An engineered exosome, its preparation method, pharmaceutical composition, and its application.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-25
- Publication Date
- 2026-08-14
AI Technical Summary
[0006]因此,本发明要解决的技术问题在于克服现有技术中的肿瘤抗原的能力受限、肿瘤浸润性免疫细胞数量和活性不足,以及外泌体递送效率低的问题,从而提供一种工程化外泌体、制备方法、药物组合物和应用,提升了外泌体的靶向能力和疗效,有效的肿瘤免疫反应,增强肿瘤免疫治疗
1.本发明提供了一种工程化外泌体,所述工程化外泌体携带膜蛋白-活性分子的融合蛋白和/或膜蛋白-胶原结合蛋白的融合蛋白;
Smart Images

Figure CN122563887A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to tumor immunotherapy, specifically to an engineered exosome, its preparation method, pharmaceutical composition, and its application. Background Technology
[0002] Cancer is a significant global public health issue, with its high mortality rate and continuously rising incidence posing a serious challenge to existing treatment methods. While traditional methods such as surgery, radiotherapy, and chemotherapy can control the disease to some extent, they are often accompanied by significant side effects and are prone to relapse, limiting their effectiveness. Tumor immunotherapy, by activating or enhancing the body's own immune system to recognize, attack, and eliminate tumor cells, has become a promising treatment approach.
[0003] Tumor immunotherapy, as a breakthrough strategy following surgery, radiotherapy, chemotherapy, and targeted therapy, has shown significant efficacy in hematological malignancies and some solid tumors. However, its effectiveness in most solid tumors remains unsatisfactory. A key bottleneck lies in the immunosuppressive state of the tumor microenvironment (TME), characterized by insufficient immune cell infiltration, depletion of effector T cell function, and enrichment of suppressor immune cells and immune checkpoint molecules. This leads to the failure of the body's anti-tumor immune response, promoting tumor growth, invasion, and metastasis. Furthermore, the presence of numerous immunosuppressive cells results in a low level of immune response. For example, dendritic cells play a central role in the activation and regulation of anti-tumor immunity, but in the tumor microenvironment, they are often in a functionally immature state, with significantly limited antigen-presenting capacity, making it difficult to effectively stimulate T cell immune responses. Simultaneously, tumor-associated macrophages, the most numerous immune cell group in the tumor microenvironment, are mostly polarized into the M2 phenotype with immunosuppressive functions. They not only promote tumor growth, invasion, migration, and angiogenesis but also actively suppress anti-tumor immune responses, further reinforcing the immune-tolerant microenvironment.
[0004] To address these challenges, researchers are actively exploring new immunotherapy strategies. Among these, exosome-based drug delivery systems are gradually emerging as a promising approach, considered the sixth cancer treatment modality after surgery, radiotherapy, chemotherapy, targeted therapy, and immunotherapy, demonstrating broad application prospects. Exosomes are naturally secreted nanoscale vesicles with good biocompatibility, low immunogenicity, excellent tissue penetration, and natural intercellular communication functions. They can precisely deliver immune regulatory signals to tumor sites and serve as carriers for delivering drugs or bioactive molecules to tumor regions. However, this technology still faces some key challenges: on the one hand, the efficiency of exosome targeted accumulation and cellular uptake in tumor tissue needs further improvement; on the other hand, how to effectively increase the number of infiltrating T cells in tumors and enhance their activity through exosome-mediated delivery systems remains a key focus and challenge of current research.
[0005] In conclusion, developing a novel therapeutic strategy that can improve the efficiency of exosome targeted delivery and simultaneously enhance T cell infiltration and function in the tumor microenvironment has significant scientific research value and clinical significance. Summary of the Invention
[0006] Therefore, the technical problem to be solved by the present invention is to overcome the limitations of tumor antigen capacity, insufficient number and activity of tumor-infiltrating immune cells, and low exosome delivery efficiency in the prior art, thereby providing an engineered exosome, preparation method, pharmaceutical composition and application, which improves the targeting ability and efficacy of exosomes, enhances effective tumor immune response, and strengthens tumor immunotherapy.
[0007] Therefore, the present invention provides the following technical solution: The present invention provides an engineered exosome carrying a fusion protein of a membrane protein and an active molecule and / or a fusion protein of a membrane protein and a collagen-binding protein; wherein the membrane protein includes at least one of CD9, CD63, and Lamp2B; The active molecules include at least one or more of cytokines, immunostimulatory molecules, costimulatory molecules, and chemokines. The immunostimulatory molecules include IL15; The co-stimulatory molecules include 4-1BBL; The collagen-binding protein includes at least one of fibronectin, the collagen-binding domain contained in fibronectin, and Lumican.
[0008] The active molecules of this invention refer to molecules that stimulate specific immune cells to produce corresponding functions. These cytokines include, but are not limited to, cytokines that stimulate the function of innate immune cells and cytokines that stimulate the function of acquired immune cells. The innate immune cells include, but are not limited to, natural killer cells, monocytes, macrophages, neutrophils, eosinophils, and basophils, with more preferably, natural killer cells, dendritic cells, and macrophages. The acquired immune cells include T cells and / or B cells, with the T cells including, but not limited to, CD4-positive helper T cells and CD8-positive cytotoxic T cells.
[0009] The collagen-binding protein of the present invention includes at least one of fibronectin and its collagen-binding domain, and Lumican; the protein number of Lumican in UniProt is P51884, in TrEMBL is Q53FV4, and in UniProtKB is A0A384N669.
[0010] The active molecules of this invention can be regarded as a combination of active functional molecules that can alter the tumor tissue microenvironment, increase immune cell infiltration, and enhance the activity of immune cell function.
[0011] The membrane protein-collagen binding protein of the present invention mediates the targeted binding of engineered exosomes to target cells, thereby altering the tumor tissue microenvironment, increasing immune cell infiltration, and enhancing the activity of immune cell function.
[0012] Optionally, the active molecules include IL15 and 4-1BBL, and the collagen-binding protein includes Lumican. In a specific embodiment of the present invention, engineered exosomes can effectively increase the number of infiltrating T cells in the tumor microenvironment and enhance their killing activity through the synergistic stimulation of Lumican, IL15, and 4-1BBL, while improving the suppressed state of dendritic cell function; thus achieving the treatment of tumor cells.
[0013] Existing technologies have also conducted related research to overcome the immunosuppressive state of the tumor microenvironment (TME), such as patent document CN114349845A (an exosome that promotes tumor infiltration of T lymphocytes and its preparation method). This technology discloses an engineered exosome, but in-depth analysis reveals that it still has many specific defects, limiting the final therapeutic effect and translational potential: First, the targeted delivery efficiency and retention capacity are lacking; second, the immune activation strategy is singular and lacks synergistic effects. The root cause of these defects is that existing technologies may not systematically integrate the two key links of targeted delivery and multiple immune activation in their design concept. Their targeting strategy has failed to effectively overcome the barrier of the tumor matrix; their payload design has failed to fully simulate the physiological immune activation cascade reaction; and their production process has failed to balance efficiency, purity, and cost.
[0014] In contrast, this invention proposes a comprehensive solution to these systemic problems. Utilizing genetic engineering techniques, this invention creatively displays collagen-binding proteins (such as Lumican) along with multiple active molecules (such as IL-15 and 4-1BBL) on the surface of exosomes. Lumican endows exosomes with the ability to target tumor matrix collagen, achieving efficient exosome aggregation and retention; IL-15 and 4-1BBL provide key cell survival / proliferation and co-stimulatory signals, respectively, synergistically acting on T cells, NK cells, etc., not only promoting their invasion but also strongly activating their function and maintaining their activity. Furthermore, membrane proteins, such as CD63 and Lamp2b, which are membrane proteins of the parent cell and are expressed on cell and exosome membranes, are added. The target gene is fused with CD63 and Lamp2b, which serves two purposes: firstly, it allows for their display on the cell membrane surface for localization (the primary objective); secondly, it allows for the selection of a site for subsequent detection to see if it is present throughout the genome. Therefore, this invention aims to provide a more efficient, precise, and synergistic engineered exosome to systematically address the core challenge of immunosuppression of the tumor microenvironment (TME) in solid tumor immunotherapy, demonstrating clear progress and outstanding substantive features.
[0015] In a specific embodiment of the present invention, when the fusion protein of the membrane protein-active molecule is a CD63-IL15-4-1BBL fusion protein, the nucleotide sequence of the gene encoding the CD63-IL15-4-1BBL fusion protein is shown in SEQ ID NO:1; the amino acid sequence of the CD63-IL15-4-1BBL fusion protein is shown in SEQ ID NO:2; or, the fusion protein of the membrane protein-collagen-binding protein is a Lamp2b-Lumican fusion protein; the nucleotide sequence of the gene encoding the Lamp2b-Lumican fusion protein is shown in SEQ ID NO:3; the amino acid sequence of the Lamp2b-Lumican fusion protein is shown in SEQ ID NO:4.
[0016] Alternatively, the amino acid sequence of the Lamp2b-Lumican fusion protein, from the N-terminus to the C-terminus, is composed of the extracellular region sequence of the Lamp2b protein, the amino acid sequence of the first linker peptide, the full-length or functional fragment amino acid sequence of the Lumican protein, the amino acid sequence of the fourth flexible linker peptide, the tag, the amino acid sequence of the second linker peptide, and the extracellular region sequence of the Lamp2b protein and the stop codon, connected sequentially. The amino acid sequence of the CD63-IL15-4-1BBL fusion protein, from the N-terminus to the C-terminus, is composed of the extracellular amino acid sequence of the CD63 protein, the amino acid sequence of the first flexible linker peptide, the amino acid sequence of the IL15 protein, the amino acid sequence of the second flexible linker peptide, the tag, the amino acid sequence of the third flexible linker peptide, the extracellular sequence of the CD63 protein, and the stop codon, connected sequentially. Preferably, the amino acid sequence of the first flexible linker peptide is GS; The amino acid sequence of the second flexible linker is GSG; The amino acid sequence of the third flexible linker is GGGGS or a variant thereof; The amino acid sequence of the fourth flexible linker peptide is GGGGS or a variant thereof; The amino acid sequence of the first linker peptide is AR; The second linker peptide has the amino acid sequence SGG.
[0017] The label includes at least one of affinity purification label, epitope label, fluorescence and reporter label, and solubilization and multifunctional label; The affinity purification tag includes at least one of His, Flag, Strep-tag II, GST, MBP, T7, Protein A / G, and PAtag; The epitope tags include at least one of HA, Myc, V5, ALFA, Spot / BC2, MoonTag, SunTag, and 2B8; The fluorescent and reporter tag includes at least one of GFP and its variant EGFP, luciferase, and other fluorescent proteins; The solubilizing and multifunctional tag includes at least one of SUMO, NEXT tag, thioredoxin, CuSF, NusA, Fh8, CAT, and DHFR; The stop codon includes TAA.
