Targeted knockout of chitinase gene Chi sgRNA, chitinase gene Chi deletion cell lines, their construction methods and applications

Abstract

This invention discloses sgRNA targeting the chitinase gene Chi, a chitinase gene Chi-deficient cell line, its construction method, and its applications, relating to the field of genetic engineering technology. The nucleotide sequence of the sgRNA includes: ACAGACTCTTGGAATGACGT; ATCTGAACTGAGATGCACCG. The construction method includes: obtaining the chitinase gene from Aspergillus niger. Who The gene sequence was obtained; then the sgRNA was designed; and a specific targeting fusion was constructed. Who CRISPR / Cas9 editing expression vectors for gene loci; obtaining Who Gene knockout Aspergillus niger strain. Beneficial effect: chitinase gene. Who When cell lines without carbon are used in fermentation, carbon source consumption is reduced, mycelial morphological integrity is improved, and mycelial breakage is reduced.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more particularly to the targeted knockout of chitinase genes. Chi sgRNA and chitinase gene Chi deletion cell lines, their construction methods and applications. Background Technology

[0002] Producing mycelial protein from industrial byproducts of Aspergillus niger fermentation not only efficiently converts inexpensive substrates into high-quality protein but also significantly reduces environmental pollution. This protein is high in content, has a balanced amino acid composition, and is rich in enzymes and prebiotics, contributing to animal gut health and nutrient absorption. Therefore, developing this type of microbial protein is of great significance for ensuring feed safety, promoting sustainable agricultural development, and achieving the goal of "feed reduction and substitution."

[0003] However, in existing Aspergillus niger fermentation techniques, excessive glucose consumption leads to low fermentation efficiency and severe hyphal breakage. In the liquid submerged fermentation of filamentous fungi, chitinase participates in the degradation and remodeling of cell wall chitin; its excessive activity exacerbates hyphal wall autolysis and breakage. After hyphal breakage, the fungal cells need to resynthesize cell wall chitin and other components to repair the wall structure, a process that consumes a large amount of additional carbon source (glucose), thus reducing the conversion efficiency of carbon source to the fungal cells. Therefore, reducing the chitinase activity of Aspergillus niger holds promise for simultaneously reducing hyphal breakage and carbon source consumption. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a method for targeted knockout of chitinase genes. Chi The study investigated the construction and application of sgRNA and chitinase gene Chi deletion cell lines, their methods, and applications, aiming to reduce carbon source consumption, improve hyphal morphological integrity, and reduce hyphal breakage.

[0005] In order to achieve the objective of this invention, the following solution is proposed: Firstly, it provides a method for targeting and knocking out chitinase genes. Chi The sgRNAs include a first sgRNA and a second sgRNA, whose nucleotide sequences are as follows: N20-1: ACAGACTCTTGGAATGACGT (SEQ ID NO.1); N20-2: ATCTGAACTGAGATGCACCG (SEQ ID NO. 2).

[0006] Secondly, this invention provides an application of the aforementioned sgRNA for targeted knockout of chitinase genes. Chi .

[0007] Thirdly, a chitinase gene is provided. ChiThe method for constructing deletion cell lines includes the following steps: 1) Obtain the chitinase gene from Aspergillus niger. Chi The gene sequence is shown in SEQ ID NO.3; then the N20 sequence for Cas9 editing was designed; according to Chi Download the corresponding gene sequence from the NCBI accession number (XP_001399836.1); use the chopchop online website (https: / / chopchop.cbu.uib.no / ) to design two N20 sequences for constructing the Cas9 expression vector, with a knockout fragment length of approximately 1233 bp between the two N20 sequences.

