A method for preparing circular RNA

Abstract

This invention discloses a method for preparing circular RNA, belonging to the field of biotechnology. The method includes: S1, preparing linear RNA to be circularized and splice DNA; S2, mixing the two with a reaction buffer and then subjecting them to thermal shock annealing to allow the splice DNA to bind to the linear RNA at specific sites; S3, adding cyanogen bromide at 0–4°C to carry out a chemical cyclization reaction, causing dehydration at both ends of the linear RNA to form a covalently closed circular RNA. This invention utilizes short-chain splice DNA to stably bind to linear RNA at low temperatures and guide cyclization, achieving a cyclization rate of over 90%. After cyclization, the splice and circular RNA are easily separated when the temperature is raised to room temperature. This method offers mild cyclization conditions, simple operation, high cyclization rate, and is easily scaled up, making it suitable for the industrial preparation of raw materials for circular RNA vaccines, protein substitutes, and antitumor drugs.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for preparing circular RNA. Background Technology

[0002] In recent years, RNA-based drug and vaccine technologies have developed rapidly, becoming a promising new therapeutic platform in the biomedical field. Circular RNA (circRNA) is formed by backsplicing of precursor mRNA into a covalently closed circular structure. It lacks a 5' cap and a 3' poly(A) tail and is widely present in eukaryotic cells. Compared with traditional linear mRNA, circular RNA has significant advantages such as extremely high exonuclease tolerance, long in vivo half-life, low immunogenicity, and long-term stable expression of target proteins. It has shown great application potential in infectious disease vaccines, tumor immunotherapy, protein replacement therapy, and rare disease treatment, and is recognized as a core platform for next-generation RNA drugs, belonging to the important component of "RNA Therapeutics 2.0".

[0003] Currently, the in vitro preparation and drug conversion of circular RNA has become a research hotspot. Its in vitro synthesis and cyclization mainly include technical routes such as enzymatic cyclization, self-splicing ribozyme strategy, and reverse splicing guidance method. After cyclization, high-speed centrifugation, gel electrophoresis, HPLC, column chromatography and other methods are usually used for separation and purification to remove linear RNA, double-stranded RNA (dsRNA) and protein impurities, so as to ensure product purity and immunological safety.

[0004] However, existing in vitro circularization and purification processes for circular RNA still have many insurmountable drawbacks, which severely restrict their industrial production and clinical translation:

[0005] (1) Existing processes mostly involve cyclization at room temperature or medium temperature, which can easily lead to non-specific pairing and an increase in side reactions. Furthermore, the precursor RNA is tightly bound to the cyclization product and is difficult to dissociate at room temperature, which greatly increases the difficulty of subsequent separation and results in high linear RNA residue.

[0006] (2) Conventional purification processes are difficult to efficiently remove impurities such as dsRNA and uncircularized linear RNA. Even trace amounts of impurities can significantly activate innate immune pathways such as TLR and RIG-I, leading to increased immunogenicity and affecting drug safety.

[0007] Therefore, developing a circular RNA circularization and purification process with mild circularization conditions, easy removal of the clamp, simple separation, and suitable for scale-up production has become an urgent technical problem to be solved in this field. Summary of the Invention

[0008] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for preparing circular RNA to solve the problems of harsh cyclization conditions and difficult separation in existing processes, thereby meeting the needs of industrial production of circular RNA drugs.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] A method for preparing circular RNA includes the following steps:

[0011] S1, Prepare the linear RNA to be circularized and the clip DNA;

[0012] S2, Annealing: Mix the linear RNA to be circularized, the splice DNA, and the reaction buffer, and perform thermal shock annealing;

[0013] S3, Low-temperature chemical cyclization: After annealing, the system temperature is controlled at 0-4℃, a cyclization catalyst is added, and after mixing, a chemical cyclization reaction is carried out. The two ends of the linear RNA are dehydrated to form covalently closed circular RNA, which is the circular RNA.