[0018] This invention provides a method for preparing engineered exosomes, comprising: S1, using a recombinant lentivirus containing the nucleotide sequence of the fusion protein encoding the membrane protein-active molecule and the fusion protein encoding the membrane protein-collagen-binding protein; S2, Using the recombinant lentivirus to infect mammalian parent cells, and then screening and culturing them with antibiotics, engineered cells that stably overexpress fusion proteins of membrane protein-active molecules and membrane protein-collagen-binding proteins are obtained; Preferably, the parent cells of the engineered cells include, but are not limited to, tool cell lines used for the production of bioactive molecules or vaccines and cell lines commonly used in scientific research; The tool cell line includes at least one of HEK293 cell line, CHO cell line and Vero cell line; more preferably, it is the HEK293 series cell line.
[0019] The cell lines commonly used in scientific research include at least one of the following: NK cell line, macrophage cell line, human B lymphoma cell line, and human T lymphocyte leukemia cell line; The NK cell line includes the NK92 cell line, the macrophage cell line includes the THP1 cell line, the human B-lymphoma cell line includes the Raji cell line, and the human T-lymphocytic leukemia cell line includes the Jurkat cell line. Preferably, in S2, the antibiotic used for screening includes puromycin, the screening concentration is 2-5 μg / mL, and the screening time is 7-10 days.
[0020] S3, collect the conditioned medium of engineered cells that stably overexpress the fusion protein of membrane protein-active molecule and the fusion protein of membrane protein-collagen-binding protein, and separate and purify to obtain engineered exosomes; in S3, the separation method includes ultracentrifugation, which includes a first centrifugation, a second centrifugation, filtration and a third centrifugation in sequence.
[0021] Preferably, the conditions for the first centrifugation are: 4-6℃, 500-700 g centrifugation for 10-15 min; The conditions for the second centrifugation are: 4-6℃, centrifugation at 15000g-20000g for 25-35min, more preferably centrifugation at 16000-17000g for 25-35min; The conditions for the third centrifugation are: 4-6℃, 100,000 - 120,000 g for 60-90 min; and / or, the filtration includes screen filtration.
[0022] CN116370647A discloses an engineered exosome for pancreatic cancer immunotherapy and its preparation method, achieving highly efficient treatment of pancreatic cancer. However, the centrifugation method in CN116370647A is as follows: centrifugation at 300g for 10 min to remove dead cells, centrifugation at 1200g for 10 min, and centrifugation at 10000g for 20 min to remove cell debris; the supernatant is collected and filtered through a sterile 0.22μm filter membrane to remove larger vesicles; finally, centrifugation at 100000g for 70 min is performed using an ultracentrifuge. First, centrifugation at 10000g for 20 min cannot completely remove cell debris; this invention increases the centrifugation force to 15000g-20000g. Second, the sedimentation force provided by 120,000g is 20% higher than that of 100,000g, which means that the target particles settle faster and more thoroughly in the same amount of time. Because the number and volume of NK92 cell-derived exosomes are small, 100000g is insufficient to fully separate the exosomes.
[0023] CN115960838A discloses an engineered exosome, its preparation method, and its applications. However, the preparation method in CN115960838A involves transient transfection, resulting in significant heterogeneity of the exosomes obtained. This invention, by constructing stable cell lines, further obtains exosomes with significantly improved stability and purity. This invention optimizes the parameters of the ultracentrifugation-based extraction and purification process to improve the yield and purity of exosomes.
[0024] This invention provides applications of engineered exosomes: 1) To prepare drugs for increasing the number of infiltrating T cells in the tumor microenvironment; 2) To prepare drugs for enhancing the activity of infiltrating T cells in the tumor microenvironment; 3) To prepare drugs that enhance the activity of innate immune cells within the tumor microenvironment; 4) To prepare drugs for enhancing the activity of acquired immune cells in the tumor microenvironment; 5) Prepare drugs for the treatment of solid tumors.
[0025] Preferably, the solid tumor includes at least one of lung cancer, pancreatic cancer, breast cancer, colorectal cancer, liver cancer, stomach cancer, ovarian cancer, prostate cancer, and glioma.
[0026] When the engineered exosomes of the present invention are used to treat solid tumors, they can increase the number of natural killer cells in the tumor tissue and the expression of cytotoxic molecules (such as perforin and granzyme). This leads to an increase in the number of dendritic cells within tumor tissue, upregulation of maturation markers (such as CD80, CD86, and MHC class II molecules), and enhanced antigen presentation ability. This causes macrophages to exhibit increased polarization toward the M1 pro-inflammatory phenotype (e.g., upregulation of iNOS and TNF-α expression) and decreased polarization toward the M2 immunosuppressive phenotype (e.g., downregulation of Arg-1 and CD206 expression), while enhancing phagocytic function and secretion of pro-inflammatory cytokines. This increases the number of acquired immune cells, thereby improving the anti-solid tumor effect. The acquired immune cells are T cells, including but not limited to CD4-positive helper T cells and CD8-positive cytotoxic T cells. + T cells are characterized by an increased number in the tumor microenvironment, a higher proportion of helper T cell subsets (such as Th1 cells), and enhanced secretion of cytokines (such as IFN-γ and IL-2). CD8 + T cells showed a significant increase in number in the tumor microenvironment, enhanced killing activity (e.g., upregulation of granzyme B and perforin expression), increased proliferation capacity, and increased production of effector cytokines (e.g., IFN-γ and TNF-α).
[0027] The present invention provides a pharmaceutical composition characterized in that it comprises engineered exosomes and pharmaceutical excipients, wherein the pharmaceutical excipients include pharmaceutically acceptable carriers, diluents or excipients.
[0028] Preferably, the dosage form of the pharmaceutical composition includes one or more of oral formulations, injections, transdermal drug delivery systems, and mucosal drug delivery systems; The routes of administration for the injection include intravenous injection, intratumoral injection, intraperitoneal injection, or intralymphatic injection. The transdermal drug delivery system includes: a gel, a microneedle patch, and a transdermal patch; The mucosal drug delivery system includes at least one of eye drops, nasal sprays, nasal drops, nebulizers, and dry powder inhalers; The oral preparations include oral capsules and / or oral liquids; The injectable formulation includes a sustained-release formulation for injection; the sustained-release formulation for injection includes hydrogels and / or injectable microgels.
[0029] Preferably, the pharmaceutical composition further comprises other antitumor active ingredients; the other antitumor active ingredients are selected from at least one of immune checkpoint inhibitors, chemotherapy drugs, molecularly targeted drugs, cancer vaccines, oncolytic viruses, and cell therapy preparations; the immune checkpoint inhibitor is at least one of antiPD-1 antibody, antiPD-L1 antibody, and antiCTLA-4 antibody.
[0030] This invention clearly explores the potential of combining engineered exosomes with immune checkpoint inhibitors for treatment, providing a clear path for their clinical translation.
[0031] The technical solution of this invention has the following advantages: 1. The present invention provides an engineered exosome carrying a fusion protein of a membrane protein-active molecule and / or a fusion protein of a membrane protein-collagen-binding protein; The membrane protein includes at least one of CD9, CD63, and Lamp2B; The active molecules include at least one or more of cytokines, immunostimulatory molecules, costimulatory molecules, and chemokines. The immunostimulatory molecules include IL15; The co-stimulatory molecules include 4-1BBL; The collagen-binding protein includes at least one of fibronectin and its collagen-binding domain, and Lumican.
[0032] This invention utilizes genetic engineering to modify the parent cells of exosomes, fusing collagen-binding proteins and active molecules highly expressed in tumor tissue with exosome surface membrane proteins to form engineered exosomes with collagen-binding proteins and active molecules on their surface. These engineered exosomes utilize collagen-binding proteins to bind to collagen highly expressed in tumor tissue, achieving targeted delivery of engineered exosomes to tumor tissue. The engineered exosomes, along with the active molecules, reside within the tumor tissue. The residing active molecules further improve the tumor tissue microenvironment and increase immune cell infiltration by altering the activity state of infiltrating immune cells within the tumor tissue microenvironment, thereby enhancing the targeted delivery efficiency of engineered exosomes.
[0033] Furthermore, engineered exosomes can effectively increase the number of infiltrating T cells in the tumor microenvironment and enhance their cytotoxic activity through Lumican-mediated targeted binding and synergistic stimulation by IL15 and 4-1BBL, while simultaneously improving the suppressed state of dendritic cell function. In addition, these engineered exosomes can be used in combination with other anti-tumor drugs or therapeutic agents, expanding the combined strategies for tumor immunotherapy. This invention provides a highly efficient and precise novel technical solution for the immunotherapy of solid tumors, possessing significant scientific research value and promising clinical application prospects.
[0034] 2. This invention provides a method for preparing engineered exosomes, which improves the extraction purity and yield of engineered exosomes.
[0035] Furthermore, this invention, through the design of a lentiviral expression vector for the Lamp2b-Lumican and CD63-IL15-4-1BBL fusion protein, achieved gene modification of HEK293T cells, effectively overcoming the limitations of traditional exosome preparation methods, enhancing the targeting ability and efficacy of exosomes, and providing more options for targeted therapy.
[0036] Furthermore, this invention utilizes recombinant lentivirus to infect parent cells, followed by antibiotic screening and passage culture to establish a stable parent cell line expressing the target fusion protein, thereby improving the stability and purity of exosomes.
[0037] Furthermore, this invention employs ultracentrifugation technology to extract modified exosomes, obtaining modified exosomes displaying Lumican, 4-1BBL, and IL15 on their surface. This significantly increases the purity of the exosomes and their absorption efficiency and targeting ability in tumor tissues, achieving more efficient drug delivery and more precise treatment.
[0038] 3. This invention provides the application of engineered exosomes, which can reside in solid tumor tissues, enhance the infiltration of immune cells, especially T cells, in the tumor tissue, reprogram macrophages in the tumor tissue, form a tumor tissue microenvironment that is conducive to the tumor-killing function of immune cells, and enhance the anti-tumor effect.
[0039] 4. This invention provides a pharmaceutical composition comprising engineered exosomes. The engineered exosomes of this invention can significantly increase the number and activity of tumor-infiltrating T cells, effectively solving the problem of insufficient activity despite sufficient supply of infiltrating T cells in existing tumor immunotherapy, thus triggering a more effective tumor immune response. The engineered exosomes of this invention can be combined with other drugs or treatments, providing a new combined therapeutic approach for tumor immunotherapy and potentially further enhancing the efficacy of tumor immunotherapy. Attached Figure Description
[0040] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0041] Figure 1 The spectrum of the GV707-CD63-IL15-4-1BBL vector; Figure 2 The spectrum of the GV844-Lamp2b-Lumican vector; Figure 3 The results observed and validated under a fluorescence microscope after simultaneous infection of 293T cell lines with two lentiviral vectors. Figure 4 Western blot results of Lumican, 4-1BBL and IL15; Figure 5 The yield of exosomes extracted in Example 2 and Comparative Example 2 is shown in the graph.
