A deoxycytidine kinase and its applications

CN122563909APending Publication Date: 2026-08-14SHENZHEN CHILDRENS HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-24
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

[0008]本发明旨在克服现有合成复杂修饰脱氧胞苷三磷酸技术的缺陷与不足,提供一种脱氧胞苷酸激酶AfhD及其应用

Benefits of technology

1.本发明发现了来源于大肠杆菌噬菌体的脱氧胞苷酸激酶AfhD,其结构与功能未见文献记载。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122563909A_ABST
    Figure CN122563909A_ABST
Patent Text Reader

Abstract

This invention discloses a deoxycytidine kinase and its applications. The deoxycytidine kinase AfhD obtained from the genome screening of bacteriophage HY126 can synthesize glycosylated deoxycytidine triphosphate (DTP) in a green manner, significantly reducing the environmental pollution caused by traditional chemical synthesis methods. It provides a method for biotechnology modification and offers new enzyme elements and pathways for the biosynthesis of DTP and its base-modified derivatives.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a class of deoxycytidine kinases, specifically deoxycytidine kinase AfhD and its application in the production of modified nucleoside triphosphates. Background Technology

[0002] With the development of biotechnology, the application of modified nucleotides has expanded from basic research to a wide range of biomedical fields, especially in the development of nucleic acid drugs. Chemical modification not only endows nucleotide drugs with pharmacological activity, but more importantly, it can significantly enhance their ability to resist degradation by nucleases in vivo, that is, improve their "resilience," thereby ensuring that the drug exerts a stable effect in vivo.

[0003] Beyond pharmaceuticals, DNA or RNA products with specific chemical modifications also demonstrate significant application value in fields such as molecular diagnostics, gene editing tools, nucleic acid vaccines, and nucleic acid aptamers due to their superior nuclease resistance, enhanced stability, and binding affinity. Currently, the mainstream method for introducing modifications into oligonucleotide chains is based on enzymatic / chemoenzymatic methods, which involve directly synthesizing substrates using chemically modified nucleoside triphosphates (dNTPs / NTPs) under the catalysis of DNA or RNA polymerases.

[0004] Therefore, the supply of high-quality, structurally diverse modified dNTPs / NTPs has become a key bottleneck. Currently, the synthesis of modified dNTPs / NTPs mainly involves two routes: chemical synthesis and enzymatic synthesis.

[0005] Chemical synthesis: The process is usually cumbersome and lengthy, requiring the use of large amounts of toxic reagents and expensive catalysts, resulting in high costs, significant environmental impact, and low yields when synthesizing certain sensitive functional groups.

[0006] Enzymatic synthesis offers advantages such as mild conditions, high selectivity, and environmental friendliness, making it theoretically more attractive. However, existing commercially available kinases typically have narrow substrate profiles, generally poor tolerance to non-natural bases or complex sugar ring modifications, and low catalytic efficiency. This severely limits the ability of enzymatic synthesis of complex modified dNTPs / NTPs.

[0007] Against this backdrop, this invention identifies a novel deoxycytidine kinase—AfhD—from the genome of bacteriophage HY126. This enzyme can efficiently catalyze the conversion of arabinoglycosylated deoxycytidine monophosphate (AfhD) to arabinoglycosylation. Phosphorylation occurs, producing the corresponding diphosphate and triphosphate products. and The discovery of AfhD provides a novel enzymatic tool for synthesizing complexly modified deoxycytidine triphosphates at the nucleotide level. Summary of the Invention

[0008] This invention aims to overcome the shortcomings and deficiencies of existing technologies for synthesizing complex modified deoxycytidine triphosphates, and provides a deoxycytidine kinase AfhD and its applications. This enzyme can synthesize glycosylated deoxycytidine triphosphates (AfhD) in vitro. Phosphorylation to glycosylated deoxycytidine triphosphate ( ).

[0009] To achieve the above objectives, the present invention adopts the following technical solution: This invention discovers the phosphorylation function of the AfhD protein, which is encoded by phage HY126 of Escherichia coli JM109.

