A cellulose synthase CESA1 mutant and its application

CN122563906APending Publication Date: 2026-08-14ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-10
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

相关研究表明,赋予CBIs耐受性的点突变常集中在CESA的跨膜区或催化域,但不同CBI的分子结合位点和作用方式存在显著差异,导致耐药位点具有较强的药物特异性,交叉耐药性有限

Benefits of technology

1)本发明首次明确纤维素酶CESA1作为除草剂MDD的作用靶点,利用化学诱变筛选结合连锁群体分析鉴定出对MDD耐受的CESA1点突变(A903T、H1024Y)。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122563906A_ABST
    Figure CN122563906A_ABST
Patent Text Reader

Abstract

This invention relates to the field of plant biotechnology, specifically to a mutant of the cellulose synthase CESA1 and its applications. Two MDD-insensitive mutants (A903T and H1024Y) with amino acid substitutions in CESA1 were identified through EMS mutagenesis screening combined with sequencing-based linkage population analysis (BSA-seq). CESA1 containing the aforementioned point mutations was transformed and complemented... cesa1 The absence of a background component restored plant survival and conferred resistance to MDD, demonstrating that CESA1 is a direct or functional site of action for MDD. Based on target identification and the application of resistance genes, this invention provides a theoretical basis and practical strategies for developing MDD-based herbicides and cultivating MDD-resistant crops, possessing significant scientific research and agricultural application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant biotechnology, specifically to a cellulose synthase CESA1 mutant and its applications. Background Technology

[0002] Herbicides are an important chemical means of controlling weeds and ensuring crop yield and quality in modern agriculture. For a long time, herbicides have achieved selective or non-selective weed control by inhibiting different physiological and biochemical pathways in plants (such as amino acid synthesis, photosynthesis, hormone signaling, or cell wall biosynthesis).

[0003] Cellulose biosynthesis is a core process in plant cell wall formation, directly determining cell elongation and tissue mechanical properties, thus making it a highly attractive target for weed control. Cellulose is synthesized by the cellulose synthesis complex (CesA complex, CSC) located in the plasma membrane, which is composed of various CesA proteins. Interference with the localization or catalytic activity of CSC can cause cell swelling, root growth inhibition, and plant growth arrest. This phenotype is also a common feature of the actions of many types of cellulose biosynthesis inhibitors (CBIs). Representative known CBIs include isoxaben, 4-(2-bromo-4,5-dimethoxyphenyl)-3,4-dihydro-1H-benzo[h]quinoline-2-one, 5-(4-chlorophenyl)-7-(2-methoxyphenyl)-1,5,6,7-tetrahydro-triazolo[1,5-a] (C17), and ES20, which targets the catalytic site of CESA. These inhibitors provide practical herbicides for crop protection and have become key chemical tools for studying the function of CSCs. Related studies have shown that point mutations conferring tolerance to CBIs are often concentrated in the transmembrane region or catalytic domain of CESA, but there are significant differences in the molecular binding sites and modes of action of different CBIs, resulting in strong drug specificity of the resistance sites and limited cross-resistance.

[0004] Although existing research has revealed the action characteristics of various CBIs, breakthroughs are still needed in the development of herbicides with clear new mechanisms of action. Summary of the Invention

[0005] In view of this, this invention proposes a CESA1 mutant of cellulose synthase and its application. By constructing the CESA1 mutant, it was applied to a herbicide screening system. Through chemical mutagenesis screening and sequencing-based linkage population analysis, the natural product MDD was determined to act on CESA1, and related resistance sites were identified, providing new scientific basis and application pathways for herbicide development and resistant crop breeding.

[0006] The specific technical solution is as follows: In a first aspect, the present invention provides a cellulose synthase CESA1 mutant, wherein the cellulose synthase CESA1 mutant differs from the parent, Arabidopsis thaliana, in the amino acid sequence of one or more amino acids. Arabidopsis thaliana Col-0 ecotype.

[0007] Furthermore, the differences include: alanine at position 903 of the sequence corresponding to the parent Arabidopsis thaliana SEQ ID NO.1 is mutated to a neutral amino acid, or histidine at position 1024 is mutated to an aromatic amino acid.