[0042] Figure 6 Flow cytometry results of LLC-Luc cells phagocytosing exosomes (ordinary exosomes or engineered exosomes); Figure 7 Figure showing the targeting validation results of engineered exosomes 3 in a mouse lung cancer model; Figure 8 Image showing single-cell sequencing results of peripheral blood mononuclear cells from mice after treatment with engineered exosomes; Figure 9 Figure showing the number and percentage of peripheral blood T cells in mice induced by engineered exosomes; Figure 10 This is a clustering diagram of peripheral blood mononuclear cells in mice after treatment with engineered exosomes. Figure 11 Venn diagram showing the number and percentage of peripheral blood mononuclear cells in mice after treatment with engineered exosomes; Figure 12 GO analysis of genes highly expressed in Cluster 0 (T cells) of mouse peripheral blood after treatment with engineered exosomes; Figure 13 KEGG analysis of genes highly expressed in Cluster 0 (T cells) of mouse peripheral blood after treatment with engineered exosomes; Figure 14 The expression levels of effector molecules (iNOS, TNF-α, Arg-1, CD206) in macrophages after different exosome treatments are shown. Figure 15 Expression levels of effector molecules (perforin, granzyme) in natural killer cells after different exosome treatments; Figure 16 After treatment with different exosomes, CD4 + Expression levels of effector molecules (IFN-γ, IL2) in T; Figure 17 Expression levels of effector molecules (CD80, CD86) in dendritic cells after different exosome treatments; Figure 18 Multiplex immunofluorescence images of mouse lung tissue sections and their representative patterns; Figure 19 In vivo fluorescence imaging of lung metastases in mice under different treatment groups (tumor cells were inoculated first, followed by treatment with exosomes); Figure 20 The results of various immunofluorescence assays on mouse lung tissue after treatment with engineered exosomes in Example 3; Figure 21 The results of various immunofluorescence assays on mouse lung tissue after treatment with engineered exosomes in Example 4; Figure 22 In vivo fluorescence imaging of lung metastases in mice under different treatment groups (after prophylactic treatment with exosomes followed by inoculation with tumor cells). Detailed Implementation
[0043] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.
[0044] For experiments not specifically described in the examples, the procedures or conditions should be followed according to the conventional experimental procedures described in the literature in this field. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.
[0045] In the following examples, lamp2 represents lamp2b.
[0046] Example 1: Construction of Recombinant Lentiviral Virus A recombinant lentivirus, GV707-CD63-IL15-4-1BBL, was constructed using GV707 as the base vector and CMV enhancer as the promoter. The GV707 base vector can be found in the following reference: Wenchao X, Taotao S, Jiaxin W, et al. GPX4 Alleviates Diabetes Mellitus-Induced Erectile Dysfunction by Inhibiting Ferrotosis[J]. Antioxidants, 2022, 11(10): 1896-1896. DOI: 10.3390 / ANTIOX11101896.
[0047] A recombinant lentivirus, GV844-lamp2b-Lumican, was constructed using GV844 as the base vector and CMV enhancer as the promoter. The GV844 base vector can be found in the following reference: Jiang L, Zhang W, He H, et al. MiR-23b-3pameliorates sepsis-induced acute lung injury by inhibiting SMAD3-mediated endothelial-mesenchymal transition.[J]. Burns & Trauma, 2025, 13tkaf062.DOI:10.1093 / BURNST / TKAF062.
[0048] The construction of both recombinant lentiviruses was commissioned to Shanghai Jikai Gene Medical Technology Co., Ltd.
[0049] The CD63-IL15-4-1BBL fusion protein is composed of the following components: mouse mCD63-flexible peptide 1-mouse IL15-flexible peptide 2-HA-flexible peptide 3-mouse mCD63 37-238aa-TM+flag-mouse 4-1BBl-stop codon TAA.
[0050] The nucleotide sequence of the gene encoding the CD63-IL15-4-1BBL fusion protein is shown in SEQ ID NO:1: ATGGCGGTGGAAGGAGGAATGAAGTGTGTCAAGTTTTTGCTCTACGTTCTCCTGCTGGCCTTCTGCGCCTGTGCAGTGGGATTGATCGCCATTGGTGTAGCGGTTCAG (The nucleotide sequence encoding amino acids 1-36 of mouse CD63, NM_007653.3) GGATCA(First flexible peptide) aactggatagatgtaagatatgacctggagaaaattgaaagccttattcaatctattcatattgacaccactttatacactgacagtgactttcatcccagttgcaaagttactgcaatgaactgctttctcctggaattgcaggttattttacatgagtacagtaacatgactcttaatgaaacagtaagaaacgtgctctaccttgcaaacagcactctgtcttctaacaagaatgtagcagaatctggctgcaaggaatgtgaggagctggaggagaaaaccttcacagagagtttttgcaaagctttatacgcattgtccaaatgttcatcaacacgtcc (The nucleotide sequence encoding amino acids 49-162 in the mature mouse IL15 protein, NM_008357.3) GGGTCCGGG (Second flexible peptide) TACCCTTATGATGTCCCAGACTATGCT (HA) GGCGGTGGCGGATCT(Third flexible peptide) GTTGTCTTGAAGCAGGCCATTACCCATGAGACTACTGCTGGCTCGCTGTTGCCTGTGGTCATCATTGCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTCATGATTACATTTGCCATCTTCCTGTCTCTTATCATGCTTGTGGAGGTGGCTGTGGCCATTGCTGGCTATGTGTTTAGAGACCAGGTGAAGTCAGAGTTTAATAAAAGCTTCCAGCAGCAGATGCAGAATTACCTTAAAGACAACAAAACAGCCACTATTTTGGACAAATTGCAGAAAGAAAATAACTGCTGTGGAGCTTCTAACTACACAGACTGGGAAAACATCCCCGGCATGGCCAAGGACAGAGTCCCCGATTCTTGCTGCATCAACATAACTGTGGGCTGTGGGAATGATTTCAAGGAATCCACTATCCATACCCAGGGCTGCGTGGAGACTATAGCAATATGGCTAAGGAAGAACATACTGCTGGTGGCTGCAGCGGCCCTGGGCATTGCTTTTGTGGAGGTCTTGGGAATTATCTTCTCCTGCTGTCTGGTGAAGAGTATTCGAAGTGGCTATGAAGTAATG (Coding nucleotide sequence of amino acids at positions 37 - 238 in mouse CD63, NM_007653.3)) GGCGGCGGAGCATCATCAGGTTCATCCGGAA GTGGCTCTCAGAAAAAGCCACGGTACGAGATTCGATGGAAAGTTGTCGTTATCTCTGCCATACTGGCACTTGTTGT TCTCACTGTCATCAGCCTCATCATCCTGATTATGTTGTGGGGTTCTGACTACAAGGATGACGACGATAAGGGCATG CAG(TM+flag, optimized with mouse codons, from https: / / www.sciencedirect.com / science / article / pii / S2773041723000100) (Mouse 4-1BBl, formal name extracellular segment of Tnfsf9, NM_009404.3(104-309aa)) TAA.
[0051] The amino acid sequence of the CD63-IL15-4-1BBL fusion protein is shown in SEQ ID NO:2: *
[0052] The Lamp2b-Lumican fusion protein is composed of the following components: mouse lamp2 NM_0106851-39aa-linker-mature mouse LUM-flexible peptide-6his-linker-mouse lamp2-stop codon.
[0053] The nucleotide sequence of the gene encoding the Lamp2b-Lumican fusion protein is shown in SEQ ID NO:3: ATGTGCCTCTCTCCGGTTAAAGGCGCAAAGCTCATCCTGATCTTTCTGTTCCTAGGAGCCGTTCAGTCCAATGCATTGATAGTTAATTTGACAGATTCAAAGGGTACTTGCCTTTAT (The nucleotide sequence encoding amino acids 1-39 of mouse lamp2 NM_010685) GCTCGA(The first linker peptide, linker1) CAATACTACGATTATGACATCCCTCTCTTCATGTATGGGCAAATATCACCCAACTGTGCACCAGAATGTAACTGCCCCCACAGCTACCCAACTGCCATGTACTGTGATGACCTCAAGTTGAAGAGTGTGCCAATGGTTCCTCCTGGCATCAAGTACCTTTACCTGAGGAATAACCAAATCGACCATATTGATGAGAAGGCCTTTGAGAACGTCACAGACCTGCAGTGGCTCATTCTTGACCACAACCTTCTAGAAAACTCCAAGATCAAAGGAAAGGTTTTCTCTAAGCTGAAACAACTGAAGAAACTGCATATAAACTACAACAACCTGACCGAGTCCGTCGGTCCACTTCCAAAGTCCCTGCAAGACCTACAGCTGACCAATAATAAAATCAGCAAGCTCGGCTCCTTCGACGGGCTGGTCAACTTGACCTTCATTTATCTTCAACACAACCAGCTCAAAGAGGATGCTGTCTCGGCTTCTCTGAAAGGTCTCAAATCACTAGAGTACCTGGATTTGAGCTTCAATCAGATGAGCAAGCTGCCTGCTGGTCTACCTACATCTCTTCTAACTCTCTACCTAGACAATAATAAGATCAGCAACATTCCGGATGAGTACTTCAAGCGCTTCACTGGGCTGCAATACCTGCGTTTATCTCACAATGAACTGGCTGATAGTGGGGTACCTGGAAACTCGTTTAATATATCATCCTTGCTCGAGCTTGATCTCTCCTATAATAAGCTTAAGAGTATACCAACAGTTAATGAAAATCTTGAAAATTATTACCTGGAGGTCAATGAACTTGAAAAGTTTGATGTGAAGAGCTTCTGTAAGATCCTGGGACCACTGTCTTACTCCAAGATCAAGCATCTGCGCTTGGATGGCAATCCTCTCACTCAGAGCAGTCTGCCTCCTGACATGTATGAGTGTCTACGTGTAGCAAATGAAATCACCGTTAAC (Mouse Lumican protein (Lum),The nucleotide sequence encoding amino acids 19-338 of NM_008524.2. GGAGGAGGCGGTTCT (Fourth flexible peptide) CATCATCATCATCATCAT(6his) TCCGGAGGT
[0054] The amino acid sequence of the Lamp2b-Lumican fusion protein is shown in SEQ ID NO:4: MCLSPVKGAKLILIFLFLGAVQSNALIVNLTDSKGTCLYARQYYDYDIPLFMYGQISPNCAPECNCPHSYPTAMYCDDLKLKSVPMVPPGIKYLYLRNNQIDHIDEKAFENVTDLQWLILDHNLLENSKIKGKVFSKLKQLKKLHINYNNLTESVGPLPKSLQDLQLTNNKISKLGSFDGLVNLTFIYLQHNQLKEDAVSASLKGLKSLEYLDLSFNQMSKLPAGLPTSLLTLYLDNNKISNIPDEYFKRFTGLQYLRLSHNELADSGVPGNSFNISSLLELDLSYNKLKSIPTVNENLENYYLEVNELEKFDVKSFCKILGPLSYSKIKHLRLDGNPLTQSSLPPDMYECLRVANEITVNGGGGSHHHHHHSGGAEWEMNFTITYETTNQTNKTITIAVPDKATHDGSSCGDDRNSAKIMIQFGFAVSWAVNFTKEASHYSIHDIVLSYNTSDSTVFPGAVAKGVHTVKNPENFKVPLDVIFKCNSVLTYNLTPVVQKYWGIHLQAFVQNGTVSKNEQVCEEDQTPTTVAPIIHTTAPSTTTTLTPTSTPTPTPTPTPTVGNYSIRNGNTTCLLATMGLQLNITEEKVPFIFNINPATTNFTGSCQPQSAQLRLNNSQIKYLDFIFAVKNEKRFYLKEVNVYMYLANGSAFNISNKNLSFWDAPLGSSYMCNKEQVLSVSRAFQINTFNLKVQPFNVTKGQYSTAQECSLDDDTILIPIIVGAGLSGLIIVIVIAYLIGRRKTYAGYQTL*.