[0008] 2) Constructing specific targeted fusion Chi CRISPR / Cas9 editing expression vector for gene loci pFC332-Cas9-sgChi-1-sgChi-2; The sequences of endogenous 5SrRNA-1 and 5SrRNA-2 were amplified from the DNA genome of Aspergillus niger strains using primer pairs 5S-1 / 5S-2 and 5S-3 / 5S-4, respectively; sgRNA was amplified from artificially synthesized gRNA scaffold fragments using primer pairs sg-1 / sg-2 and sg-3 / sg-4, respectively. Chi-1 and sgRNA Chi-2 The sequence was then obtained. Two rounds of amplification were subsequently performed using fusion PCR, amplifying 5S rRNA-1 and sgRNA respectively. Chi-1 Fragments, 5SrRNA-2 and sgRNA Chi-2 Fragment fusion yields 5SrRNA-sgRNA Chi-1 and 5SrRNA-sgRNA Chi-2 The fused fragment was then ligated to the backbone vector pFC332-Cas9 using homologous recombinase to obtain a target specific to... Chi The dual-target editing vector pFC332-Cas9-sgChi-1-sgChi-2, with the gene targeting a specific site, was used for gene editing. Single colonies were selected after transformation of *E. coli* with DH5α, and positive transformants were obtained by PCR verification using the Chiyz-1 / Chiyz-2 primer pair.

[0009] 3) Obtain Chi Gene knockout Aspergillus niger strains Plasmids were extracted from the above-mentioned positive E. coli, and the plasmids targeting the above-mentioned E. coli were transformed using protoplast transformation. Chi A dual-target CRISPR / Cas9 expression vector targeting specific gene loci was introduced into Aspergillus niger strains to obtain candidate gene loci. ChiGene editing transformants. Simple DNA templates for candidate transformants were prepared using a lysis method, and the target gene sequence was amplified from the templates using primer pair Chiyz-3 / 4. Positive transformants were then identified by electrophoresis and sequencing. Chi Gene-edited mutants.

[0010] 4) Chi Fermentation evaluation of gene knockout Aspergillus niger strains wild-type strains and Chi Gene-knockout Aspergillus niger strains were inoculated into potato dextrose (PDB) medium and cultured at 34°C and 200 rpm for 48 h to obtain seed culture. The seed culture was then inoculated into two 30 L fermenters (containing 15 L of fermentation medium) for fermentation. After inoculation, the culture temperature was 34°C, pH 4.5, rotation speed was 500 rpm, and aeration rate was 15 L / min, which lasted for about 18 h. After the pH and dissolved oxygen recovered, 50% glucose solution was added at a flow rate of 8 mL / L / h. The air volume and rotation speed were adjusted to control dissolved oxygen at 20%-40%. The feeding time was about 130 h. After fermentation, the cell dry weight (DCW) and sugar content of the cell were collected and the glucose yield coefficient of the cell was calculated (Yx / s = cell dry weight / glucose consumption).

[0011] Fourthly, providing a Chi The application of gene knockout Aspergillus niger strains during fermentation is to reduce carbon source, improve mycelial morphological integrity, and reduce mycelial breakage.

[0012] The beneficial effect of this invention is that a chitinase gene was identified in Aspergillus niger. Chi Knockout gene Chi The ANchi strain obtained later showed a significant reduction in glucose consumption during fermentation compared to the wild-type strain, decreasing from 7.59 kg to 2.81 kg, while the cell dry weight (biomass) remained comparable to the wild-type. The glucose yield coefficient was significantly improved, approximately 2.8 times higher, greatly enhancing the conversion rate of carbon source to the cell and saving on fermentation raw material costs. Furthermore, the mycelium of the ANchi strain remained intact. The mechanism lies in the knockout of the chitinase gene. Chi Subsequently, the degradation and autolysis of chitin in the cell wall are weakened, hyphal breakage is reduced, and the cells do not need to consume a large amount of carbon source to repair the cell wall, thereby reducing glucose consumption and improving carbon source utilization efficiency. Attached Figure Description

[0013] Picture 1 To target the chitinase gene of Aspergillus niger chi Diagram of the construction of a dual-target CRISPR / Cas9 expression vector for gene editing; where A represents the target gene editing vector. chiA schematic diagram of a dual-target editing Cas9 and sgRNA expression vector (pFC332-Cas9-sgChi-1-sgChi-2) targeting a specific gene; B shows the 5S rRNA-sgRNA in the expression vector pFC332-Cas9-sgChi-1-sgChi-2. chi-2 -5SrRNA-sgRNA chi-1 Electrophoresis image of PCR amplification verification of the fragment; C represents 5S rRNA-sgRNA in the expression vector pFC332-Cas9-sgChi-1-sgChi-2. chi-2 -5SrRNA-sgRNA chi-1 The sequencing alignment results of the fragments are shown in the figure.