[0008] Furthermore, the mutations include: The A at position 903 is mutated to any one of T, S, C, G, or P; preferably A903T. Alternatively, the H at position 1024 may be mutated to any one of Y, F, or W; preferably H1024Y.

[0009] Furthermore, the amino acid sequence when the A at position 903 is mutated to T is shown in SEQ ID NO.2.

[0010] Furthermore, the amino acid sequence when the H at position 1024 is mutated to Y is shown in SEQ ID NO.3.

[0011] Furthermore, the mutation is a semi-dominant mutation.

[0012] Furthermore, the semi-dominant mutation refers to a situation in plants where a single copy of the mutation can confer the corresponding trait, and the degree of expression of the trait is positively correlated with the number of mutated copies. When both copies are mutated, the resistance is more pronounced.

[0013] Secondly, the present invention provides a nucleic acid molecule encoding the above-mentioned cellulose synthase CESA1 mutant.

[0014] Furthermore, when the cellulose synthase CESA1 mutant is mutated from A to T at position 903 of the parent Arabidopsis thaliana SEQ ID NO.1, its encoded nucleotide sequence is shown in SEQ ID NO.4.

[0015] Furthermore, when the cellulose synthase CESA1 mutant has an H mutation of Y at position 1024 relative to the parent Arabidopsis thaliana SEQ ID NO.1, its encoded nucleotide sequence is shown in SEQ ID NO.5.

[0016] Thirdly, the present invention provides a recombinant vector comprising the above-mentioned nucleic acid molecules.

[0017] Fourthly, the present invention provides a genetically engineered cell, wherein the genetically engineered cell comprises the above-mentioned nucleic acid molecule or the above-mentioned recombinant vector.

[0018] Fifthly, the present invention provides a kit comprising the above-mentioned mutant, or the above-mentioned nucleic acid molecule, or the above-mentioned recombinant vector, or the above-mentioned genetically engineered cell.

[0019] Sixthly, the present invention provides a method for preparing a cellulose synthase CESA1 mutant, comprising: The above-mentioned genetically engineered cells were cultured, and the cellulose synthase CESA1 mutant was obtained by inducing expression and purification.

[0020] In a seventh aspect, the present invention provides the use of the above-mentioned cellulose synthase CESA1 mutant, the above-mentioned nucleic acid molecule, the above-mentioned recombinant vector, and the above-mentioned genetically engineered cell in any of the following: 1) Cultivate herbicide-resistant plant strains; 2) Prepare a kit for screening cellulase inhibitors.

[0021] Furthermore, the applications include obtaining herbicide-resistant strains through gene editing, transgenic methods, mutagenesis, hybridization, backcrossing, or asexual reproduction.

[0022] Furthermore, the target of the cellulase inhibitor is cellulase CESA1.

[0023] Furthermore, the active ingredient of the cellulase inhibitor includes: 6,8-dimethoxy-3-[1-hydroxy-2,2-dichloropropyl]coumarin (MDD, C 14 H 14 Cl2O5MW 333.16), 4-(2-bromo-4,5-dimethoxyphenyl)-3,4-dihydro-1H-benzo[h]quinoline-2-one (quinoxyphen, C 21 H 18 BrNO3MW 412.28), 5-(4-chlorophenyl)-7-(2-methoxyphenyl)-1,5,6,7-tetrahydro-triazolo[1,5-a]pyrimidine (C17, C 18 H 17 ClN4O MW340.8).

[0024] Furthermore, the active ingredient of the cellulase inhibitor is preferably 6,8-dimethoxy-3-[1-hydroxy-2,2-dichloropropyl]coumarin or 4-(2-bromo-4,5-dimethoxyphenyl)-3,4-dihydro-1H-benzo[h]quinoline-2-one.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows: 1) This invention first clearly identifies cellulase CESA1 as a target of the herbicide MDD, and identifies MDD-tolerant CESA1 point mutations (A903T, H1024Y) using chemical mutagenesis screening combined with linkage population analysis.

[0026] 2) The cellulase mutant of this invention undergoes an amino acid substitution at position 903 of the transmembrane domain, changing from alanine to threonine. This mutation enables plants to develop resistance to three cellulase inhibitors: MDD, Quinoxyphen, and C17.

