A Gardenia enhancer GjE-1 and its application in plant genetic engineering

Abstract

This invention belongs to the field of plant genetic engineering technology, specifically relating to a gardenia enhancer GjE-1 and its application in plant genetic engineering. The sequence of the gardenia enhancer GjE-1 is any one of the following: the nucleotide sequence shown in SEQ ID NO.1; or a nucleotide sequence with more than 80% identity to SEQ ID NO.1. This invention is the first to successfully mine and identify an endogenous enhancer sequence GjE-1 with strong transcriptional enhancement activity from the medicinal plant gardenia. The gardenia enhancer GjE-1 provided by this invention can synergistically act with the existing 35S promoter and the mini35S promoter, greatly improving the transcription efficiency of the genes they drive. Dual-luciferase assay results show that GjE-1 can increase the transcription initiation ability of the strong 35S promoter by about 5-6 times; for the basal promoter mini35S, its enhancement effect is even more significant, reaching more than 40-50 times.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a gardenia enhancer GjE-1 and its application in plant genetic engineering. Background Technology

[0002] In plant genetic engineering research, exogenous strong promoters (such as the 35S promoter) are currently the most commonly used constitutive promoters, widely used to drive the expression of target genes in transgenic plants. However, the transcriptional activation capacity of the 35S promoter itself has an inherent bottleneck, and the expression level it drives often fails to meet the stringent requirements of ultra-high expression levels of target genes in certain applications, such as plant bioreactors, secondary metabolite synthetic biology, and high-value recombinant protein production. Although promoter engineering or tandem enhancer strategies can partially improve expression levels, existing methods mostly rely on viral sources or a few known enhancers from model plants, resulting in limited efficiency and severely restricting further optimization of plant genetic engineering expression systems. Therefore, there is an urgent need to provide a new strategy that can improve the expression level of existing promoters. Summary of the Invention

[0003] The purpose of this invention is to provide a gardenia enhancer GjE-1, which solves the problems existing in the prior art.

[0004] The technical solution adopted in this invention is: This invention provides a gardenia enhancer GjE-1, wherein the gardenia enhancer GjE-1 is any one of the following: 1) The nucleotide sequence shown in SEQ ID NO.1; 2) A nucleotide sequence that is more than 80% identical to SEQ ID NO.1.

[0005] A second aspect of the present invention provides a nucleic acid molecule comprising the aforementioned gardenia enhancer GjE-1; The nucleic acid molecule also includes at least one of a multiple cloning site, a selection marker, and an origin of replication.

[0006] A third aspect of the present invention provides a recombinant expression vector containing the gardenia enhancer GjE-1 or the nucleic acid molecule described above.

[0007] Preferably, the recombinant expression vector further contains a promoter; the promoter is a 35S promoter or a mini35S promoter.

[0008] Preferably, the nucleotide sequence of the 35S promoter is shown in SEQ ID NO.4; Preferably, the nucleotide sequence of the mini35S promoter is shown in SEQ ID NO.5.

[0009] Preferably, the starting vector of the recombinant expression vector includes any one of pCAMBIA, pBI121, pGreen, and pGD.

[0010] A fourth aspect of the present invention provides a host cell containing the aforementioned Gardenia enhancer GjE-1, the aforementioned nucleic acid molecule, or the aforementioned recombinant expression vector.

[0011] The fifth aspect of the present invention provides the application of the aforementioned Gardenia enhancer GjE-1, the aforementioned nucleic acid molecule, the aforementioned recombinant expression vector, and / or the aforementioned host cell in plant genetic engineering.

[0012] Preferably, the application in plant genetic engineering refers to improving the expression level of the target gene in plant cells or transgenic plants.

[0013] Preferably, the method for increasing the expression level of the target gene in plant cells is as follows: The gardenia enhancer GjE-1 was linked to the promoter to construct a recombinant expression vector, which was then transformed into plant cells to improve the expression level of the target gene in plant cells.

[0014] Compared with the prior art, the beneficial effects of the present invention are: This invention provides a gardenia enhancer GjE-1, wherein the sequence of the gardenia enhancer GjE-1 is any one of the following: 1) the nucleotide sequence shown in SEQ ID NO.1; 2) a nucleotide sequence having more than 80% identity with SEQ ID NO.1. This invention is the first to obtain a gardenia enhancer GjE-1 from the medicinal plant gardenia (Gardenia jasminoides). Gardenia jasminoides A potent endogenous enhancer sequence, GjE-1, with strong transcriptional enhancement activity was successfully discovered and identified in [the study]. The Gardenia enhancer GjE-1 provided by this invention can synergistically interact with existing promoters (such as the 35S and mini35S promoters) to significantly improve the transcription efficiency of the genes they drive. Dual-luciferase assays showed that GjE-1 can increase the transcription initiation capacity of the strong 35S promoter by approximately 5-6 times; for the basal mini35S promoter, the enhancement effect is even more significant, reaching 40-50 times or more. Given its powerful enhancement ability, GjE-1 can be widely applied in plant bioreactors, crop genetic improvement, and synthetic biology research on secondary metabolic pathways. By significantly increasing the expression levels of exogenous or endogenous target genes, it can increase the yield of target products (such as recombinant proteins and pharmaceutical active ingredients), thus possessing significant economic and social benefits. Attached Figure Description