[0014] Picture 2 Chitinase gene of Aspergillus niger chi Screening diagram of gene knockout transformant ANchi; where A is the PCR amplification verification electrophoresis diagram of the fragment between the two N20 sequences of Aspergillus niger; B is the sequencing alignment result of the fragment between the two N20 sequences of Aspergillus niger.

[0015] Picture 3 Microscopic comparison images of the bacterial cells after 180 hours of fermentation; WT is the wild-type Aspergillus niger strain, and ANchi is the knockout strain. Chi Genetically modified Aspergillus niger strain. Detailed Implementation

[0016] Example 1 Obtaining the chitinase gene from Aspergillus niger Chi The gene sequence was determined and the N20 sequence was designed for Cas9 editing, as follows: (1) Experimental methods Based on the chitinase gene of Aspergillus niger Chi Download the corresponding gene sequence from the NCBI accession number (XP_001399836.1), as shown in SEQ ID NO.3; design two N20 sequences for Cas9 editing using the chopchop online website (https: / / chopchop.cbu.uib.no / ), with a knockout fragment length of approximately 1233bp between the two N20 sequences.

[0017] (2) Results chitinase gene of Aspergillus niger Chi After the gene sequence was submitted to the chopchop online website, two N20 sequences, N20-1 and N20-2, were obtained through screening based on indicators such as cutting efficiency, and were used for the subsequent construction of gene editing vectors.

[0018] N20-1: ACAGACTCTTGGAATGACGT (SEQ ID NO.1); N20-2: ATCTGAACTGAGATGCACCG (SEQ ID NO. 2).

[0019] Example 2 Constructing specific targeted fusion Chi The CRISPR / Cas9 editing expression vector pFC332-Cas9-sgChi-1-sgChi-2 for the gene locus is as follows: (1) Primers Table 1 Primer sequence listing (2) Fragment amplification procedure 5S rRNA promoter nucleotide sequence: CACATACGACCACAGGGTGTGGAAAACAGGGCTTCCCGTCCGCTCAGCCGTACTTAAGCCACACGCCGGGAGGTTAGTAGTTGGGTGGGTGACCACCAGCGAATCCCTTCTGTTGTATG.

[0020] gRNA scaffold nucleotide sequence: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.

[0021] 5SrRNA-sgRNA chi-1 Nucleotide sequence: CACATACGACCACAGGGTGTGGAAAACAGGGCTTCCCGTCCGCTCAGCCGTACTTAAGCCACACGCCGGGAGGTTAGTAGTTGGGTGGGTGACCACCAGCGAATCCCTTCTGTTGTATGACAGACTCTTGGAATGACGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.

[0022] 5SrRNA-sgRNA chi-2 Nucleotide sequence: CACATACGACCACAGGGTGTGGAAAACAGGGCTTCCCGTCCGCTCAGCCGTACTTAAGCCACACGCCGGGAGGTTAGTAGTTGGGTGGGTGACCACCAGCGAATCCCTTCTGTTGTATGATCTGAACTGAGATGCACCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.

[0023] Table 2 Fragment Amplification Program Record Table (3) Experimental methods The sequences of endogenous 5SrRNA-1 and 5SrRNA-2 were amplified from the DNA genome of Aspergillus niger strains using primer pairs 5S-1 / 5S-2 and 5S-3 / 5S-4, respectively; sgRNA was amplified from artificially synthesized gRNA scaffold fragments using primer pairs sg-1 / sg-2 and sg-3 / sg-4, respectively. Chi-1 and sgRNA Chi-2 The sequence was then obtained. Two rounds of amplification were subsequently performed using fusion PCR, amplifying 5S rRNA-1 and sgRNA respectively. Chi-1 Fragments, 5SrRNA-2 and sgRNA Chi-2 Fragment fusion yields 5SrRNA-sgRNA Chi-1 and 5SrRNA-sgRNA Chi-2 The fused fragment was then ligated to the backbone vector pFC332-Cas9 using homologous recombinase to obtain a target specific to... Chi The dual-target editing vector pFC332-Cas9-sgChi-1-sgChi-2, with the gene targeting a specific site, was used for gene editing. After transformation of *E. coli* with DH5α, single colonies were selected for culture, and PCR verification was performed using the Chiyz-1 / Chiyz-2 primer pair, yielding positive transformants.