[0027] 3) The cellulase mutant of this invention undergoes an amino acid substitution at position 1024 of the transmembrane domain, changing from histidine to tyrosine. This mutation enables plants to develop resistance to two cellulase inhibitors, MDD and Quinoxyphen. Attached Figure Description

[0028] Figure 1 The mutation sites were located in two MDD-resistant plants obtained by mutagenesis screening in Examples 1 and 2 of this invention, and in linkage populations. Figure 1 a represents the growth phenotype of the M2 population in medium containing MDD, with red arrows indicating two MDD-insensitive plants; Figure 1 b is mddi1-1, mddi1-2 The growth phenotypes of its hybrid F1 plants on alcohol- and MDD-containing media; Figure 1 c is a pair mddi1-1 and mddi1-2 MDD-insensitive plants in the F2 population obtained by crosses with wild type were subjected to pooled sequencing to show the SNP frequency of mutation sites. Figure 1 d represents the key amino acid position and substitution type involved in MDD resistance.

[0029] Figure 2 This invention relates to the verification of MDD resistance mutation sites and the construction of resistant plants in Example 3 of the present invention; wherein, Figure 2 PCR identification showed that A903T, H1024Y, and wild-type CESA1 could all be retrograded. cesa1 Growth lethal phenotype of the complete deletion mutant; Figure 2 b represents the hypocotyl length of A903T, H1024Y and wild-type CESA1 replants after 5 days of dark culture in MDD medium; Figure 2 c represents the length of the taproot of A903T, H1024Y, and wild-type CESA1 replanted plants after 7 days of light cultivation in MDD-containing medium.

[0030] Figure 3This invention describes the resistance test of the MDD-resistant mutant to quinoxyphen and C17 cellulase inhibitors in Example 4 of this invention; wherein, Figure 3 a is mddi1-1 and mddi1-2 The length of the primary root after 7 days of light cultivation in a medium containing Quinoxyphen; Figure 3 b is mddi1-1 , mddi1-2 The root length of C17-insensitive plants 18A1 S307 and 14U G1013E after 7 days of light cultivation in a C17-containing medium.

[0031] Figure 4 This invention describes the resistance test of the MDD-resistant mutant to two cellulase inhibitors, isoxaben and ES20, in Example 4 of this invention; wherein, Figure 4 a is mddi1-1 , mddi1-2 and isoxaben-insensitive plants ixr1-1 The length of the primary root after 7 days of light cultivation in isoxaben-containing medium; Figure 4 b is mddi1-1 , mddi1-2 and ES20 insensitive plants ES20-R4 The length of the primary root after 7 days of light culture in ES20 medium.

[0032] Figure 5 This is an example of the resistance detection of other cellulase inhibitor-insensitive plants on MDD-containing medium plates in Example 4 of the present invention; wherein, Figure 5 a represents plants insensitive to isoxaben. ixr1-1 , ixr1-2 , ixr2-1 The length of the primary root after 7 days of light cultivation in medium containing MDD or an equal volume of alcohol solvent; Figure 5 b represents ES20 insensitive plants. es20-r2 , es20-r3 , ES20-R4 , ES20-R7 , es20-r9 , es20-r15 The length of the primary root after 7 days of light cultivation in medium containing MDD or an equal volume of alcohol solvent; Figure 5 c represents C17 insensitive plants 20c1 , 1B , 2C , 3D , 9Q , 14U , 9R , 8P , 3F , 7L , 18A1The length of the primary root after 7 days of light cultivation in medium containing MDD or an equal amount of alcohol solvent.

[0033] Figure 6 This is the wild type in Embodiment 5 of the present invention. mddi1-1 and mddi1-2 Plant growth phenotypes after four weeks; among them, Figure 6 a is a plant growth diagram; Figure 6 b represents the fresh weight of the plant.

[0034] Figure 7 The structural formula is that of 6,8-dimethoxy-3-[1-hydroxy-2,2-dichloropropyl]coumarin (MDD).

[0035] Figure 8 The structural formulas are 4-(2-bromo-4,5-dimethoxyphenyl)-3,4-dihydro-1H-benzo[h]quinoline-2-one and 5-(4-chlorophenyl)-7-(2-methoxyphenyl)-1,5,6,7-tetrahydro-triazolo[1,5-a]pyrimidine (C17). Detailed Implementation

[0036] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited to the contents described herein. Unless otherwise specified, the methods in this embodiment are operated according to conventional methods, and the reagents used are commercially available conventional reagents.