[0010] This invention provides a specific synthesis The system comprises AfhD, the nucleotide sequence of which is shown in SEQ ID NO.1 and the amino acid sequence encoded by it is shown in SEQ ID NO.2.

[0011] The present invention also provides a vector pWHU4505 for expressing the recombinant protein AfhD in Escherichia coli.

[0012] The deoxycytidine kinase AfhD can be expressed in Escherichia coli BL21(DE3), but this host is only an example and does not limit the scope of the invention. AfhD can also be expressed in cells and corresponding organisms including but not limited to Streptomyces, Bacillus subtilis, Pseudomonas aeruginosa, yeast, insect cells, plant cells, mammalian cells, and human cells.

[0013] The deoxycytidine kinase AfhD provided by this invention can catalyze... Phosphorylation .

[0014] Phosphorylation formation Reaction formula The advantages of this invention are as follows: 1. This invention discovers a deoxycytidine kinase AfhD derived from Escherichia coli bacteriophages, the structure and function of which have not been documented in the literature.

[0015] 2. Specific catalysis: This enzyme has the ability to... Phosphorylation to Its activity enables the efficient synthesis of complex glycosylated deoxycytidine triphosphates.

[0016] 3. Broad substrate adaptability: AfhD has strong tolerance to base modifications and can also phosphorylate dCMP and 5hdCMP into the corresponding triphosphate products, making it suitable for the synthesis of nucleoside triphosphates with other cytosine-modified bases.

[0017] 4. Green Synthesis: This activity can be used for the synthesis of... Deoxycytidine triphosphate and other modified bases reduce the use of toxic organic reagents in traditional chemical synthesis methods, lower production costs, and are more environmentally friendly.

[0018] 5. Application value: It provides key modified nucleoside triphosphate monomers for nucleic acid drug development, gene editing tools, nucleic acid vaccines and other fields. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.

[0020] Figure 1 The distribution of the afhD gene on the genome of HY126 bacteriophage; Figure 2 Here is a schematic diagram of the structure of plasmid pWHU4505; Figure 3 The results of purification of AfhD recombinant protein; Figure 4 Results of AfhD protein function validation; Figure 5 Substrate selectivity analysis for AfhD protein Figure 6 This is a schematic diagram of the AfhD catalytic mechanism.

[0021] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0022] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are for illustrative purposes only and should not be construed as limiting the invention in any way. Unless otherwise stated, the present invention is implemented using conventional molecular biology, biochemistry, and microbiology techniques in the art.

[0023] Materials and general methods used in the examples: Strains and plasmids: Escherichia coli BL21(DE3) and JM109 were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; plasmid pET28a(+) was preserved in our laboratory; bacteriophage HY126 was isolated and preserved in our laboratory.

[0024] Enzymes and reagents: Restriction endonucleases, homologous recombinase kits, and high-fidelity DNA polymerase were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; IPTG, ATP, dCMP, and 5hdCMP standards were purchased from Sigma-Aldrich. Prepared in our laboratory previously; HPLC-grade methanol and acetonitrile were purchased from Merck; other routine reagents were domestically produced analytical grade.

[0025] Culture conditions: Escherichia coli was cultured in LB medium (1% tryptone, 0.5% yeast extract, 1% sodium chloride), with kanamycin added as needed. ).

[0026] Mass spectrometry analysis method: The sample was filtered through a 10 kDa ultrafiltration membrane and then directly injected for mass spectrometry analysis. An ABSciex TripleTOF 5600+ mass spectrometer was used for detection in negative ion mode with an electrospray ionization (ESI) source.

[0027] Example 1: Identification of the afhD gene and its distribution on the genome of HY126 bacteriophage. This invention involves whole-genome sequencing of bacteriophage HY126, a strain of Escherichia coli JM109 preserved in the laboratory. Bioinformatics analysis revealed a 549 bp open reading frame (AfhD) in the HY126 genome. The nucleotide sequence of this gene is shown in SEQ ID NO.1, encoding a 182-amino acid protein, the amino acid sequence of which is shown in SEQ ID NO.2. BLASTp alignment analysis showed that the AfhD protein exhibited low homology with proteins of known function, and 40%-60% homology with some presumed phage proteins, suggesting that it may be a novel phage-encoded deoxycytidine kinase.