[0055] The nucleotide sequence of CMV enhancer promoter is SEQ ID NO:5 shows: cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaat gggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttat gggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccacccca ttgacgtcaatgggagtttgttttggcaccaaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct.
[0056] The chromatogram of the GV707-CD63-IL15-4-1BBL recombinant lentiviral vector is shown below. Figure 1 The map of the GV844-Lamp2-Lumican recombinant lentiviral vector is shown below. Figure 2 .
[0057] After constructing CD63 recombinant lentivirus and Lamp2 recombinant lentivirus, plasmid transfection and lentivirus harvesting were performed.
[0058] Plasmid transfection: 24 h before transfection, logarithmic growth phase 293T cells were digested with trypsin and the cell density was adjusted to approximately 5 × 10⁶ cells / year in DMEM medium containing 10% (v / v) fetal bovine serum. 6Cells per 10 ml were re-seeded into 10 cm cell culture dishes and cultured at 37°C in a 5% CO2 incubator. After 24 h of culture, when the cell density reached 70%, the culture was ready for transfection. Two hours before transfection, the medium was replaced with fetal bovine serum-free medium. The three prepared plasmids (GV844-Lamp2b-Lumican 20 μg, lentiviral packaging helper plasmid pHelper 1.0 15 μg, lentiviral packaging helper plasmid pHelper 2.0 10 μg or GV707-CD63-IL15-4-1BBL 20 μg, lentiviral packaging helper plasmid pHelper 1.0 15 μg, lentiviral packaging helper plasmid pHelper 2.0 10 μg) were added to a sterile centrifuge tube, along with the transfection reagent Lipofectamine™ 3000. The specific method was as follows: Step 1: Prepare two tubes: Tube 1: 125 μl DMEM (serum-free medium, no serum added) + the three plasmids mentioned above. Tube 2: 125 μl DMEM (basal DMEM medium, no serum added) + 5 μl Lipofectamine™ 3000. Step 2: Pour the mixture from tube 1 into tube 2 and mix well, resulting in a total of 260 μl of mixture. Step 3: Add 760 μl DMEM (serum-free medium, no serum added), adjust the volume to 1 mL, and incubate at room temperature for 15 min to obtain the transfection mixture. Slowly add the transfection mixture dropwise to a culture dish containing 293T cells, mix well, and incubate at 37°C in a 5% CO2 cell culture incubator. Note: The addition process must be thorough, and avoid blowing the cells away as much as possible. After culturing for 6 h, discard the culture medium containing the transfection mixture, add 10 ml of PBS solution to wash once, gently shake the culture dish to wash away the remaining transfection mixture, and then discard it; slowly add 20 ml of cell culture medium containing 10% serum, and continue culturing in an incubator at 37°C with 5% CO2 for 48 h.
[0059] Lentiviral concentration and purification: Collect supernatant from 293T cells 48 h post-transfection (0 h is considered the start time after transfection) according to cell state; centrifuge at 4000 g for 10 min at 4℃ to remove cell debris; filter the supernatant through a 0.45 μm filter into 40 ml ultracentrifuge tubes; balance the samples, and place each ultracentrifuge tube containing viral supernatant into a Beckman ultracentrifuge, setting the centrifugation parameters to 25000 rpm for 2 h, and maintaining the centrifugation temperature at 4℃; after centrifugation, discard the supernatant, remove as much liquid as possible from the tube walls, add PBS, and gently resuspend by repeated pipetting; Note: Some viral loss is possible in this step of virus recovery, so avoid prolonged exposure of the virus to room temperature. After thorough dissolution, centrifuge at 10000 rpm for 5 min, and aliquot the resulting supernatant as required; prepare samples for testing.
[0060] The supernatant with correct sequencing results was transferred to 50 mL of LB liquid medium containing the corresponding antibiotic and incubated overnight at 37°C. Recombinant lentiviral plasmids were extracted using the AmMag Quatro Plasmid Purification Kit-24 prep (water elution) kit. The qualified recombinant lentiviral plasmids were used in the next step.
[0061] Example 2 This invention provides a method for preparing exosomes that can enhance the number and activity of infiltrating immune cells in the tumor microenvironment, the specific steps of which are as follows: 1. Construct a lentiviral expression vector for the Lamp2b-Lumican and CD63-IL15-4-1BBL fusion proteins.
[0062] (1) Based on the nucleic acid sequences of Lamp2b, Lumican, CD63, IL15, and 4-1BBL, cDNA sequences encoding the Lamp2b-Lumican and CD63-IL15-4-1BBL fusion proteins were designed and synthesized. The cDNA sequence of the Lamp2b-Lumican fusion protein was obtained by reverse transcription using SEQ ID NO:3 as a template. The cDNA sequence of CD63-IL15-4-1BBL was obtained by reverse transcription using SEQ ID NO:1 as a template.
[0063] (2) The cDNA sequence was cloned into lentiviral expression vectors GV707 and GV844 to obtain recombinant lentiviruses GV844-Lamp2b-Lumican and GV707-CD63-IL15-4-1BBL (completed by Shanghai Jikai Gene Medical Technology Co., Ltd.). CD63-IL15-4-1BBL was cloned in GV707 between the SP6 promoter and the EF-1α core promoter, and Lamp2b-Lumican was cloned in GV844 between the CMV promoter and the EF-1α core promoter.
[0064] 2. Transfection 1) 24 hours before transfection, HEK293T cells in logarithmic growth phase were digested with trypsin and adjusted to approximately 5 × 10⁶ cells / day in DMEM medium containing 10% fetal bovine serum. 6 Cells per 10 mL were reseeded into 10 cm cell culture dishes and cultured at 37°C in a 5% CO2 incubator. Transfection was initiated after 48 hours when the cell density reached 70%. The medium was replaced with serum-free complete medium 2 hours before transfection. 2) Add the three prepared plasmids (recombinant lentivirus GV844-Lamp2b-Lumican 20 μg, lentivirus packaging helper plasmid pHelper 1.0 15 μg, lentivirus packaging helper plasmid pHelper 2.0 10 μg or GV707-CD63-IL15-4-1BBL 20 μg, lentivirus packaging helper plasmid pHelper 1.0 15 μg, lentivirus packaging helper plasmid pHelper 2.0 10 μg) to a sterile centrifuge tube, and add the transfection reagent Lipofectamine™ 3000 respectively. The specific method is as follows: Step 1: Prepare two tubes: Tube 1: 125 μl DMEM (serum-free medium, no serum added) + the three plasmids mentioned above. Tube 2: 125 μl DMEM (basal medium, no serum added) + 5 μl Lipofectamine™ 3000. Step 2: Pour the mixture from tube 1 into tube 2 and mix well, yielding a total of 260 μl of solution. Step 3: Add 760 μl DMEM (serum-free medium, no serum added), adjust the volume to 1 mL, and incubate at room temperature for 15 min to obtain the transfection system after incubation. 3) Slowly add the incubated transfection system to the culture medium of HEK293T cells in step 1), mix well, and incubate at 37°C in a cell culture incubator containing 5% CO2.
[0065] After culturing for 6 hours, discard the culture medium containing the transfection system mixture, add 10 mL of PBS solution to wash once, gently shake the culture dish to wash away any remaining transfection mixture, and then discard it.
[0066] 4) Slowly add 12 mL of cell culture medium containing 2% serum and incubate at 37°C in a 5% CO2 incubator for 48 h.
[0067] Collect the supernatant of HEK293T cells cultured for 48 h after transfection (0 h is counted from transfection); Centrifuge at 4000 g for 10 min at 4℃ to remove cell debris and impurities, and obtain the centrifuged supernatant; The supernatant was filtered through a 0.45 μm filter into a 40 mL ultracentrifuge tube to obtain an ultracentrifuge tube containing the virus supernatant. Balance the samples separately, and place the ultracentrifuge tubes containing the viral supernatant into the Beckman ultracentrifuge one by one. Set the centrifugation parameters to 25,000 rpm, centrifugation time to 2 h, and centrifugation temperature to 4℃. After centrifugation, discard the supernatant, remove as much liquid as possible from the tube wall, add PBS, and gently and repeatedly blow and resuspend the precipitate.
[0068] After resuspension and complete dissolution, centrifuge at 10,000 rpm for 5 minutes, and then collect the supernatant, which is the virus solution containing lentivirus particles.
[0069] 4) Determination of virus titer by fluorescence method Preliminary experiment: The day before the assay, HEK293T adherent cells were seeded into 96-well plates at a density of 1.5 × 10⁶ cells per well. 5 Cells were added at volumes of 100 μL, 200 μL, and 500 μL, respectively. Prepare four sterile EP tubes according to the expected viral titer, and add 90 μL of serum-free culture medium to each tube; Add 11 μL of the virus solution to be tested to the first tube, mix well, then add 10 μL to the second tube, and continue the same operation until the last tube. Select the desired cell wells, add all diluted virus solution, and incubate at 37°C with 5% CO2. After 24 hours of incubation, aspirate the supernatant from the cell wells, add 2000 μL of complete culture medium, handling carefully to avoid agitating the cells. After 72 hours of incubation, observe fluorescence expression. Figure 3 As shown in section A, the number of fluorescent cells decreases with increasing dilution factor. The optimal amount of HEK293T cells added is 100 μL per well. The experimental method is feasible, and the preliminary experiment verifies the feasibility of the method, avoiding failure and waste of samples and time in the formal experiment.