[0024] (4) Results like Picture 1 As shown, the amplification verification and sequencing comparison results indicate that a chitinase gene targeting Aspergillus niger has been successfully constructed. Chi Dual-target editing of Cas9 and sgRNA expression vectors for specific targets: pFC332-Cas9-sgChi-1-sgChi-2.

[0025] Example 3 The chitinase gene knockout and verification in Aspergillus niger are detailed below: First, let me clarify how Aspergillus niger is obtained: Aspergillus niger is a common industrial fermentation bacteria. It can be obtained, for example, through the China Industrial Microbial Culture Collection Center (CICC), with numbers such as CICC 2377, CICC 2089, and CICC 40165. Another example is... Purchased from the China General Microbiological Culture Collection Center (CGMCC). This example uses CICC2377.

[0026] (1) Experimental materials PDAS solid culture medium: 39g PDA powder (purchased from BD), 219g sorbitol, bring the volume to 1L; Buffer for dissolving enzyme: 0.7M sodium chloride; STC: 0.8M sorbitol; 50mM CaCl2, 50mM Tris-HCl (pH 8.0); SPTC: STC containing 40% PEG6000; Regeneration medium: 1g yeast extract, 1g tryptone, 274g sucrose, 10g agarose, adjusted to 1L; Screening medium: PDAS solid medium supplemented with 20 μg / mL hygromycin; Mycelial lysis buffer: Dissolve 1.2g NaOH in deionized water and bring the volume to 100mL; Mycelial neutralization solution: 10 mL 1M Tris-HCl (pH 8.0), 40 mL 0.3M HCl, and dilute to 800 mL with deionized water.

[0027] (2) Primers Chiyz-3:GCCACGAGGTTGCAGGATTA; Chiyz-4: TGTCGTAGGAGACCATGGTG.

[0028] (3) Amplification and verification system Amplification validation: 95℃ for 15s, 60℃ for 15s, 72℃ for 42s; 35 cycles of 2×Rapid Taq Master Mix, Vazyme.

[0029] (4) Experimental methods The Aspergillus niger strain was inoculated onto PDAS solid medium and cultured at 30°C for about 7 days. Protoplasts were prepared using enzyme lysis buffer (20 mg of lysis enzyme + 40 mg of snail enzyme dissolved in 10 ml of 0.7 M sodium chloride and filtered for sterilization), and lysed at 32 °C and 130 rpm for 4 h. After filtration through three layers of lens paper, centrifuge at 4°C, 6500 rpm, and 15 min. Wash twice with STC, centrifuge as described above, resuspend the protoplasts with STC, and place on ice for later use. Take 100 μl of the above protoplast suspension, add 25 μl of SPTC, mix gently, add 10 μg of gene editing expression vector, mix gently, and place on ice for 50 min. Add 1 ml of SPTC and mix gently. Let stand at room temperature for 30 minutes. Add the mixture to the regeneration medium at about 40°C, shake well, pour into a plate, and incubate at 30°C overnight (about 12 hours). Pour on the selection medium and incubate at 30°C until colonies grow. Positive transformants were selected and inoculated into PDAS solid medium. A simple template was prepared using mycelial lysis buffer and neutralization solution (a small amount of mycelium was placed in 8 μl of mycelial lysis buffer and treated at 98°C for 3 min, followed by the addition of 170 μl of mycelial neutralization solution to obtain the simple template). The template was then constructed using primers (primer Chiyz-3 is located in sgRN). Achi-2 Upstream, primer Chiyz-4 is located on the sgRNA chi-1 Downstream amplification and verification.

[0030] (5) Results like Picture 2 As shown, the amplification verification and sequencing alignment results indicate a base deletion between the two N20 pairs, proving that... chi The enzyme gene was successfully knocked out, and the resulting transformant was named ANchi.