[0015] Figure 1The candidate enhancer GjE-1 was identified for bioinformatics analysis. RNA-1 and RNA-2 represent two transcriptome datasets; ATAC-1, ATAC-2, and ATAC-Input represent ATAC-seq datasets. GjE-1 is a candidate enhancer.

[0016] Figure 2 Electrophoresis diagram of candidate enhancer amplification. Lane 1 and lane 2 are two replicates.

[0017] Figure 3 To verify the activity of the composite carrier in a dual-luciferase assay; A: Schematic diagram of different carriers; B: Results of dual-luciferase activity assays for mini35S-Luc and GjE-1-mini35S-Luc; Results of dual-luciferase activity assays for C:35S-Luc and GjE-1-35S-Luc. Detailed Implementation

[0018] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0019] The inventive concept of this invention is as follows: Enhancers are important cis-regulatory elements in eukaryotic genomes that can significantly improve gene transcription efficiency. Through synergistic action with promoters, transcription factors, and chromatin complexes, they can efficiently activate target genes regardless of distance or orientation, playing a core regulatory role in spatiotemporally specific gene expression, developmental regulation, and secondary metabolic pathway remodeling. With their unique advantages such as significantly increasing gene expression intensity, compatibility with heterologous expression systems, and preservation of original expression specificity, plant-derived enhancers have become key tools for optimizing expression efficiency and achieving precise regulation in genetic engineering.

[0020] Gardenia ( Gardenia jasminoides As a medicinal plant with extremely high medicinal and economic value, gardenia's genome-related research remains relatively scarce. Systematic mining and identification of regulatory sequences (especially endogenous enhancers) in the gardenia genome that can promote gene expression enhancement have not yet been carried out, and this remains a pressing issue, further limiting the development of gardenia genetic engineering. Therefore, given the current lack of research on the gardenia genome and the urgent need to discover regulatory sequences, this study aims to mine and identify endogenous enhancer sequences in gardenia. The combined use of enhancers and traditional promoters has promoted the progress of plant genetic engineering research.

[0021] In genetic engineering research and related applications, the 35S promoter (a strong promoter) is a commonly used promoter element that drives high expression of target genes and is widely used in various genetic engineering operations. However, the 35S promoter has certain limitations. To address the bottleneck of 35S promoter capacity, this invention provides an endogenous enhancer sequence from Gardenia jasminoides. This enhancer sequence can significantly improve the promoter activity of 35S or mini35S (increasing the transcription initiation capacity of 35S by approximately 5-6 times; and increasing the gene expression promotion capacity of mini35S by approximately 40-50 times or more). This invention improves the expression level of target genes and promotes the refinement and application of genetic engineering technology.

[0022] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below with reference to specific embodiments. In the description of the present invention, unless otherwise specified, all reagents used are commercially available, and all methods used are conventional techniques in the art.

[0023] Example 1 A gardenia enhancer GjE-1 and its application in plant genetic engineering are detailed below: 1. Experimental procedure: Discovery of gardenia enhancers.

[0024] 1.1. Discovery of Gardenia Enhancers

[0025] 1.1.1 Analysis of RNA sequencing (RNA-seq) data.

[0026] Trim_Galore (http: / / github.com / FelixKrueger / TrimGalore, default parameters) was used for quality control of the raw data. Hisat2 was used to align to the Gardenia genome. Samtools was used to sort, index, filter, and perform statistics on the data (-F 4 -q 30: filter out unaligned reads and low-quality alignments). Cuffnorm was used to calculate gene expression values ​​(FPKM). Pheatmap was used to calculate the reproducibility of the experimental and control groups.

[0027] 1.1.2 Analysis of transposase-accessibility chromatin sequencing (ATAC-seq) data.