[0070] Formal Experiment: The formal experiment was conducted in a 6-well plate.
[0071] Day 1: Cell seeding. Prepare cells at a density of 2 × 10⁶ cells / year using complete culture medium (DMEM + 10% FBS). 5 Cells / ml of cell suspension were added to each well of a 6-well plate at a rate of 1 mL, and three parallel experiments were set up. The cells were then cultured at 37°C for 24 h until the cell confluence reached 75%.
[0072] Day 2: Infection.
[0073] Add 2 μL (MOI=1), 20 μL (MOI=10), and 200 μL (MOI=100) of virus solution to each well of a 6-well plate, and add 40 μL of HiTransGP infection solution to each well. Incubate at 37°C for 16 h, then replace with complete medium and continue culturing. (If cell morphology changes, the medium can be changed earlier at 8 h to maintain normal cell growth); Virus volume = (MOI × cell number) / virus titer.
[0074] Days 3-4: Continue culturing, changing the medium occasionally to maintain cell viability.
[0075] Day 5: Approximately 72 hours post-infection, infection efficiency was observed, and viral fluid containing lentiviral particles was obtained. It was determined that infection efficiency was optimal at MOI=100.
[0076] The titer of the GV844-Lamp2b-Lumican recombinant lentivirus was 1.10E+09 TU / mL.
[0077] The titer of the recombinant lentivirus GV707-CD63-IL15-4-1BBL was 8.90E+08 TU / mL.
[0078] Sequencing of viral fluid containing lentiviral particles was performed, and the results are shown in [the table below]. Figure 3 From B and C, it can be seen that Lumican was loaded into Lamp2b, and 4-1BBL and IL15 were loaded into CD63. Further Sanger sequencing detected the insertion of the relevant sequences.
[0079] 2. Viral fluid containing lentiviral particles was screened with antibiotics and passaged to construct a stable HEK293T-Lamp2b-Lumican-CD63-IL15-4-1BBL cell line (engineered cell line 3), as detailed below: (1) The lentivirus solution of HEK293T-Lamp2b-Lumican-CD63-IL15-4-1BBL was placed in DMEM medium containing 100 U / mL penicillin and 100 μg / mL streptomycin and cultured at 37°C.
[0080] (2) Replace the DMEM medium with fresh medium containing 100 U / mL penicillin and 100 μg / mL streptomycin every 2 days.
[0081] (3) When the cells reach 80%-90% confluence, they are digested with 0.25% trypsin and passaged to the P3 generation. The first three generations of cells are cultured in DMEM medium containing a final concentration of 8 μg / mL of puromycin. The culture medium containing puromycin is changed every 3 days until the control group cells that are not infected with the virus are completely killed by puromycin. Finally, stable HEK293T cells, namely HEK293T-Lamp2b-Lumican-CD63-IL15-4-1BBL cells, are obtained.
[0082] (4) P3 generation cells were cultured in DMEM medium containing 100 U / mL penicillin and 100 μg / mL streptomycin at 37°C, and the supernatant of P4 generation cells was collected.
[0083] 3. Extraction of engineered exosomes using ultracentrifugation (1 Collect cell culture supernatant of P4 generation cells HEK293T-Lamp2b-Lumican-CD63-IL15-4-1BBL.)
[0084] (2) The culture medium supernatant obtained in step (1) was centrifuged at 4℃ and 500g for 10 min, and the precipitate was discarded to obtain supernatant 1; then supernatant 1 was centrifuged at 4℃ and 16800g for 30 min, and the precipitate was discarded to obtain supernatant 2; supernatant 2 was then filtered through a 0.22-micron filter to obtain filtrate; then filtrate was centrifuged at 4℃ and 110000g for 70 min, and the supernatant was discarded. The centrifuged product was resuspended in PBS to obtain engineered exosome 3 (Lumican-HEK293T-Exo IL15+4-1BBL ).
[0085] The exosomes displayed Lumican, 4-1BBL, and IL15 molecules on their surface. Protein composition was verified by SDS-PAGE electrophoresis; the SDS-PAGE electrophoresis results are shown below. Figure 4 It can be seen that the surface of engineered exosome 3 simultaneously displays Lumican, 4-1BBL and IL15 molecules.
[0086] Example 3 This invention provides a method for preparing exosomes that can enhance the number and activity of infiltrating immune cells in the tumor microenvironment, the specific steps of which are as follows: 1. Construct a lentiviral expression vector for the CD63-IL15-4-1BBL fusion protein.
[0087] (1) Based on the nucleic acid sequences of CD63, IL15, and 4-1BBL, the cDNA sequence encoding the CD63-IL15-4-1BBL fusion protein was designed and synthesized. The cDNA sequence of the CD63-IL15-4-1BBL fusion protein was obtained by reverse transcription using SEQ ID NO:1 as a template.
[0088] (2) The cDNA sequence encoding the CD63-IL15-4-1BBL fusion protein was cloned into the lentiviral expression vector GV707 to obtain the recombinant lentivirus GV707-CD63-IL15-4-1BBL. CD63-IL15-4-1BBL was cloned in GV707 between the SP6 promoter and the EF-1α core promoter.
[0089] (3) The recombinant lentivirus GV707-CD63-IL15-4-1BBL was used to infect HEK293T cells, and the cell line HEK293T-CD63-IL15-4-1BBL expressing the CD63-IL15-4-1BBL fusion protein was screened to obtain the cell line HEK293T-CD63-IL15-4-1BBL.
[0090] 2. Construct a stable HEK293T-CD63-IL15-4-1BBL cell line (engineered cell line 2).
[0091] The composition of culture medium 2 is as follows: penicillin and streptomycin with a final concentration of 100 U / mL are added to DMEM medium.
[0092] (1) The HEK293T-CD63-IL15-4-1BBL cells were placed in culture medium 2 and cultured at 37°C.
[0093] (2) Replace the culture medium with fresh culture medium every 2 days.
[0094] (3) When the cells reached 90% confluence, they were digested with 0.25% trypsin and passaged. The first three generations of cells were cultured in DMEM medium containing a final concentration of 8 μg / mL of puromycin. The culture medium containing puromycin was changed every 3 days until the control group cells that were not infected with the virus were completely killed by puromycin. Finally, stable HEK293T cells, namely HEK293T-Lamp2b-Lumican-CD63-IL15-4-1BBL cells, were obtained.
[0095] P3 generation cells were cultured in DMEM medium containing 100 U / mL penicillin and 100 μg / mL streptomycin at 37°C, and the supernatant of P4 generation cells was collected.
[0096] (4) Use ultracentrifugation to extract engineered exosomes.
[0097] The obtained culture medium supernatant was centrifuged at 4℃ and 500g for 10 min, and the precipitate was discarded to obtain supernatant 1. Supernatant 1 was then centrifuged at 4℃ and 16800g for 30 min, and the precipitate was discarded to obtain supernatant 2. Supernatant 3 was then filtered through a 0.22-micron filter to obtain the filtrate. The filtrate was centrifuged at 4℃ and 110000g for 70 min, and the supernatant was discarded. The centrifuged product was resuspended in PBS to obtain engineered exosome 2 (HEK293T-Exo). 4-1BBL+IL15 ).
[0098] Comparative Example 1 This invention provides a method for preparing exosomes that can enhance the number and activity of infiltrating immune cells in the tumor microenvironment, the specific steps of which are as follows: 1. Construct lentiviral expression vectors for Lamp2b and CD63 blank overexpression. (1) The empty vectors Lamp2b and CD63 only express Lamp2b and CD63. The empty CD63 vector is GV707. Figure 1Replace the corresponding elements in the middle; the carrier GV707 carries CD63 but does not contain the IL15-4-1BBL sequence; Lamp2b is empty, which is the carrier GV844, according to... Figure 2 The corresponding element is replaced in the middle. The carrier GV844 carries Lamp2b, but does not contain the Lumican sequence.
[0099] The vectors GV707 and GV844 were developed by Shanghai Jikai Gene Medical Technology Co., Ltd.
[0100] (2) After HEK293T cells were revived, they were infected with vectors GV707 and GV844 and cultured in 10% FBS+DMEM+1% double antibiotic medium (purchased from Wuhan Pronosai Life Science Technology Co., Ltd., the double antibiotic was penicillin and streptomycin mixture) under the following conditions: 37℃, 5% CO2. The control cell line HEK293T-ctrl, which stably overexpressed Lamp2b and CD63 proteins, was obtained by screening.
[0101] 2. Construct the control cell line HEK293T-ctrl (engineered cell line 1).
[0102] The composition of culture medium 1 is: DMEM medium with a final concentration of 100 U / mL penicillin and 100 μg / mL streptomycin.
[0103] The control cell line HEK293T-ctrl cells were placed in medium 1 containing 10 ml of medium and cultured at 37°C. The medium 1 was replaced with fresh medium every 2 days. When the cells reached 80%-90% confluence, they were digested with 0.25% trypsin and passaged to the P3 generation.
[0104] 3. Extraction of engineered exosomes using ultracentrifugation 1 (1) The control cell line HEK293T-ctrl was cultured in the P3 generation and the supernatant of the culture medium of the control cell line HEK293T-ctrl was collected in the culture medium of the P4 generation.
[0105] The cell culture supernatant obtained in step (1) was centrifuged at 4°C and 500g for 10 min, and the precipitate was discarded to obtain supernatant 1. Supernatant 1 was then centrifuged at 4°C and 16800g for 30 min, and the precipitate was discarded to obtain supernatant 2. Supernatant 2 was then filtered through a 0.22-micron filter to obtain the filtrate. The filtrate was then centrifuged at 4°C and 110000g for 70 min, and the supernatant was discarded. The product obtained by centrifugation was resuspended in PBS, and the resulting exosomes were designated as engineered exosome 1 (HEK293T-Exo). ctrl ).
[0106] Comparative Example 2 Same as Example 2, the only difference being that the exosomes were extracted using the method disclosed in CN116370647A, which describes an engineered exosome for pancreatic cancer immunotherapy and its preparation method. Specifically, the method involves centrifuging at 300g for 10 min to remove dead cells, centrifuging at 1200g for 10 min, and centrifuging at 10000g for 20 min to remove cell debris. The supernatant was then collected, filtered through a sterile 0.22μm filter membrane to remove larger vesicles, and finally, centrifuged at 100000g for 70 min using an ultracentrifuge.
[0107] The yields of exosomes extracted in Example 2 and Comparative Example 2 are shown in the figure. Figure 5 In this example, A represents Comparative Example 2, which uses clockwise rotation and high-speed centrifugation. B represents the effect of Example 2. The number of peaks and the amount of exosomes extracted per unit volume indicate that the purity and yield of exosomes obtained by the method of the present invention have been improved.