[0028] Example 2: Construction of AfhD recombinant protein expression plasmid pWHU4505 2.1 Primer Design Primers for homologous recombination were designed based on the afhD gene sequence and the multiple cloning site sequence of the pET28a(+) vector: Primers for amplifying the afhD gene: Upstream primer P1: 5'- CTTTAAGAAGGAGATATACC ATGGCTAAAATTATTTTAGT-3' Downstream primer P2: 5'- GTGGTGGTGGTGCTCGAGAC GAGCCCATTTGATAATTT-3' The underlined parts are sequences homologous to the vector and are used for homologous recombination.

[0029] Primers for amplifying linearized vectors: Upstream primer P3: 5'-CTCGAGCACCACCACCAC-3' Downstream primer P4: 5'-GGTATATCTCCTTCTTAAAG-3' 2.2 PCR amplification Using phage HY126 genomic DNA as a template, PCR amplification was performed using primers P1 / P2. The reaction system ( Template DNA 100 ng, upstream and downstream primers each dNTPs 0.2 mM, high-fidelity DNA polymerase 1 U, 10× buffer Add sterile water until Amplification program: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, for a total of 30 cycles; 72℃ final extension for 10 min.

[0030] Using pET28a(+) plasmid as a template, PCR amplification was performed using primers P3 / P4 to obtain the linearized vector fragment. The amplification program was the same as above, but the extension time was changed to 2 min.

[0031] The PCR products were analyzed by 1% agarose gel electrophoresis, yielding an approximately 550 bp afhD gene fragment and an approximately 5.3 kb linearized vector fragment. The two fragments were purified separately using a gel extraction kit.

[0032] 2.3 Homologous recombination linkage Prepare homologous recombination reactions according to the system in Table 1 ( ): Table 1. Homologous recombination reaction system After gently mixing, react at 50°C for 30 min. After the reaction is complete, cool the product on ice for later use.

[0033] 2.4 Transformation and Identification Will Addition of recombinant products E. coli In competent cells, incubate on ice for 30 min, heat shock at 42°C for 90 s, and immediately incubate on ice for 2 min. Add Culture medium, incubate at 37°C for 1 hour to recover. Take... Bacterial solution applied to a solution containing kanamycin ( Incubate overnight at 37°C on LB plates.

[0034] Single clones were picked and inoculated into LB liquid medium (containing kanamycin) and cultured overnight at 37°C with shaking. The plasmid was then extracted and sequenced for verification. Sequencing results showed that the afhD gene was correctly inserted into the vector without mutation, indicating that the recombinant plasmid pWHU4505 was successfully constructed. Its plasmid map is shown below. Figure 2 As shown in the figure. In this plasmid, the afhD gene is expressed by fusion with a 6× His tag at the C-terminus, controlled by the T7 promoter, and has a kanamycin resistance marker, making it suitable for inducing recombinant protein expression in Escherichia coli BL21(DE3).

[0035] Example 3: Expression and purification of recombinant AfhD protein 3.1 Protein-induced expression The pWHU4505 plasmid was transformed into E. coli BL21(DE3) competent cells, plated on LB agar plates containing kanamycin, and incubated overnight at 37°C. Single colonies were picked and inoculated into 10 mL of LB medium (containing kanamycin) and incubated overnight at 37°C.

[0036] Transfer the overnight culture to 1 L LB medium (containing kanamycin) at a ratio of 1:100 and incubate at 37°C and 220 rpm until... Approximately 0.6. Lower the culture temperature to 16℃, adjust the rotation speed to 180 rpm, and after the temperature stabilizes, add IPTG to a final concentration of 1 mM, and continue induction culture at 16℃ for 16 h.

[0037] 3.2 Collection and disruption of bacterial cells Collect bacterial cells by centrifuging at 4°C and 6000 × g for 15 min. Resuspend the bacterial pellet in pre-cooled lysis buffer (25 mM Tris-HCl, 300 mM NaCl, 20 mM imidazole, pH 8.0) and add 10 mL of lysis buffer per gram of wet bacterial weight.