[0028] ATAC-seq data, filtered by Trim_Galore, was mapped to the Gardenia genome using Bowtie2 with the parameter set to -X 1000. Samtools was used for sorting, indexing, filtering, and statistical analysis (-F 4 -q 30), followed by peak retrieval using MACS3 (parameters set to "--nomodel --shift 100 --extsize 200"). Gardenia genomic DNA treated with Tn5 enzyme was used as an input control. Chromatin regions with stable open signals in the two repeat sets, identified as ACRs, were determined using the IDR (Irreproducible Discovery Rate) pipeline. HOMER (http: / / homer.ucsd.edu / homer) was used to annotate the ACRs. Deeptools and IGV were used to visualize the ATAC-seq signals. Fimo was used for motif analysis. Based on the ACRs data analyzed by ATAC-seq, enhancers were identified by combining histone modification status and gene expression levels.

[0029] 1.1.3 Analysis of histone chromatin immunoprecipitation sequencing (ChIP-seq) data.

[0030] ChIP-seq data, filtered by Trim_Galore, was mapped to the Gardenia genome using Bowtie2 with the parameter set to -X 1000. Reads with MAPQ values ​​greater than 30 were extracted using Samtools and then further processed for peak retrieval using MACS3 (with parameters set to "--nomodel --shift 100 --extsize 200"). The ChIP-seq signals were visualized using Deeptools and IGV.

[0031] Based on the above bioinformatics mining process, this invention obtained a candidate enhancer GjE-1, see... Figure 1 .

[0032] 1.2 Cloning of Gardenia enhancers.

[0033] The enhancer GjE-1 is 660 bp in length and its sequence is shown in SEQ ID NO.1.

[0034] SEQ ID NO.1: 5'--3'.

[0035] Primers were designed based on the above sequences, and the primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0036] Primer F, SEQ ID NO.2: GTGAAATTAATGGATTTCGC.

[0037] Primer R, SEQ ID NO.3: GCATCATACCTCATTTGACTC.

[0038] (1) Extract DNA from fresh young leaves of gardenia according to the method of RaPure Plant DNA Kit (Magen).

[0039] (2) PCR amplification was performed using DNA from gardenia leaves as a template.

[0040] PCR reaction system (50 μL): 25 μL of 2× TransStart FastPfu Fly PCR Mix (TransGen), 2 μL each of primer F and primer R, 1 μL of template, and 20 μL of ddH2O.

[0041] PCR reaction program: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 20 s, 58℃ annealing for 20 s, 72℃ extension for 15 s, 35 cycles, 72℃ extension for 5 min.

[0042] (3) Add PolyA tail: Taq DNA Polymerase (5U / ul) (Vazyme) 0.2μL, 72℃, 10min.

[0043] (4) The target fragment of GjE-1 was recovered using a DNA gel recovery kit.

[0044] 1.3 Construction of vectors containing 35S promoters or mini35S promoters.

[0045] 1.3.1 Synthesize the 35S promoter and the mini35S promoter.

[0046] The sequences of the 35S promoter and the mini35S promoter were synthesized through gene synthesis, and XcmⅠ and BstBI restriction sites were introduced. The sequence of the 35S promoter is shown in SEQ ID NO.4, and the sequence of the mini35S promoter is shown in SEQ ID NO.5.

[0047] SEQ ID NO.4: 5'-TGAGACTTTTCAACAAAGGGTAATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTACTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATTCAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTTCATTTCATTTGGAGAGGACA-3'.

[0048] SEQ ID NO.5: 5'-GGTGATGATGATGATGATGGTGATGATGATGATGATGATGGTTCTGACGGTTCACTAAACGAATTGATGAGCCCCTTTCGTCTTCAA-3'.

[0049] 1.3.2 Construction of expression vectors containing 35S promoters or mini35S promoters.

[0050] The expression vector used in this invention is the pGreenII 800-Luc vector (Novopro, V010545, https: / / www.novopro.cn / vector / Vgiydgni).

[0051] The 35S promoter, mini35S promoter, or expression vector were digested with enzymes at 37°C for 3 hours. The enzyme digestion reaction system is shown in Table 2.

[0052] Table 2 Enzyme digestion reaction system Three DNA fragments were recovered using a DNA gel recovery kit (Focus on Life Sciences, catalog number DR511-250T) following the instructions.

[0053] The ligation system was prepared using the T4 enzyme: 0.5 μL T4 ligase, 1 μL T4 Buffer, 1 μL linearized expression vector, 1 μL target fragment (35S promoter or mini35S promoter), and ddH2O to bring the total to 10 μL.

[0054] The ligation product was transformed into E. coli, screened with kanamycin, and positive clones were selected and sequenced to obtain vectors containing the 35S promoter or mini35S promoter, which were denoted as 35S-Luc and mini35S-Luc, respectively.

[0055] 1.4 Construction of GjE-1 recombinant expression vector.