[0108] Application Example 1: Efficiency of Exosomes in Recognizing Target Cells PKH67 was used to label engineered exosomes 1 and 3, and the labeling conditions are shown in Table 1.
[0109] Table 1 Marking conditions
[0110] 1. Preparation of dye working solution DiluentC was used to prepare a dye working solution with a final concentration of 100 μM PKH67 from the PKH67 stock solution. The dye working solution should be prepared appropriately according to the experimental dosage, and should be used immediately after preparation and protected from light.
[0111] 2. Exosome staining (1) Add 100 μL of dye working solution to engineered exosome 1 and engineered exosome 3 to make the final concentration of PKH67 dye 5 μM.
[0112] (2) After adding the dye working solution, tighten the centrifuge tube, mix it with a vortex shaker for 1 min, and then incubate it in the dark for 10 min.
[0113] (3) Add an appropriate amount of 1xPBS buffer to the incubated exosome dye complex and mix. Then transfer it to an ultrafiltration column with a molecular weight cutoff of 10kDaMWCO. Centrifuge the resulting filtrate at 3000g for 10min in a high-speed centrifuge. Then wash the supernatant obtained by centrifugation twice with PBS to completely remove unbound dye. Finally reduce the volume to 50μL to obtain a concentrated solution.
[0114] (4) Recover the concentrate from the ultrafiltration column, store it in a microcentrifuge tube on ice, and use the labeled exosomes as soon as possible to ensure the highest fluorescence intensity.
[0115] 3. Cellular uptake Add PKH67-labeled exosomes (about 20 μg / well) to the cell culture wells and incubate at 37 °C for 4 h. After incubation, aspirate the supernatant, wash twice with PBS, and then prepare slides for fluorescence photography or flow cytometry detection as normal. See Figure 6 , it can be seen that exosomes modified with Lumican have a higher recognition efficiency for target cells compared to ordinary exosomes.
[0116] Application Example 2 Evaluate the anti-tumor efficacy of engineered exosome 1 (HEK293T-Exo ctrl ), engineered exosome 2 (HEK293T-Exo 4-1BBL+IL15 ), and engineered exosome 3 (Lumican-HEK293T-Exo IL15+4-1BBL ).
[0117] (1) SPF-grade female C57BL / 6J mice, 4 weeks old, were purchased from Beijing Spearf Bio-Technology Co., Ltd. (SCXK (Beijing) 2024-0001), and the animal certificate number was NO.110324251106500842. Take LLC-Luc lung cancer cells, prepare a cell suspension, adjust the cell density to 1×10 7 cells / mL, and inject 100 μL into each mouse via the tail vein. The injection day was recorded as injection D1.
[0118] (2) Seven days after injecting the lung cancer cell suspension via the tail vein, use a mouse in vivo imaging system to detect the fluorescence intensity of tumor cells in the mice and group them. The average fluorescence intensity between groups was not significantly different. Divide them into 4 groups, with 3 mice in each group, namely the PBS group, the HEK293T-Exo ctrl group, the HEK293T-Exo 4-1BBL+IL15组 group, and the HEK293T-Exo 4-1BBL+IL15 group. After grouping, observe them under normal feeding conditions.
[0119] (3) Twenty-one days after grouping, inject PBS, engineered exosome 1, engineered exosome 2, and engineered exosome 3 into the mice via the tail vein, respectively. The injection volume was 100 μL / mouse, once every three days, for a total of three injections. For 100 μg of engineered exosome 1, it was resuspended in 100 μL of PBS and then injected; for 100 μg of engineered exosome 3, it was resuspended in 100 μL of PBS and then injected; for 100 μg of engineered exosome 2, it was resuspended in 10??L of PBS and then injected.
[0120] (4) Seven days after the last injection, use a mouse in vivo imaging system to detect the fluorescence intensity of tumor cells in the mice and judge the anti-tumor efficacy of engineered exosome 3. Figure 7The left image shows in vivo imaging of the engineered exosome 3 mouse before dissection, the middle image shows the engineered exosome 3 mouse after thoracotomy, and the right image shows the engineered exosome 3 mouse after its organs have been removed. Figure 7 The fluorescence intensity represents DIR dye-labeled exosomes, and the purpose is to detect the location of exosome accumulation in various organs. Figure 7 Overall, the results show the precise enrichment of engineered exosomes 3 at the tumor site (lung).
[0121] (5) Multiple immunofluorescence was performed on mouse lung tissue to detect the number and activity of infiltrating T cells and tumor cells.
[0122] The detection methods and results analysis are as follows: 1) Mouse exosome mononuclear cell single-cell sequencing process Phase 1: Experimental preparation and sample collection.
[0123] Experimental design: Determine the experimental / control group, the required number of mice (considering biological replication), and the number of target cells.
[0124] Reagent preparation: pre-cooled PBS, anticoagulant (sodium heparin), red blood cell lysis buffer or Ficoll separation buffer, cell viability dyes, culture medium, etc.
[0125] Peripheral blood collection: Methods: Heart puncture in mice. Peripheral blood was collected using anticoagulant tubes, processed quickly and gently to prevent platelet activation and cell autolysis, and immediately placed on ice to obtain anticoagulated blood.
[0126] Phase 2: Enrichment of peripheral blood mononuclear cells (PBMCs).
[0127] PBMCs were obtained by density gradient centrifugation. Specifically, anticoagulated blood was diluted with PBS at a volume ratio of 1:1 to obtain diluted blood. The diluted blood was carefully added to the upper layer of Ficoll separation solution. After centrifugation, the middle white membrane layer (PBMCs, containing lymphocytes and monocytes) was aspirated and washed three times with PBS to remove platelets and residual separation solution, thus obtaining PBMCs.
[0128] Cell counting and viability assay: PBMC cell concentration and viability were assessed using an automated cell counter. PBMC cell viability >85% was acceptable.
[0129] Phase 3: Preparation and quality control of single-cell suspensions.
[0130] Resuspension: Resuspend PBMC cells in a suitable buffer (PBS containing 1% BSA to a final concentration of 1000 cells / μL) to obtain a single-cell resuspension of PBMCs.
[0131] Filtration: The PBMC single-cell resuspension was filtered using a 30-40μm cell sieve to remove cell clumps and debris. This is a critical step in preventing microfluidic chip clogging.
[0132] Secondary quality control: Flow cytometry can be used to assess the purity of the target cells; a purity greater than 95% is acceptable.
[0133] Phase 4: Single-cell isolation, library construction, and sequencing.
[0134] Single-cell isolation, library construction, and sequencing were performed using the 10x Genomics Chromiu platform.
[0135] Computer operation: Strictly follow the 10x Genomics Chromium platform operation manual.
[0136] 10x Platform: The prepared PBMC single-cell suspension, gel beads (GEMs), oil, and reagents are loaded into the chip. The system automatically generates water-in-oil droplets to complete the capture, lysis, mRNA reverse transcription, and addition of cell barcodes and UMIs for PBMC single cells.
[0137] Subsequent library construction: cDNA is broken, sequencing adapters are added, PCR amplification is performed, and the completed sequencing library is constructed.
[0138] Library quality control: Use Qubit, Bioanalyzer, and other tools to perform quantitative and fragment size analysis on the library.
[0139] High-throughput sequencing: Sequencing is performed on platforms such as Illumina NovaSeq / HiSeq. A sequencing depth of 50,000-100,000 reads per cell is typically recommended.
[0140] Phase 5: Bioinformatics analysis.
[0141] Raw data preprocessing: Use tools such as singleCellTK (R package), scPipe (R package), and iCellR (R package) for quality control and connector removal.
[0142] Sequence alignment and quantification: Reads were aligned to the mouse reference genome (mm10) to generate a UMI count matrix for each gene in each cell.
[0143] Cellular and gene quality control filtering: Filtering low-quality cells: Removing cells with insufficient UMI count, too few genes detected, or an excessively high proportion of mitochondrial genes (indicating dead or ruptured cells). Filtering low-expression genes: Removing genes expressed in only a very small number of cells.
[0144] Data standardization and integration: Data standardization (SCTransform) was performed using tools such as Seurat and Scanpy, and technical noise and batch effect correction were performed (using Harmony and BBKNN).
[0145] Dimensionality reduction and clustering: Dimensionality reduction: PCA analysis.
[0146] Clustering: Neighborhood graphs are constructed and clustered based on principal components (such as Louvain and Leiden algorithms) to obtain different cell subpopulations.
[0147] Cell type annotation: Known cell marker genes (such as monocyte subpopulations: Ly6C (classical), Nr4a1 (non-classical)) were used for comparison with the reference database (Mouse Cell Atlas). Monocyte identity was confirmed and further subdivided into subpopulations; results are shown below. Figure 8-13 .
[0148] Figure 8 The results show the single-cell sequencing of peripheral blood mononuclear cells from mice after treatment with engineered exosomes 1-3 and PBS; it can be seen that the number of T cells increased significantly after treatment with engineered exosomes 3.
[0149] Figure 9 The number and percentage of peripheral blood T cells in mice induced by engineered exosomes; based on Figure 9 It can be seen that the number of T cells was significantly increased under the treatment of engineered exosomes 3.
[0150] Figure 10 Table 1 shows the population of peripheral blood mononuclear cells in mice after treatment with engineered exosomes; according to Figure 10 It was found that mouse peripheral blood mononuclear cells were divided into 23 clusters. According to the results of Cluster 0, the proportion of T cells was significantly increased. Therefore, the engineered exosomes prepared in this invention can significantly increase the number of T cells, that is, enhance the proliferative activity of T cells. (Lumican-HEK293T-Exo) 4-1BBL+IL15 The effect is the strongest.
[0151] Table 1. Population of mouse peripheral blood mononuclear cells
[0152] 0: T cell, 1: B cell, 2: B cell, 3: T cell, 4: T cell, 5: T cell, 6: Erythroid terminal differentiation cell, 7: Erythroid terminal differentiation cell, 8: T cell, 9: Neutrophil T cell, 10: Monocyte, 11: B cell, 12: Erythroid terminal differentiation cell, 13: Erythroid terminal differentiation cell, 14: T cell, 15: Erythroid terminal differentiation cell, 16: Monocyte; Natural killer cell, 17: Macrophage; Monocyte, 18: B cell, 19: T T cells, 20: Megakaryocyte; Monocyte; Natural killer cell; T cell, 21: B cell, 22: Monocyte, 23: Monocyte, here the 0-23 groups and Figure 11 Corresponding to 0-23, B cells are divided into different cell populations because they express different genes, and the same applies to other cells.
[0153] Figure 11 The figures show the number and proportion of peripheral blood mononuclear cells in mice after treatment with engineered exosomes; it can be seen that the number and proportion of T cells in peripheral blood of mice were significantly increased after treatment with engineered exosomes.