[0038] The resuspension was placed in an ice bath and homogenized using a high-pressure homogenizer at 4°C and 600 bar for 5 min. The homogenized homogenate was centrifuged at 4°C and 10,000 g for 1 h to remove cell debris and insoluble impurities. The supernatant was then... The solution was filtered through a membrane to obtain a clear crude enzyme solution.

[0039] 3.3 Nickel column affinity chromatography Load the crude enzyme solution onto a 5 mL HisTrap HP nickel column (GE Healthcare) equilibrated with lysis buffer at a flow rate of 1 mL / min. To ensure complete binding, repeat the column pass three times with the supernatant. After loading, wash the column with 3 column volumes of lysis buffer to remove unbound contaminants.

[0040] Subsequently, the fractions were eluted in stages using 2 column volumes of lysis buffer containing 20 mM, 50 mM, 100 mM, 200 mM, 300 mM and 500 mM imidazole, and the eluted fractions were collected.

[0041] 3.4 SDS-PAGE Analysis Each eluted fraction was analyzed by 12% SDS-PAGE. Based on the electrophoresis results, the eluted fraction with the highest protein purity (usually the 100-200 mM imidazole elution peak) was selected for further purification.

[0042] 3.5 Size Exclusion Chromatography The target protein fractions collected by affinity chromatography were combined and concentrated to 2 mL using an ultrafiltration tube (10 kDa molecular weight cutoff). The concentrate was loaded onto a Superdex 200 Increase 10 / 300 GL column (GE Healthcare) equilibrated with gel filtration buffer (25 mM Tris-HCl, 150 mM NaCl, 5% glycerol, pH 8.0) at a flow rate of 0.5 mL / min, and each elution peak was collected.

[0043] 3.6 Purity Verification and Protein Preservation The target protein peak was collected and validated by SDS-PAGE. The results are as follows: Figure 3 As shown, the purified protein exhibits a single protein band with a molecular weight of approximately 22 kDa, consistent with the theoretical molecular weight of AfhD protein (approximately 22.2 kDa), indicating that high-purity recombinant AfhD protein has been obtained.

[0044] The purified AfhD protein was concentrated to approximately 10 mg / mL using ultrafiltration, and the protein concentration was determined (Bradford method). It was then aliquoted into... Small samples were flash-frozen in liquid nitrogen and stored at -80°C for later use. Approximately 18 mg of high-purity AfhD protein was obtained from 1 L of culture.

[0045] Example 4: Functional Verification of AfhD Protein 4.1 Reaction System Prepare in 1.5 mL centrifuge tubes Reaction system: Tris-HCl buffer: 100 mM, pH 8.0 10 mM 1 mM ATP: 2 mM (as phosphate donor) AfhD protein: (about ) Simultaneously set the following controls: Control 1: No AfhD protein added Control 2: No ATP added Comparison 3: No addition Control 4: AfhD protein was pre-inactivated by boiling. 4.2 Reaction Conditions After mixing the reaction system, place it in a 37°C water bath for 2 hours.

[0046] 4.3 Sample Preparation After the reaction was completed, the reaction solution was transferred to an ultrafiltration membrane with a molecular weight cutoff of 10 kDa and centrifuged at 4°C and 12000×g for 20 min to remove proteins and insoluble impurities.

[0047] The filtrate was adsorbed onto an anion exchange resin (DEAE Sephadex A-25) and eluted with a linear gradient of 0-1 M NaCl. Each elution peak was collected. The collected target product peak was desalted using a C18 column and then concentrated by vacuum lyophilization. Reconstitute with ultrapure water and directly inject for mass spectrometry analysis.

[0048] 4.4 Mass spectrometry detection results Mass spectrometry analysis results as follows Figure 4 As shown. Compared with the control groups, three main peaks were detected in the complete reaction system: m / z 454.1: Corresponding substrate [MH] - ion m / z 534.3: Corresponding product [MH] - ion m / z 614.4: Corresponding product [MH] - ion Secondary mass spectrometry analysis further confirmed the structural characteristics of each product. Quantitative analysis showed that, under standard reaction conditions, approximately 35% of the products... Transform into Approximately 28% were converted .