[0037] In this invention, Arabidopsis thaliana Arabidopsis thaliana The amino acid sequence of the Col-0 ecotype cellulase CESA1 is shown in SEQ ID NO.1.

[0038] SEQ ID NO.1:

[0039] In this invention, the amino acid sequence of the cellulose synthase CESA1 mutant (CESA1-A903T) is shown in SEQ ID NO.2.

[0040] SEQ ID NO.2:

[0041] In this invention, the amino acid sequence of the cellulose synthase CESA1 mutant (CESA1-H1024Y) is shown in SEQ ID NO.3.

[0042] SEQ ID NO.3:

[0043] In this invention, the encoding nucleotide sequence of the cellulose synthase CESA1 mutant (CESA1-A903T) is shown in SEQ ID NO.4.

[0044] SEQ ID NO.4:

[0045] In this invention, the encoding nucleotide sequence of the cellulose synthase CESA1 mutant (CESA1-H1024Y) is shown in SEQ ID NO.5.

[0046] SEQ ID NO.5:

[0047] In this invention, the structural formula of 6,8-dimethoxy-3-[1-hydroxy-2,2-dichloropropyl]coumarin (8-methyldichlorodiaporthin, MDD) is as follows: Figure 7 As shown.

[0048] In this invention, the structural formulas of quinoxyphen and C17 are as follows: Figure 8 As shown.

[0049] Example 1: EMS mutagenesis screening and mutant screening Approximately 5000 wild-type Arabidopsis thaliana (Col-0) seeds were soaked in 20 mL of 0.1% KCl (w / v) at room temperature for 1 hour, followed by centrifugation to remove the KCl. A 20 mL EMS (Ethyl methanesulfonate) treatment solution (0.1 M phosphate buffer, pH 5.8, containing 5% DMSO, EMS concentration 1‰) was prepared, and the seeds were placed in this solution and incubated in a fume hood with shaking for 16 hours. After treatment, the EMS solution was discarded by centrifugation, and the seeds were washed three times with 0.1 M sodium thiosulfate solution (shaking for 15 minutes each time and centrifuging to remove the solution). The washed seeds were then sown in soil (M0). Once the M0 seeds reached maturity, the resulting seeds were collected and designated M1. M1 seeds and wild-type controls were sown on 1 / 2 MS solid medium containing 10 µM MDD (1 L formulation: 2.2 g MS powder, 0.5 g MES, 10 g sucrose, adjusted to pH 5.8 with KOH, made up to 1 L, 8 g agar added, autoclaved, and MDD added when cooled to about 50°C). Root length changes were observed after 7 days, and MDD-tolerant mutants were screened based on root length recovery.

[0050] from Figure 1 It can be seen that, when M1 generation seeds were grown in 1 / 2 MS solid medium containing 10 µM MDD, two plants showed root elongation, indicating resistance to MDD, and were named... mddi1-1 and mddi1-2 .

[0051] Example 2: Linkage population analysis (BSA-seq) to locate mutation sites Will mddi1-1 and mddi1-2 The mutants were crossed with wild-type (Col-0, WT), and the F1 cells were collected and sown. After maturity, the F2 seeds were collected. The F1, F2, and wild-type seeds obtained from the hybridization were then compared. mddi1-1 and mddi1-2 The seeds were sown on 1 / 2 MS plates containing 10 μM MDD to screen phenotypes and identify dominance and recessiveness. mddi1-1 ×WT and mddi1-2 From the F2 population of ×WT, approximately 50 plants that recovered root length after 7 days (MDD tolerance) were selected, and the samples were pooled and recovered. Genomic DNA was extracted using the CTAB method and subjected to next-generation high-throughput sequencing. The sequencing results were used to statistically analyze whole-genome mutation sites and calculate allele frequencies (SNP frequencies) to locate mutation regions, genes, and sites.