[0154] Figure 12GO analysis of highly expressed genes in mouse peripheral blood Cluster 0 (T cells) after engineered exosome treatment and in the untreated group showed that engineered exosome treatment resulted in the enrichment of genes related to chromosome organization, mRNA processing (messenger RNA processing), chromosomal region, telomeric region, nuclear membrane, and GTPase binding. This indicates that the activity and function of mouse peripheral blood T cells were significantly enhanced, especially in terms of cell proliferation. Figure 12 In this context, "Biological Process" represents biological processes; "Cellular Component" represents cellular components; and "Molecular Function" represents molecular functions.
[0155] Figure 12 In the Biological Processes section, from top to bottom, they are: histone modification; chromosome organization; peptidyl-lysine modification; Golgi vesicle transport; macromolecule methylation; histone methylation; protein alkylation; protein methylation; histone lysine methylation; and mRNA processing (messenger RNA processing). Figure 12 In the Cellular Component, from top to bottom, they are: Chromosomal region, vesicle tethering complex, spindle, chromosome centromeric region, PML body, microtubule, nuclear envelope, nuclear speck, chromosome telomeric region, nuclear membrane. Figure 12 In the Molecular Functions section, from top to bottom, they are: ubiquitin-like protein transferase activity, GTPase binding, transcription coregulator activity, ubiquitin-protein transferase activity, small GTPase binding, catalytic activity (acting on DNA), protein serine / threonine kinase activity, ATP-dependent activity (acting on DNA), histone binding, and ubiquitin-like protein ligase activity.
[0156] Figure 13 KEGG analysis of highly expressed genes in mouse peripheral blood Cluster 0 (T cells) after engineered exosome treatment and in the untreated group revealed that engineered exosome treatment significantly enhanced the activity and function of mouse peripheral blood T cells, particularly in disease treatment.
[0157] High-throughput sequencing results of mouse peripheral blood mononuclear cells (PBMCs) are shown below. Figure 14-17 .according to Figure 14-17 It is known that the engineered exosomes of this invention enhance the efficacy of natural killer cells, dendritic cells, macrophages, and acquired immune cells, increasing the number of natural killer cells in tumor tissue and the expression levels of cytotoxic molecules (such as perforin and granzyme); increasing the number of dendritic cells in tumor tissue, upregulating the expression of maturation markers (such as CD80, CD86, and MHC class II molecules), and enhancing antigen presentation ability; increasing macrophage polarization towards the M1 pro-inflammatory phenotype (such as upregulation of iNOS and TNF-α expression), decreasing macrophage polarization towards the M2 immunosuppressive phenotype (such as downregulation of Arg-1 and CD206 expression), and enhancing phagocytic function and secretion of pro-inflammatory cytokines; the acquired immune cells are T cells, CD4+. + T cells are characterized by an increased number in the tumor microenvironment, an increased proportion of helper T cell subsets (such as Th1 cells), and enhanced secretion of cytokines (such as IFN-γ and IL-2). CD8 + T cells showed a significant increase in number in the tumor microenvironment, enhanced killing activity (e.g., upregulation of granzyme B and perforin expression), increased proliferation capacity, and increased production of effector cytokines (e.g., IFN-γ and TNF-α).
[0158] 2) Procedure for multiplex immunofluorescence (mIHC) experiment on mouse lung tissue: Phase 1: Sample Preparation and Slicing Tissue collection and fixation: After the mice were euthanized, lung tissue was immediately dissected, immersed in sufficient formalin, and fixed at 4°C for 24 hours.
[0159] Dehydration and embedding: The fixed tissue was dehydrated by gradient ethanol, cleared with xylene, impregnated with paraffin, and then embedded in paraffin.
[0160] Sectioning: Use a microtome to cut the paraffin block into sections 4-5 μm thick, and mount them onto a detachable glass slide. Bake at 60℃ for 2 hours to ensure tight adhesion of the tissue.
[0161] Phase Two: Dewaxing, Hydration, and Antigen Retrieval Dewaxing and hydration: Immerse the sections sequentially in: xylene I, 15 min → xylene II, 15 min → anhydrous ethanol I, 5 min → anhydrous ethanol II, 5 min → 95% ethanol, 5 min → 85% ethanol, 5 min → 75% ethanol, 5 min → rinse with running water for 2 min.
[0162] Antigen retrieval: Place the slides in a retrieval box filled with antigen retrieval solution (pH 6.0 sodium citrate buffer). Perform heat-induced epitope retrieval (HIER) using an autoclave or microwave oven. Using an autoclave as an example: start timing after the pressure cooker releases steam, maintain at 110–115°C for 3 minutes, then allow to cool naturally to room temperature (approximately 1 hour). Rinse three times with PBS (pH 7.4), 5 minutes each time.
[0163] Phase 3: Endogenous substance blocking and primary antibody incubation Endogenous peroxidase blocking: Add 3% hydrogen peroxide (H2O2) solution to the slices and incubate at room temperature in the dark for 20 min. Wash three times with PBS, 5 min each time.
[0164] Serum blocking: Add 5% normal serum (e.g., goat serum) or BSA matching the species from which the secondary antibody is derived, and block for 30 minutes at room temperature. Discard; do not wash.
[0165] First round of primary antibody incubation: Add the primary antibody (prepared with antibody diluent) targeting the first target protein, ensuring complete coverage of the tissue.
[0166] Place the slices flat in a humidified chamber and incubate overnight (18h) at 4°C.
[0167] Phase 4: Signal Amplification and Color Development (First Round) HRP secondary antibody incubation: After the sections have returned to room temperature, wash three times with PBS. Add the corresponding HRP (horseradish peroxidase)-labeled secondary antibody and incubate at room temperature for 1 hour. Wash three times with PBS.
[0168] TSA fluorescence signal amplification: Following the reagent instructions, add the working solution of the selected first TSA fluorescent dye (Opal 520, 570, 620, 690, etc.) to the slide and incubate at room temperature in the dark for 5-10 minutes. Rinse three times with PBS, 5 minutes each time.
[0169] Phase 5: Antibody elution and subsequent staining (repeated cycle) Heat retrieval: This step is crucial for multiple staining, used to wash away the primary / secondary antibody complex from the previous round while retaining the covalently bound TSA fluorescent signal. The slide is then immersed again in a retrieval chamber filled with antigen retrieval solution and heat retrieval is performed using an autoclave (conditions as in stage two). After natural cooling, the slide is rinsed with PBS. This process thoroughly washes away the antibody but retains the deposited tyrosine fluorescent signal. Repeated staining cycle: After elution, the next staining cycle begins: serum blocking → incubation with the primary antibody against the second target protein (4°C overnight) → HRP secondary antibody (room temperature 1 h) → development with the second TSA fluorescent dye → heat retrieval.
[0170] Note: TSA dyes with different spectra are used in each round, and the primary antibodies must be from different species (or the same species but verified for sequential staining).
[0171] Complete all rounds of staining: According to the experimental design, repeat the cycle until all target proteins (usually 4 - 6 kinds) are labeled.
[0172] Phase 6: Counterstaining, Mounting, and Imaging Nuclear counterstaining: After completing the last round of staining and washing, add the working solution of DAPI (1 μg / mL) to cover the tissue, and incubate in the dark at room temperature for 5 - 10 min. Rinse 3 times with PBS.
[0173] Mounting:吸干切片周围水分,滴加抗荧光淬灭封片剂,盖上盖玻片,避免气泡。4℃避光保存。 Dry the moisture around the sections with a tissue paper, add an anti - fluorescence quenching mounting medium, cover with a coverslip, and avoid air bubbles. Store at 4℃ in the dark.
[0174] Image acquisition: Use a multi - spectral fluorescence microscope. Set up independent acquisition channels for each fluorescent dye (including DAPI), use monochromatic exposure to avoid cross - talk. Take multi - channel images of the same field of view for later synthesis and quantitative analysis. The results are shown in Figure 18 , where the blue frame shows the effect diagram of immune cell expansion, the red frame represents the schematic diagram of the tumor site in the tissue, and the green fluorescence represents T cells.
[0175] According to Figure 18 it can be seen that after treatment with engineered exosomes, the number, function, and activity of T cells in the tumor microenvironment of mice have been significantly improved, greatly enhancing their anti - tumor function.
[0176] Application Example 3 Operating steps: 15 SPF - level female C57BL / 6J mice, 4 weeks old, were purchased from Beijing Specif (Beijing) Biotechnology Co., Ltd. (SCXK (Beijing) 2024 - 0001), and the animal certificate number was NO.110324251106500842. After passing the animal quarantine, they were randomly grouped by body weight into three groups: Group G1 (PBS group), Group G2 (engineered exosome 1: HEK293T - Exo ctrl ), and Group G3 (engineered exosome 3: Lumican - HEK293T - Exo 4-1BBL+IL15 ), with 5 animals in each group. On the first day, LLC - LUC tumor cells were injected into the animals via the tail vein at a dose of 1×10 6 cells / mouse. The day of injecting the tumor cells was recorded as the first injection day. On the 10th, 13th, and 16th days after injecting the tumor cells, Group G2 and Group G3 were each intravenously injected with the corresponding engineered exosome 1 and engineered exosome 3 once, with an injection volume of 0.1 mL / mouse / time. Group G1 was injected with 100 μl of PBS without exosomes.
[0177] Group G2 was injected with 1:100 μg of engineered exosomes HEK293T-Exo ctrl , after resuspending the exosomes with 100 μl of PBS, injection was performed; Group G3 was injected with engineered exosomes 3: Lumican-HEK293T-Exo 4-1BBL+IL15 , after resuspending 100 μg of exosomes with 100 μl of PBS, injection was performed.
[0178] During the experiment, the clinical symptoms of the animals were observed once a day. On the 23rd day (D23) after injecting the tumor cells, the mice were anesthetized by inhaling isoflurane and then in vivo fluorescence imaging was performed using a small animal in vivo imaging system. On the 31st day (D31) after injecting the tumor cells, 5 mice from each group were sacrificed to obtain the lungs for fluorescence imaging, and the fluorescence signal intensity was measured. The measurement results of the fluorescence signal intensity are shown in Figure 20 , and the lungs were removed and placed in 10% neutral formalin solution for sufficient fixation. Figure 19 The glowing ones are tumor cells, and the added dye can stain the tumor cells. The higher the intensity and the more the quantity, the faster the disease progresses.
[0179] According to Figures 19-20 , it can be seen that during the experimental period, no abnormalities were observed in the clinical symptoms of the animals in each group. The results of small animal in vivo imaging showed that compared with Group G1, the fluorescence signal intensity of tumors in mice of Group G2 and Group G3 on D31 was significantly decreased (p < 0.05). The results showed that engineered exosomes 1: HEK293T-Exo ctrl , engineered exosomes 3: Lumican-HEK293T-Exo 4-1BBL+IL15 could both activate T cells in the mice of Xiehe expansion to exert tumor killing function, and the fluorescence intensity of tumor cells in Group G3 was the weakest, with the best therapeutic effect.