[0031] Example 4 Chi The fermentation evaluation of the gene-knockout Aspergillus niger strain is as follows: (1) Seed liquid preparation wild-type strains and Chi Gene knockout Aspergillus niger strains were inoculated into potato dextrose liquid (PDB) medium and cultured at 34°C and 200 rpm for 48 h to obtain seed liquid; (2) Preparation of fermentation medium The above seed culture was inoculated into two 30L fermenters (containing 15L of fermentation medium) for fermentation culture. Each strain was set up with three independent biological replicates. The fermentation medium included: glucose 30g / L, soybean meal 30g / L, corn steep liquor 30g / L, ammonium sulfate 10g / L, potassium dihydrogen phosphate 10g / L, magnesium sulfate 0.1g / L, calcium chloride 0.1g / L, and defoamer 1g / L (sterilized at 121℃-123℃ for 30min).

[0032] (3) Fermentation process control After inoculation, the culture temperature was 34℃, pH 4.5, rotation speed 500 rpm, and aeration rate 15 L / min, lasting for approximately 18 hours. After the pH and dissolved oxygen recovered, a 50% glucose solution was added at a flow rate of 8 mL / L / h. To control dissolved oxygen at 20%-40%, the airflow and rotation speed were adjusted. The feeding time was approximately 130 hours. After fermentation, the cell bodies and fermentation broth were collected for cell dry weight (DCW, cell bodies dried at 105℃ to constant weight and then weighed) and sugar content determination. The yield coefficient of glucose from the cell body, Yx / s, was calculated. At the same time, ≥100 hyphae were randomly counted to determine the breakage rate, and the crude protein content of the cell body was determined (Kjeldahl method).

[0033] The evaluation results of wild-type (WT) and ANchi strains fermented in a 30L fermenter for 180 h (n=3) are shown in Table 3. As shown in Table 3, there was no significant difference in cell dry weight between the two strains (P>0.05), but the glucose consumption of the ANchi strain was significantly lower than that of the wild-type (P<0.01). Based on this, the yield coefficient Yx / s was significantly increased by about 2.8 times, that is, the conversion rate of carbon source to cell was significantly improved, which can save fermentation raw material costs; microscopic observation of the cell ( Picture 3 The results showed that the wild-type strain exhibited severe hyphal breakage (breakage rate of approximately 62%), while the knockout strain... Chi The hyphae of the ANchi strain after gene knockout remained intact (fracture rate of approximately 11%); the crude protein content of the cells of the two strains was comparable and did not decrease due to knockout.

[0034] Table 3. Evaluation results of 30L fermentation of wild-type and ANchi strains (n=3) The above embodiments are only used to illustrate the technical ideas and features of the present invention, and are not intended to be unique or to limit the present invention. Those skilled in the art should understand that various changes or equivalent substitutions made to the present invention without departing from its scope are all within the scope of protection of the present invention.

Claims

1. A method for targeting and knocking out chitinase genes Chi The sgRNA is characterized by, It includes the first sgRNA and the second sgRNA, whose nucleotide sequences are as follows: SEQ ID NO.1: ACAGACTCTTGGAATGACGT; SEQ ID NO. 2: ATCTGAACTGAGATGCACCG.

2. The sgRNA of claim 1 in targeting and knocking out the chitinase gene Chi Applications in [the context of the text].

3. A chitinase gene Chi A method for constructing a cell line with deletions, characterized in that, Includes the following steps: Based on chitinase gene Chi Based on the gene sequence, design the sgRNA of claim 1; The designed sgRNA and Cas9 nuclease expression elements were constructed into the expression vector; The obtained expression vector was introduced into Aspergillus niger for gene editing, and the chitinase gene was obtained through screening. Chi Missing Aspergillus niger cell lines.

4. The construction method according to claim 3, characterized in that, Chitinase gene Chi The gene sequence is shown in SEQ ID NO.3, and the expression vector is pFC332-Cas9-sgChi-1-sgChi-2.

5. The application of the Aspergillus niger cell line according to claim 3 in reducing carbon source consumption during microbial fermentation and / or improving mycelial morphological integrity.

Images