[0014] Furthermore, in step S1, the base length of the clip DNA is 10-16 bases, the Tm value is 20-30℃, and the molar ratio of clip DNA to linear RNA to be circularized is 1.5-3:1.

[0015] Furthermore, in step S2, the thermal shock annealing operation is as follows: maintain a constant temperature of 90~100℃ for 1.8~2 min, and slowly cool down to 8~12℃ at a rate of 0.08~0.12℃ / min to achieve complementary pairing and binding between the clamp and the linear RNA.

[0016] Furthermore, in step S2, the reaction buffer is a 2.5× buffer solution, consisting of 0.25M MES and 0.02M MgCl2, with a pH of 7.5.

[0017] Furthermore, in step S3, the cyclization catalyst is a solution, the concentration of the added cyanogen bromide solution is 4.5M, the cyclization reaction is carried out in an ice bath at 0-4°C, and the cyclization reaction time is 2.5-4 minutes.

[0018] On the other hand, the present invention also provides the application of the above preparation method in the preparation of vaccines, protein substitute drugs, and circular RNA raw materials for anti-tumor use.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) The present invention uses DNA clip sequence to help fix the linear RNA to be circularized. The molar ratio of clip to RNA to be circularized is controlled at 1.5~3. The circularization reaction is carried out at low temperature (0~4℃), which effectively inhibits non-specific binding and side reactions, and improves the circularization efficiency and reaction specificity.

[0021] (2) The clamp sequence designed in this invention is 10-16 bases long, and the Tm temperature is controlled at 20-30℃. During low-temperature cyclization, it stably binds to linear RNA to guide the cyclization reaction, achieving a cyclization rate of over 90%. After cyclization, the binding ability of the clamp to the circular RNA product weakens when the temperature is raised to room temperature, making them easy to separate. This thermodynamic characteristic eliminates the need for complex DNA enzyme removal steps in subsequent purification. The clamp DNA and uncirculated linear RNA can be efficiently removed simply by conventional ethanol precipitation, washing with 70% ethanol, and molecular sieve column chromatography. Compared to the cumbersome process of existing technologies that rely on gel electrophoresis, HPLC, and enzyme treatment, the cyclization process provided by this invention can significantly simplify subsequent purification operations, shorten the preparation cycle, and reduce equipment costs.

[0022] (3) The preparation method provided by the present invention does not require complex equipment throughout the process, and the key steps (thermal shock annealing and low-temperature chemical cyclization) are easy to scale up and are suitable for industrial production. At the same time, the cyclization reaction is rapid and can be completed in a short time. The overall process is efficient and economical, and can meet the needs of large-scale preparation of raw materials for circular RNA vaccines, protein substitute drugs, anti-tumor drugs and other pharmaceutical products.

[0023] (4) This invention provides an integrated preparation scheme for the clinical translation of circular RNA drugs with mild cyclization conditions, simple separation and easy scale-up. Attached Figure Description

[0024] Figure 1 The results of 20% denaturing polyacrylamide gel electrophoresis in this invention;

[0025] Figure 2 The molecular weight of the pre-circulated linear RNA raw material was determined using a Xevo G3-XS QTOF mass spectrometer.

[0026] Figure 3 The molecular weight of the cyclized product was determined using a Xevo G3-XS QTOF mass spectrometer. Detailed Implementation

[0027] The present invention will be further described below with reference to the accompanying drawings and embodiments. The embodiments of the present invention include, but are not limited to, the following embodiments.

[0028] The method for preparing circular RNA by chemical cyclization provided in this embodiment is as follows:

[0029] I. Experimental Objective

[0030] An RNA chemical circularization process was established, and the circular RNA products were identified and the circularization effect was verified by electrophoretic migration rate analysis.