[0180] Application Example 4 Operating steps: Twenty SPF-grade female C57BL / 6J mice, 4 weeks old, were purchased from Beijing Spey Foster Biotechnology Co., Ltd. (SCXK (Beijing) 2024-0001), and the animal certificate number was N0.110324251106415027. After passing the quarantine, they were randomly grouped according to body weight, with 3 animals in each group, a total of 9 animals, divided into 3 groups, namely Group G1 (PBS group, injected with 100 μl of PBS), Group G2 (engineered exosomes 1: HEK293T-Exo ctrl , after resuspending 100 μg of exosomes with 100 μl of PBS, injection was performed), Group G3 (engineered exosomes 3: Lumican-HEK293T-Exo 4-1BBL+IL15100 μg of exosomes were resuspended in 100 μl PBS before injection. The PBS group received an equal volume of PBS without exosomes. The injection volume for all three groups was 0.1 mL / animal / injection. The day of exosome injection was designated as day 1. On day 4 and day 7, the corresponding engineered exosome 1 and engineered exosome 3 were administered once each. On day 10, each group received 1×10⁻⁶ exosomes. 6 LLC cells were injected via tail vein, and the day of the first administration of exosomes was designated as D1.
[0181] During the experiment, clinical symptoms of the animals were observed once daily. After D31 mice were anesthetized with isoflurane inhalation, in vivo fluorescence imaging was performed on all mice using a small animal in vivo imaging system, and the fluorescence signal intensity was measured. Multiple immunofluorescence assays in the mouse lung tissue showed weakening. Figure 21 The mice were then euthanized by dislocation, and their lungs were collected and fixed in formalin.
[0182] Figure 22 The colored areas represent tumor cells; the deeper the fluorescence intensity, the greater the number of tumor cells, indicating faster progression. According to... Figure 22 It can be seen that no abnormalities were observed in the clinical symptoms of the animals in each group during the experimental period. The in vivo imaging results of small animals showed that, compared with the G1 group, the intensity of the D31 tumor fluorescence signal in the G2 and G3 groups was significantly reduced. p <0.05). The results showed that engineered exosomes could activate and expand T cells in mice to exert tumor-killing functions and inhibit tumor growth rate.
[0183] In summary, this invention established a C57BL / 6J mouse LLC-Luc lung cancer xenograft model and injected engineered exosomes via the tail vein. After treatment with engineered exosomes, the number, function, and activity of T cells in the mouse tumor microenvironment were significantly improved, greatly enhancing their anti-tumor function. Combined with single-cell sequencing, immunofluorescence analysis, and in vivo imaging technology, the effects on tumor growth rate, metastatic ability, and the number and activity of invasive T cells in the tumor microenvironment were evaluated.
[0184] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. An engineered exosome carrying a fusion protein of a membrane protein-active molecule and / or a fusion protein of a membrane protein-collagen-binding protein; The membrane protein includes at least one of CD9, CD63, and Lamp2B; The active molecules include at least one or more of cytokines, immunostimulatory molecules, costimulatory molecules, and chemokines. The immunostimulatory molecules include IL15; The co-stimulatory molecules include 4-1BBL; The collagen-binding protein includes at least one of fibronectin, the collagen-binding domain contained in fibronectin, and Lumican.
2. The engineered exosomes according to claim 1, characterized in that, The active molecules include IL15 and 4-1BBL, and the collagen-binding protein includes Lumican.
3. The engineered exosome according to claim 1, characterized in that, The membrane protein-active molecule fusion protein is a CD63-IL15-4-1BBL fusion protein; the nucleotide sequence of the gene encoding the CD63-IL15-4-1BBL fusion protein is shown in SEQ ID NO:1; the amino acid sequence of the CD63-IL15-4-1BBL fusion protein is shown in SEQ ID NO:
2. Alternatively, the membrane protein-collagen-binding protein fusion protein is a Lamp2b-Lumican fusion protein; the nucleotide sequence of the gene encoding the Lamp2b-Lumican fusion protein is shown in SEQ ID NO:3; the amino acid sequence of the Lamp2b-Lumican fusion protein is shown in SEQ ID NO:
4.
4. The engineered exosomes according to claim 3, characterized in that, The amino acid sequence of the Lamp2b-Lumican fusion protein, from the N-terminus to the C-terminus, consists of the extracellular region sequence of the Lamp2b protein, the amino acid sequence of the first linker peptide, the full-length or functional fragment amino acid sequence of the Lumican protein, the amino acid sequence of the fourth flexible linker peptide, the tag, the amino acid sequence of the second linker peptide, and the extracellular region sequence of the Lamp2b protein and the stop codon, connected in sequence. The amino acid sequence of the CD63-IL15-4-1BBL fusion protein, from the N-terminus to the C-terminus, is composed of the extracellular amino acid sequence of the CD63 protein, the amino acid sequence of the first flexible linker peptide, the amino acid sequence of the IL15 protein, the amino acid sequence of the second flexible linker peptide, the tag, the amino acid sequence of the third flexible linker peptide, the extracellular sequence of the CD63 protein, and the stop codon, connected sequentially. Preferably, the amino acid sequence of the first flexible linker peptide is GS; The amino acid sequence of the second flexible linker is GSG; The amino acid sequence of the third flexible linker peptide is GGGGS or a variant thereof; The amino acid sequence of the fourth flexible linker peptide is GGGGS or a variant thereof; The amino acid sequence of the first linker peptide is AR; The second linker peptide has the amino acid sequence SGG.
5. The engineered exosome according to claim 4, characterized in that, The label includes at least one of affinity purification label, epitope label, fluorescence and reporter label, and solubilization and multifunctional label; The affinity purification tag includes at least one of His, Flag, Strep-tag II, GST, MBP, T7, Protein A / G, and PA tag; The epitope tags include at least one of HA, Myc, V5, ALFA, Spot / BC2, MoonTag, SunTag, and 2B8; The fluorescent and reporter tag includes at least one of GFP and its variant EGFP, luciferase, and other fluorescent proteins; The solubilizing and multifunctional tag includes at least one of SUMO, NEXT tag, thioredoxin, CuSF, NusA, Fh8, CAT, and DHFR; The stop codon includes TAA.
6. The method for preparing engineered exosomes according to any one of claims 1-5, characterized in that, include: S1, using a recombinant lentivirus containing the nucleotide sequence of the fusion protein encoding the membrane protein-active molecule and the fusion protein encoding the membrane protein-collagen-binding protein; S2, Using the recombinant lentivirus to infect mammalian parent cells, and then screening and culturing them with antibiotics, engineered cells that stably overexpress fusion proteins of membrane protein-active molecules and membrane protein-collagen-binding proteins are obtained; S3, collect the conditioned medium of engineered cells that stably overexpress the fusion protein of membrane protein-active molecule and the fusion protein of membrane protein-collagen-binding protein, and separate and purify to obtain engineered exosomes; in S3, the separation method includes ultracentrifugation, which includes a first centrifugation, a second centrifugation, filtration and a third centrifugation in sequence.
7. The preparation method according to claim 6, characterized in that, The mammalian parent cells include, but are not limited to, tool cell lines used in the production of bioactive molecules or vaccines, and cell lines commonly used in scientific research. The tool cell line includes at least one of HEK293 cell line, CHO cell line and Vero cell line; The cell lines commonly used in scientific research include at least one of the following: NK cell line, macrophage cell line, human B lymphoma cell line, and human T lymphocyte leukemia cell line; The NK cell line includes the NK92 cell line, the macrophage cell line includes the THP1 cell line, the human B lymphoma cell line includes the Raji cell line, and the human T lymphocytic leukemia cell line includes the Jurkat cell line.
8. The preparation method according to claim 6, characterized in that, In S2, the antibiotics used for screening include puromycin, with a screening concentration of 2-5 μg / mL and a screening time of 7-10 days.
9. The preparation method according to claim 6, characterized in that, In S3, the conditions for the first centrifugation are: 4-6℃, 500-700g centrifugation for 10-15min; The conditions for the second centrifugation are: 4-6℃, centrifugation at 15000g-20000g for 25-35 minutes; The conditions for the third centrifugation are: 4-6℃, 100,000 - 120,000 g for 60-90 min; and / or, the filtration includes screen filtration.
10. The use of the engineered exosomes according to any one of claims 1-5 or the engineered exosomes prepared by the preparation method according to any one of claims 6-9 in at least one of the following: 1) To prepare drugs for increasing the number of infiltrating T cells in the tumor microenvironment; 2) To prepare drugs for enhancing the activity of infiltrating T cells in the tumor microenvironment; 3) To prepare drugs that enhance the activity of innate immune cells within the tumor microenvironment; 4) To prepare drugs for enhancing the activity of acquired immune cells in the tumor microenvironment; 5) Prepare drugs for the treatment of solid tumors.
11. The application according to claim 10, characterized in that, the Solid tumors include at least one of the following: lung cancer, pancreatic cancer, breast cancer, colorectal cancer, liver cancer, stomach cancer, ovarian cancer, prostate cancer, and glioma.
12. A pharmaceutical composition, characterized in that, The invention includes engineered exosomes as described in any one of claims 1-5 or engineered exosomes prepared by the preparation method described in any one of claims 6-9, as well as pharmaceutical excipients, wherein the pharmaceutical excipients include pharmaceutically acceptable carriers, diluents or excipients.
13. The pharmaceutical composition according to claim 12, characterized in that, The dosage form of the pharmaceutical composition includes one or more of the following: oral formulation, injection, transdermal drug delivery system, and mucosal drug delivery system. The routes of administration for the injection include intravenous injection, intratumoral injection, intraperitoneal injection, or intralymphatic injection. The transdermal drug delivery system includes: a gel, a microneedle patch, and a transdermal patch; The mucosal drug delivery system includes at least one of eye drops, nasal sprays, nasal drops, nebulizers, and dry powder inhalers; The oral preparations include oral capsules and / or oral liquids; The injectable formulation includes a sustained-release formulation for injection; the sustained-release formulation for injection includes hydrogels and / or injectable microgels.
14. The pharmaceutical composition according to claim 12 or 13, characterized in that, The pharmaceutical composition further comprises other antitumor active ingredients; the other antitumor active ingredients are selected from at least one of immune checkpoint inhibitors, chemotherapy drugs, molecularly targeted drugs, cancer vaccines, oncolytic viruses, and cell therapy preparations; the immune checkpoint inhibitor is at least one of antiPD-1 antibody, antiPD-L1 antibody, and antiCTLA-4 antibody.
Citation Information
Patent Citations
Exosome for promoting tumor infiltration of T lymphocytes and preparation method thereof
CN114349845A