[0049] This result fully confirms that the AfhD protein can... Using ATP as a substrate, it catalyzes the stepwise phosphorylation of ATP to generate the corresponding diphosphate and triphosphate products.

[0050] Example 5: Selectivity analysis of AfhD protein substrates 5.1 Experimental Design To investigate the substrate selectivity of the AfhD protein, the substrate was replaced with the following in the reaction system of Example 4: Group A: dCMP (1 mM) Group B: 5hdCMP (1 mM) Group C: CMP (1 mM) Group D: dAMP (1 mM) Group E: dGMP (1 mM) Group F: dTMP (1 mM) The reaction conditions, subsequent processing, and detection methods are the same as in Example 4.

[0051] 5.2 Results Analysis Mass spectrometry detection results as follows Figure 5 As shown: Group A (dCMP): The corresponding diphosphate product dCDP (m / z 386.1) and triphosphate product dCTP (m / z 466.1) were detected, indicating that AfhD can use natural dCMP as a substrate. Figure 5 a).

[0052] Group B (5hdCMP): The corresponding diphosphate product 5hdCDP (m / z 402.1) and triphosphate product 5hdCTP (m / z 482.1) were detected, indicating that AfhD can use hydroxylated modified dCMP as a substrate. Figure 5 b).

[0053] CF group: No corresponding phosphorylation products were detected, indicating that AfhD has no activity against CMP, dAMP, dGMP, and dTMP.

[0054] 5.3 Comparison of relative activities By quantitatively comparing the product yields of each group, the relative activity of AfhD for different substrates was calculated (with dCMP as 100%). dCMP: 100% 5hdCMP: 86% 63% CMP, dAMP, dGMP, dTMP: <1% 5.4 Conclusion These results indicate that AfhD has the following characteristics: Substrate specificity: It specifically recognizes cytosine nucleotides and has no activity against purine nucleotides and uracil nucleotides.

[0055] Base modification tolerance: It has good tolerance to 5-position hydroxylation modification (5hdCMP activity is 86% of dCMP activity).

[0056] Glycosyl modification tolerance: It has a certain tolerance for arabinoglycosylation modification. The activity was 63% of that of dCMP.

[0057] Phosphorylation form specificity: It cannot directly phosphorylate nucleosides using monophosphate or diphosphate as substrates.

[0058] This indicates that AfhD has strong tolerance to base and sugar ring modifications and can be applied to the synthesis of nucleoside triphosphates with various cytosine-modified bases.

[0059] Example 6: Enzymatic Properties Analysis of AfhD 6.1 Determination of Optimal pH AfhD activity was determined in different pH buffers: MES buffer for pH 5.0-6.0, MOPS buffer for pH 6.5-7.5, Tris-HCl buffer for pH 8.0-9.0, and CAPS buffer for pH 9.5-10.5. All buffer concentrations were 100 mM. The substrate was used, and other conditions were the same as in Example 4.

[0060] The results showed that the optimal reaction pH for AfhD was 8.0-8.5, and it maintained high activity (>70%) in the pH range of 7.5-9.0. The activity decreased significantly (<30%) when the pH was below 7.0 or above 9.5.

[0061] 6.2 Determination of Optimal Temperature AfhD activity was measured at different temperatures (4, 16, 25, 30, 37, 42, 50, 60 °C). The substrate was used, and other conditions were the same as in Example 4.

[0062] The results showed that the optimal reaction temperature for AfhD was 37℃, and its activity was high (>75%) in the range of 30-42℃. The activity decreased sharply when the temperature exceeded 50℃, and it was basically inactivated at 60℃.

[0063] 6.3 Metal ion dependence Using different divalent metal ions ( , , , , , (Final concentration 10 mM) to replace the standard reaction system Alternatively, metal ions can be chelated with EDTA (5 mM) to determine AfhD activity.

[0064] The results show: 100% relative activity 78% relative activity 10% relative activity , , <1% relative activity EDTA-treated group: inactive This indicates that the catalytic activity of AfhD depends on divalent metal ions. For the optimal metal ion, It can be partially replaced.