[0056] Enzyme digestion: 35S-Luc and mini35S-Luc were digested separately at 37°C for 3 hours. The two fragments were recovered using a DNA gel recovery kit. The digestion system is shown in Table 3.

[0057] Table 3. Enzyme digestion systems of 35S-Luc and mini35S-Luc Linearized 35S-Luc or mini35S-Luc were respectively connected to GjE-1, and the connection reaction was carried out in the following system: Add 0.5 μL of T4 ligase, 1 μL of T4 buffer, 50 ng of linearized vector (linearized 35S-Luc or mini35S-Luc), 40 ng of the target fragment GjE-1, and bring the total volume to 10 μL with ddH2O; then ligate overnight at 16°C.

[0058] The ligation products were transformed into E. coli, screened with kanamycin, and positive clones were selected for sequencing verification. The recombinant expression vectors with correct sequencing results were named GjE-1-35S-Luc and GjE-1-mini35S-luc.

[0059] 1.5 Verification of the effect of GjE-1.

[0060] GjE-1-35S-Luc, GjE-1-mini35S-Luc, 35S-Luc, and mini35S-Luc were transformed into Agrobacterium and cultured overnight. The bacterial cells were collected by centrifugation and resuspended in a permeation buffer (MES, pH 5.6, 10 mM; MgCl2, 10 mM; AS, 100 μM). One mL of the bacterial resuspension was injected onto the surface of tobacco leaves using a syringe and cultured for 4 days. The luciferase activity in the tobacco leaves was detected using the TransDetectDouble-Luciferase Reporter Assay Kit (TransGen).

[0061] 2. Results.

[0062] This invention, based on bioinformatics technology, successfully mined and identified a candidate enhancer element from the gardenia genome, named GjE-1. Figure 2 As shown, PCR amplification of GjE-1 using specific primers yielded a clear target band on agarose gel electrophoresis, indicating successful cloning of the enhancer sequence. Further functional studies revealed that GjE-1 exhibits significant synergistic effects with the commonly used strong constitutive promoter 35S and the basal promoter mini35S, greatly enhancing their efficiency in driving downstream gene transcription. Quantitative results from the dual-luciferase reporter gene assay are shown below. Figure 3The results showed that GjE-1 could increase transcription initiation activity by approximately 5-6 times in the presence of the 35S promoter; and for the basal promoter mini35S, which has a lower activity background, the enhancement effect of GjE-1 was particularly prominent, increasing transcription efficiency by more than 40-50 times. This result indicates that GjE-1, as a novel plant enhancer, not only has a significant enhancing effect on strong promoters but also achieves orders-of-magnitude activation on weak promoters, demonstrating significant application potential in plant genetic engineering and synthetic biology.

[0063] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0064] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A gardenia enhancer GjE-1, characterized in that, The gardenia enhancer GjE-1 is any one of the following: 1) The nucleotide sequence shown in SEQ ID NO.1; 2) A nucleotide sequence that is more than 80% identical to SEQ ID NO.

1.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule includes the gardenia enhancer GjE-1 as described in claim 1; The nucleic acid molecule also includes at least one of a multiple cloning site, a selection marker, and an origin of replication.

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the gardenia enhancer GjE-1 as described in claim 1 or the nucleic acid molecule as described in claim 2.

4. The recombinant expression vector as described in claim 3, characterized in that, The recombinant expression vector also contains a promoter; The promoter is a 35S promoter or a mini35S promoter.

5. The recombinant expression vector as described in claim 4, characterized in that, The nucleotide sequence of the 35S promoter is shown in SEQ ID NO. 4; The nucleotide sequence of the mini35S promoter is shown in SEQ ID NO.

5.

6. The recombinant expression vector as described in claim 2, characterized in that, The starting vector of the recombinant expression vector includes any one of pCAMBIA, pBI121, pGreen, and pGD.

7. A host cell, characterized in that, The host cell contains the gardenia enhancer GjE-1 as described in claim 1, the nucleic acid molecule as described in claim 2, or the recombinant expression vector as described in claim 4.

8. The application of the Gardenia enhancer GjE-1 of claim 1, the nucleic acid molecule of claim 2, the recombinant expression vector of claim 4, and / or the host cell of claim 7 in plant genetic engineering.

9. The application as described in claim 8, characterized in that, In plant genetic engineering, the application refers to improving the expression level of target genes in plant cells or transgenic plants.

10. The application as described in claim 9, characterized in that, The following methods can be used to increase the expression level of target genes in plant cells: The gardenia enhancer GjE-1 was linked to the promoter to construct a recombinant expression vector, which was then transformed into plant cells to improve the expression level of the target gene in plant cells.

Images