[0031] II. Experimental Materials and Equipment

[0032] 1. Nucleotide sequence:

[0033] The RNA sequence to be circularized is shown in SEQ NO:1 (concentration 700 ng / μL):

[0034] SEQ NO:1: CUCCCCUAUCCAUGGAGCCCCUACCGCCCC;

[0035] The DNA sequence of the splint is shown in SEQ NO:2 (Tm=30℃, concentration 13795.9ng / μL):

[0036] SEQ NO:2: GGGCTCCATG.

[0037] 2. Reagents: 2.5× buffer (0.25M MES, 0.02M MgCl2) pH 7.5, 4.5M cyanogen bromide (CNBr), 5M sodium chloride solution, anhydrous ethanol, microRNA quantitative detection kit (Thermo Fisher Scientific, catalog number Q32880); all reagents are prepared using RNase-free raw materials to avoid degradation of RNA substrates by exogenous nucleases.

[0038] 3. Instruments and equipment: Nanodrop (ultra-micro spectrophotometer), thermostatic metal mixer, pipette, electronic timer, gel imaging system, vertical electrophoresis apparatus, refrigerated centrifuge, Xevo G3-XS QTOF mass spectrometer.

[0039] 4. Consumables: 1.5mL EP centrifuge tubes, EP tube rack, pipette tips, ice box.

[0040] III. Test Methods

[0041] 1. Detection Items: The results of RNA circularization reaction were detected by denaturing polyacrylamide gel electrophoresis (PAGE) to distinguish between circular and linear nucleic acids.

[0042] 2. Specific operating steps:

[0043] (1) Sample setup: Total reaction volume 100 μL / group, and prepare the reaction system according to the components and addition volumes in Table 1 below.

[0044] Table 1. Components and dosage in the thermal shock reaction system (100 μL reaction system)

[0045] Components Experimental group (μL) 2.5×Buffer A buffer 40 RNA to be circularized (3300 pmol) 45 Splint DNA (6600 pmol) 2 Enzyme-free water 13

[0046] After the reagents are added, vortex thoroughly to mix, and seal the centrifuge tube opening with sealing film; execute the thermal shock temperature control program: maintain a constant temperature of 95℃ for 2 min, and then slowly reduce the temperature to 10℃ at a cooling rate of 0.1℃ / min (overnight) to complete the annealing and pairing.

[0047] (2) Low-temperature cyclization

[0048] After the thermal shock annealing is completed, place the reaction tube in an ice box at a low temperature (0~4℃), add 11μL of 4.5M cyanogen bromide solution, vortex thoroughly to mix, and manually shake continuously for 3 minutes to complete the RNA chemical circularization.

[0049] (3) Precipitation

[0050] Add 2 μL of 5M sodium chloride solution to the cyclized system and mix well to adjust the ionic strength of the system;

[0051] Add 300 μL of anhydrous ethanol, mix by inversion, and place at -80℃ to precipitate and enrich nucleic acids for 1 hour;

[0052] Centrifuge at 12000 rpm and 4℃ for 15 min, and discard the supernatant after centrifugation;

[0053] Add 500 μL of 70% ethanol solution prepared with enzyme-free water to the precipitate, centrifuge at 12000 rpm and 4℃ for 15 min, and discard the supernatant; repeat the ethanol washing operation once.

[0054] After washing, remove the supernatant and dry at room temperature for 5 minutes; add 50 μL of enzyme-free water to fully resuspend the nucleic acid precipitate to obtain the purified sample to be tested.

[0055] IV. Test Results

[0056] 1. The concentration of the purified sample was measured, and the data are shown in Table 2 below:

[0057] Table 2 Concentration Detection Results

[0058] serial number Volume (μL) Concentration (ng / μL) experimental group 50 2343

[0059] As can be seen from the data in the table above, the nucleic acid recovery concentration in the experimental group in this embodiment is relatively high, which proves that the low-temperature chemical cyclization process provided by the present invention can achieve effective enrichment and cyclization of RNA, and the overall process performance is good.