[0065] Example 7: Enzyme kinetic analysis of AfhD 7.1 Optimization of Reaction Conditions To accurately determine the enzyme kinetic parameters of AfhD, the reaction conditions were first optimized. Preliminary experiments determined that the reaction rate was linearly related to the amount of enzyme and time under the following conditions: Reaction time: 15 min AfhD dosage: Concentration: 10 mM (saturation concentration) ATP concentration: 2 mM (saturation concentration) Reaction temperature: 37℃ Buffer solution: 100 mM Tris-HCl, pH 8.0 7.2 Dynamics Experiment Prepare the reaction solution according to the following system ( ): 100 mM Tris-HCl (pH 8.0) 10 mM ATP: 2 mM AfhD: Add 20, 50, 100, 200, 500, 800, and 1200 mg of the solution according to the concentration gradient. Three parallel reactions were set up for each concentration. The reaction system (except for the substrate) was premixed and pre-incubated at 37°C for 2 min. The appropriate concentration of substrate was added to start the reaction, and the reaction was allowed to proceed precisely for 15 min.

[0066] 7.3 Reaction Termination and Sample Preparation Add immediately after the reaction is complete Mix with trichloroacetic acid (100%, w / v), vortex, and incubate on ice for 10 min to completely denature the protein. Centrifuge at 15000 × g for 10 min at 4°C to remove protein precipitate, and use the supernatant. After filtration through a filter membrane, HPLC-UV analysis was performed.

[0067] 7.4 Data Processing The enzyme kinetic parameters were calculated using nonlinear fitting based on the Michaelis-Menten equation as follows: by For the substrate: kcat = Vmax / [E] = 2.38 / 0.5 = 4.76 min kcat / Km = 4.76 / 246.3 = 0.0193 Using dCMP as a substrate (control): The results show that AfhD has a high affinity for the natural substrate dCMP and for complex modified substrates. It still maintains good catalytic efficiency and has the potential to be applied to the synthesis of modified nucleoside triphosphates.

[0068] Example 8: Application of AfhD in the preparation of arabinoglycosylated deoxycytidine triphosphate To verify the application potential of AfhD in the preparation of arabinoglycosylated deoxycytidine triphosphate, a scale-up reaction was conducted. The following was added to a 5 mL reaction system: 5 mM (approximately 10 mg) ATP: 10 mM (approximately 27 mg) AfhD: 10 mM Tris-HCl buffer: 100 mM, pH 8.0 The reaction system was incubated at 37°C for 4 hours. Samples were taken every 30 minutes to monitor the reaction progress.

[0069] 8.2 Product Purification After the reaction was completed, the reaction solution was filtered through a 10 kDa ultrafiltration membrane to remove the protein. The filtrate was purified by anion exchange chromatography (HiTrap Q HP, 5 mL), eluted with a linear gradient of 0-1 M NaCl, and the target product peak was collected.

[0070] The collected target fraction was desalted by C18 reversed-phase chromatography, concentrated by rotary evaporation, and freeze-dried to obtain a white powder product.

[0071] 8.3 Product Identification Mass spectrometry analysis revealed that the main component of the purified product was... (m / z 614.1), purity approximately 92%. Approximately 4.8 mg of purified product was obtained from a 5 mL reaction system, with a molar conversion of approximately 28%.

[0072] This result demonstrates that AfhD can be used for the large-scale synthesis of arabinoglycosylated deoxycytidine triphosphates, providing a key modified nucleoside triphosphate monomer for subsequent nucleic acid drug development.

[0073] The above embodiments describe in detail the specific implementation of the present invention, and fully demonstrate that the AfhD protein has catalytic properties. generate The activity, and the specific catalytic mechanism, are as follows: Figure 6 As shown, it exhibits good substrate adaptability to various cytosine-modified nucleotides and can achieve green synthesis of complex modified nucleoside triphosphates via enzymatic methods.

[0074] The above description is merely a preferred embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural transformations made using the contents of the present invention's specification and drawings under the inventive concept of the present invention, or direct / indirect applications in other related technical fields, are included within the patent protection scope of the present invention.