[0052] Figure 1 b shows, mddi1-1 and mddi1-2 Single mutants are insensitive to MDD. mddi1-1 ×WT and mddi1-2 The F1 cells of ×WT showed an intermediate phenotype between wild type and parent on MDD plates, suggesting that the mutations in both mutants were semi-dominant. Figure 1 High-throughput sequencing results of F2 cells showed that the SNP frequencies of both MDD-resistant plants exhibited significant linkage peaks at the end of chromosome 4, suggesting that the mutation sites in both mutants were located within this region. Within this candidate region, only the CESA1 gene showed missense mutations in both mutants. Figure 1 As shown in d, both mutation sites are located in the transmembrane domain of CESA1.

[0053] Example 3: Validation of MDD resistance mutation sites and construction of resistant plants Wild-type CESA1 and its upstream 2 kb promoter, as well as the CESA1 fragment containing the A903T or H1024Y mutation, were amplified and cloned into the plant transformation vector pEG302-GW. The three reconstructed vectors were then transformed into plants using Agrobacterium-mediated transformation. cesa1 Heterozygous mutants were collected, and seeds from the T0 generation were sown. The seeds were then spread on a substrate containing 50 μg / mL hygromycin (Solepro, CAS: 31282). 04 Positive screening was performed on 1 / 2 MS solid medium (9). Homozygous positive plants were obtained after two generations of hygromycin screening, and PCR was used to confirm that the CESA1 original site was a homozygous mutant.

[0054] SAIL_278_E08_LP_1: CCAGAACTGCTCGTTCCTCC (SEQ ID NO.6); SAIL_278_E08_LP_2: AGCTAATCTTGGACATGGAA (SEQ ID NO.7); SAIL_278_E08_RP: CCTGCGTTCAAGGGATCTGC (SEQ ID NO.8); sail LB: GGATAAATAGCCTTGCTTCC (SEQ ID NO. 9).

[0055] Complementary strains containing wild-type CESA1, A903T, and H1024Y were cultured on 1 / 2 MS solid medium containing 10 μM MDD and an equal amount of solvent control, respectively, to assess tolerance to MDD.

[0056] from Figure 2 The AC results show that the three construction vectors are complementary. cesa1 The missing lethal phenotype yields homozygous mutant plants with the CESA1 in situ gene. However, complementary plants carrying only A903T or H1024Y are resistant to MDD, while wild-type complementary plants do not confer MDD resistance to plants.

[0057] Example 4: Cross-resistance between MDD-resistant plants and other cellulase inhibitors Cellulose synthase inhibitors are a class of plant growth inhibitors, with reported representatives including isoxaben, 4-(2-bromo-4,5-dimethoxyphenyl)-3,4-dihydro-1H-benzo[h]quinoline-2-one, indaziflam, 5-(4-chlorophenyl)-7-(2-methoxyphenyl)-1,5,6,7-tetrahydro-triazolo[1,5-a]pyrimidine (C17), and N-(4-methoxybenzoyl)-N'-(2-methylbenzoyl)thiocarbazide (ES20). To detect whether MDD exhibits cross-resistance with these inhibitors, [the following is a separate, unrelated section:] mddi1-1 , mddi1-2 The root length changes were compared after inoculating the positive controls and the positive controls on 1 / 2 MS plates containing 10 μM MDD for 7 days.

[0058] from Figure 3 ab display mddi1-1 It exhibits resistance to quinoxyphen and C17. And from... Figure 4 ab display mddi1-1 Sensitive to isoxaben, indaziflam and ES20. Figure 3 ab and 4a-b also show mddi1-2 It exhibits resistance to quinoxyphen but is sensitive to C17, isoxaben, indaziflam, and ES20. These results indicate that the mechanism of action of MDD is similar to that of quinoxyphen and C17, but different from that of isoxaben, indaziflam, and ES20.

[0059] Figure 5As shown in Table 1, most plants resistant to isoxaben, ES20, and C17 remain susceptible to MDD, with only the S307L amino acid substitution exhibiting partial resistance to MDD. These results indicate that the A903T and H1024Y sites play important roles in MDD resistance.