[0060] 2. Results of 20% denaturing PAGE electrophoresis

[0061] The purified sample was subjected to 20% denaturing polyacrylamide gel electrophoresis, and the results are as follows: Figure 1 As shown, from Figure 1It can be seen that the splint fragment, the RNA fragment to be circularized, and the circularized product fragment are clearly distinguishable. The electrophoresis image was analyzed using the iBright analysis software of the Thermo Fisher iBright 1500 imaging analysis system. The circularized product accounted for more than 90%, and the circularization method met the process requirements.

[0062] 3. Mass spectrometry detection results

[0063] The molecular weights of the linear RNA raw material before circularization and the purified product after circularization were determined using a Xevo G3-XS QTOF mass spectrometer. The mass spectrometry results before and after circularization are shown below. Figure 2 and Figure 3 As shown in the figure, by comparing the two sets of measured molecular weight values, it can be seen that the molecular weight of the product is less than the theoretical molecular weight of the raw linear RNA by the relative molecular mass of one water molecule. This confirms that the linear RNA loses one water molecule and forms a covalently closed cyclic structure, thus confirming the successful cyclization reaction at the molecular weight level.

[0064] V. Conclusion

[0065] This invention utilizes a clamp-mediated DNA anchoring process combined with a low-temperature chemical catalysis process using cyanogen bromide to induce dehydration condensation of the hydroxyl / phosphate groups at both ends of linear RNA, resulting in the removal of one water molecule and the formation of a covalently closed ring structure (as shown in the molecular formula below). Furthermore, this invention leverages the thermodynamic characteristics of low-temperature annealing anchoring and room-temperature hydrogen bond dissociation to reduce byproduct formation and simplify impurity separation. Verification by both denaturing PAGE electrophoresis band characteristics and high-resolution mass spectrometry molecular weight changes confirms that this clamp-mediated low-temperature chemical cyclization route can stably achieve in vitro RNA cyclization, demonstrating the feasibility of the preparation method.

[0066]

[0067] Where B is a pyrimidine or purine base.

[0068] The above embodiments are merely one of the preferred embodiments of the present invention and should not be used to limit the scope of protection of the present invention. Any modifications or refinements made to the main design concept and spirit of the present invention that are not of substantial significance, but solve the same technical problem as the present invention, should be included within the scope of protection of the present invention.

Claims

1. A method for preparing circular RNA, characterized in that, Includes the following steps: S1, Prepare the linear RNA to be circularized and the clip DNA; S2, Annealing: Mix the linear RNA to be circularized, the splice DNA, and the reaction buffer, and perform thermal shock annealing; S3, Low-temperature chemical cyclization: After annealing, the system temperature is controlled at 0-4℃, a cyclization catalyst is added, and after mixing, a chemical cyclization reaction is carried out. The two ends of the linear RNA are dehydrated to form covalently closed circular RNA, which is the circular RNA.

2. The method for preparing circular RNA according to claim 1, characterized in that, In step S1, the base length of the clip DNA is 10-16 bases, and the Tm value is 20-30℃; the molar ratio of clip DNA to linear RNA to be circularized is 1.5-3:

1.

3. The method for preparing circular RNA according to claim 2, characterized in that, In step S2, the thermal shock annealing process is as follows: maintain a constant temperature of 90~100℃ for 1.8~2 min, and then slowly cool down to 8~12℃ at a rate of 0.08~0.12℃ / min to achieve complementary pairing and binding between the splint and the linear RNA.

4. The method for preparing circular RNA according to claim 3, characterized in that, In step S2, the reaction buffer is a 2.5× buffer solution, consisting of 0.25M MES and 0.02M MgCl2, with a pH of 7.

5.

5. The method for preparing circular RNA according to claim 4, characterized in that, In step S3, the cyclization catalyst is a cyanogen bromide solution with a concentration of 4.5 M. The cyclization reaction is carried out in an ice bath at 0–4 °C for 2.5–4 minutes.

6. The application of the preparation method according to any one of claims 1 to 5 in the preparation of vaccines, protein substitute drugs, and circular RNA raw materials for antitumor use.

Images