Claims

1. A deoxycytidine kinase, characterized in that, Its amino acid sequence is shown in SEQ ID NO.2: 1 MAKIILVDGP DNAGKTTFIN DIMEISERYV KIDFPKRTVD GRFDVKSRNE VGCFETMLNY 61 LDPTKIYLLD RGYISNWVYG RIRQDADSVL DVYEQDYVRL CQNHDVFTII LTRNEMTESF 121 EDDLITLSSF GFNTVISYFE EFAIHNEIQT YQLLNHDGAN KVIGFNASER NNLITEIIKW 181 AR.

2. The deoxycytidine kinase according to claim 1, characterized in that, The deoxycytidine kinase is a derivative protein of the amino acid sequence shown in SEQ ID NO.2, which has been substituted, deleted, or added with one or more amino acids and has the activity of catalyzing the phosphorylation of deoxycytidine monophosphate or its derivatives.

3. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule encodes a deoxycytidine kinase as described in claim 1 or 2, and the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO. 1: 1 ATGGCTAAAA TTATTTTAGT AGATGGCCCG GATAATGCTG GTAAAACAAC TTTCATTAAT 61 GACATAATGG AAATTAGTGA AAGATATGTA AAGATTGATT TCCCTAAACG AACAGTTGAT 121 GGACGTTTCG ATGTTAAGTC TCGAAATGAA GTTGGCTGTT TCGAAACGAT GTTGAATTAT 181 TTAGACCCTA CTAAGATTTA TCTGTTAGAC CGTGGATATA TTAGTAACTG GGTTTATGGA 241 CGTATTCGAC AAGATGCGGA CTCGGTTCTT GACGTTTATG AACAGGATTA TGTTCGTCTT 301 TGCCAAAACC ATGATGTGTT CACAATTATT TTAACACGTA ACGAAATGAC TGAAAGTTTT 361 GAAGACGACC TTATTACTTT GTCTTCGTTC GGTTTTAATA CAGTCATTTC ATATTTTGAA 421 GAGTTTGCAA TTCATAACGA AATCCAAACG TATCAATTAC TTAATCATGA TGGTGCTAAC 481 AAAGTTATAG GATTTAATGC AAGCGAACGT AATAATTTGA TTACAGAAAT TATCAAATGG 541 GCTCGTTAA.

4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule as described in claim 3.

5. An engineered cell, characterized in that, The engineered cells comprise the recombinant expression vector of claim 4.

6. The engineered cell according to claim 5, characterized in that, The host cell of the engineered cells is a prokaryotic cell or a eukaryotic cell; The prokaryotic cells are preferably Escherichia coli, Streptomyces, Bacillus subtilis, or Pseudomonas aeruginosa; The eukaryotic cells are preferably yeast cells, insect cells, plant cells, mammalian cells, or human cells.

7. A method for producing deoxycytidine triphosphate or its derivatives, characterized in that, The method includes the following steps: (1) culturing the engineered cells of claim 6 or 7 to express deoxycytidine kinase AfhD; (2) isolating deoxycytidine triphosphate or a derivative thereof from the culture.

8. A method for the in vitro enzymatic synthesis of deoxycytidine triphosphate or its derivatives, characterized in that, Using deoxycytidine monophosphate or its derivatives as substrates, a reaction is carried out in the presence of the deoxycytidine kinase, phosphate donor and divalent metal ions as described in claim 1 or 2 to generate deoxycytidine triphosphate or its derivatives. The deoxycytidine monophosphate or its derivative is dCMP, 5-hydroxydeoxycytidine monophosphate (5hdCMP), or arabinofuranyl-5-hydroxydeoxycytidine monophosphate (5hdCMP). The phosphate donor is ATP; the divalent metal ion is... or .

9. The method according to claim 8, characterized in that, A reaction system for producing deoxycytidine triphosphate or its derivatives, characterized in that it comprises the deoxycytidine kinase as described in claim 1 or 2, deoxycytidine monophosphate or its derivative substrate, a phosphate donor, and a divalent metal ion.

10. The use of the deoxycytidine kinase of claim 1 or 2, or the recombinant expression vector of claim 4, or the engineered cell of claim 5 or 6, or the reaction system of claim 9 in the preparation of deoxycytidine triphosphate or its derivatives.