[0060] Table 1 Mutation sites and amino acid changes Insensitive plant mutant genes Sensitive to MDD Cellulase inhibitors Root length on MDD plate (mean ± SD) A903T CESA1 no MDD 2.61±0.41 H1024Y CESA1 no MDD 1.43±0.23 G998D CESA3 yes isoxaben 0.13±0.02 T942I CESA3 yes isoxaben 0.14±0.02 R1064W CESA6 yes isoxaben 0.15±0.03 G632D CESA6 yes ES20 0.14±0.02 G935E CESA6 yes ES20 0.11±0.03 D605N CESA6 yes ES20 0.15±0.02 S394F CESA6 yes ES20 0.14±0.02 L829F CESA6 yes ES20 0.13±0.02 S818T CESA6 yes ES20 0.12±0.03 P1010L CESA1 yes C17 0.14±0.02 A1023T CESA1 yes C17 0.15±0.01 S983F CESA3 yes C17 0.13±0.02 V297M CESA1 yes C17 0.16±0.02 L872F CESA1 yes C17 0.1±0.02 G1013E CESA1 yes C17 0.12±0.02 G1013R CESA1 yes C17 0.41±0.04 S1037F CESA3 yes C17 0.13±0.02 S892N CESA1 yes C17 0.14±0.01 A1018V CESA1 yes C17 0.14±0.05 S307L CESA1 Partial resistance C17 1.23±0.15 Example 5: MDD-resistant plants had no effect on plant growth and yield. Although CESA1 is an essential gene for plants, its complete knockout is lethal and cannot produce homozygous mutants. Figure 6 The results showed that after four weeks of incubation at 22°C, mddi1-1 and mddi1-2 It did not exhibit growth defects, and its biomass was not significantly different from that of the wild type.

[0061] This invention is not limited to the specific textual description above. Various changes can be made to this invention within the scope outlined in the claims, and all such changes are within the scope of this invention.

Claims

1. A CESA1 mutant of cellulose synthase, characterized in that, The cellulose synthase CESA1 mutant differs from the parent, Arabidopsis thaliana, in its amino acid sequence by one amino acid. Arabidopsis thaliana Col-0 ecotype; The differences include: alanine at position 903 of the sequence corresponding to the parent Arabidopsis thaliana SEQ ID NO.1 is mutated to a neutral amino acid, or histidine at position 1024 is mutated to an aromatic amino acid.

2. The CESA1 mutant of cellulase according to claim 1, characterized in that, The mutations include: The A at position 903 is mutated to any one of T, S, C, G, or P; preferably A903T. Alternatively, the H at position 1024 may be mutated to any one of Y, F, or W; preferably H1024Y.

3. The CESA1 mutant of cellulase according to claim 1, characterized in that, The mutation is a semi-dominant mutation; The semi-dominant mutation refers to a trait that can be conferred by a single copy of a mutation in plants, and the degree of expression of the trait is positively correlated with the number of mutated copies. When both copies are mutated, the resistance is more pronounced.

4. A nucleic acid molecule encoding a mutant of the cellulose synthase CESA1 according to any one of claims 1 to 3.

5. A recombinant vector, characterized in that, It includes the nucleic acid molecule as described in claim 4.

6. A genetically engineered cell, characterized in that, The genetically engineered cell comprises the nucleic acid molecule of claim 4 or the recombinant vector of claim 5.

7. A reagent kit, characterized in that, This includes the mutants described in claims 1 to 3, the nucleic acid molecules described in claim 4, the recombinant vectors described in claim 5, or the genetically engineered cells described in claim 6.

8. A method for preparing a CESA1 mutant of cellulose synthase, characterized in that, include: The genetically engineered cells of claim 6 were cultured, and the cellulose synthase CESA1 mutant was obtained by inducing expression and purification.

9. The use of the CESA1 mutant of cellulose synthase according to claims 1-3, the nucleic acid molecule according to claim 4, the recombinant vector according to claim 5, or the genetically engineered cell according to claim 6 in any of the following: 1) Cultivate herbicide-resistant plant strains; 2) Prepare reagents or kits for screening cellulase inhibitors.

10. The application according to claim 9, characterized in that, The active ingredients of the cellulase inhibitor include: 6,8-dimethoxy-3-[1-hydroxy-2,2-dichloropropyl]coumarin, 4-(2-bromo-4,5-dimethoxyphenyl)-3,4-dihydro-1H-benzo[h]quinoline-2-one, and 5-(4-chlorophenyl)-7-(2-methoxyphenyl)-1,5,6,7-tetrahydro-triazolo[1,5-a]pyrimidine.