing conditions, vascular organoids exhibited reduced branching structures. For example... Figure 4 As shown, changes in vascular structure can be observed by detecting the endothelial marker CD31 and the pericyte marker PDGFRβ. Figure 6 The real-time quantitative PCR assay showed that the expression levels of related genes CD31 and PDGFRβ were elevated, while the expression levels of angiogenesis and stability marker ROBO4 were not significantly different.

[0040] Example 3: Establishment of a High-Glucose Vascular Injury Model - High-Glucose Stimulated Vascular Organoids

[0041] Mature vascular organoids were treated under high glucose culture conditions (35-75 mM D-glucose) for 3 weeks, while an isotonic mannitol control group (5+17 mM glucose + 30+58 mM mannitol) was set up to eliminate the influence of osmotic pressure, thereby establishing a stable vascular injury model. Figure 7 High glucose treatment revealed varying degrees of morphological changes in hBVOs, with reduced or loosely arranged vascular branches in some areas. High glucose stimulation may affect the structural stability of hBVOs. Immunofluorescence staining was performed on vascular organoids to detect the expression of endothelial cell marker CD31 and pericyte marker PDGFR-β. Images were acquired and analyzed using confocal microscopy. Figure 8 CD31-labeled vascular-like structures in some regions show relatively widened lumens and a slightly looser vascular network structure compared to normal conditions. For example... Figure 9 COLIV staining of vascular organoids revealed increased deposition of vascular basement membrane-related components in the cross-section of the blood vessel lumen after high-glucose treatment. Total RNA was extracted from the organoids and analyzed by reverse transcription and real-time quantitative PCR. Figure 10 The results showed that CD31 expression generally decreased, PDGFRβ expression generally increased, and COL4A1 was significantly increased in the high-sugar treatment group.

[0042] Example 4: Evaluation Method for Vascular Injury Phenotype

[0043] To quantitatively evaluate the degree of damage to vascular organoids after high-glucose treatment, the following structural and molecular phenotypic evaluation system was established:

[0044] Microscopic imaging (bright field and confocal microscopes) was performed on vascular organoids cultured to a predetermined time point (preferably day 20-25). Representative field-of-view images of no fewer than three independent samples were acquired under the same magnification and exposure conditions. Quantitative analysis was performed using image analysis software, including the following indicators: (1) number of vascular branches: the number of vascular branch points per unit field of view; (2) lumen diameter: the average lumen width of the vascular-like structure. Statistical analysis of the above indicators was performed to assess changes in the vascular network structure (see...). Figure 5 , Figure 9 ).

[0045] The deposition of basement membrane-related components was assessed by immunofluorescence staining and molecular detection methods, including: (1) using immunofluorescence staining to detect the expression and distribution of type IV collagen (COL IV) and performing image quantitative analysis of fluorescence signal intensity; (2) extracting total RNA from organoids and performing real-time quantitative PCR to detect the expression level of basement membrane-related genes such as COL4A1; (3) comparing and analyzing ECM deposition changes based on fluorescence intensity or relative gene expression levels.

Claims

1. A method for constructing a high-glucose injury model of human vascular organoids based on PAX4 gene editing, characterized in that, Includes the following steps: (1) Gene editing of human induced pluripotent stem cells to obtain cell lines with PAX4 gene mutation; (2) Three-dimensional vascular organoids were formed by inducing differentiation of PAX4 gene mutant cell lines; (3) The vascular organoids are placed under high glucose culture conditions for treatment, which is a high glucose damage model of human vascular organoids based on PAX4 gene editing.

2. The method for constructing a high-glucose injury model of human vascular organoids based on PAX4 gene editing according to claim 1, characterized in that, The high-glucose culture conditions mentioned in step (2) refer to the addition of 35-75 mM glucose to the culture medium.

3. The application of the high glucose damage model obtained by the method of any one of claims 1 or 2 for non-disease diagnosis and treatment purposes.

4. The application according to claim 3, characterized in that, Including the following aspects: (1) Construction of an in vitro model of diabetic vascular complications; (2) Drug screening; (3) Research on the mechanism of vascular injury.

Images