An aptamer specifically for recognizing influenza A virus, its preparation method and application

Abstract

This invention relates to an aptamer for specifically recognizing influenza A virus, its preparation method, and its application. The aptamer is a nucleic acid aptamer whose nucleotide sequence contains at least one of the sequences shown in SEQ ID NO:1 to SEQ ID NO:6; or a complementary sequence that specifically hybridizes with any of its sequences; or a functionally equivalent sequence that has at least 80% sequence identity with any of the above sequences and retains the binding activity of the aptamer; or a chemically modified derivative of any of the above sequences. The aptamer of this invention has high sensitivity, low cost, is easy to prepare, modify, and label, and can be used to construct various detection methods. It has good affinity and specificity, and can conveniently and sensitively detect influenza A virus H1N1 and H3N2 present in environmental and patient respiratory specimens. It has advantages such as in vitro screening, convenient synthesis, easy labeling with various functional groups and reporter molecules, and stable properties that allow for long-term storage and use.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an aptamer that specifically recognizes influenza A virus, its preparation method, and its application. Background Technology

[0002] Influenza virus belongs to the Orthomyxoviridae family and is classified into four types: A, B, C, and D. Influenza viruses are enveloped viruses with 6-8 segments of single-stranded negative-sense RNA as their genetic material. They can infect humans, poultry, livestock, and other animals. Transmission primarily occurs through droplets (including aerosols), but infection can also occur through contact with virus-contaminated objects and surfaces. Autumn and winter are the peak seasons for infection. The main symptoms of influenza are fever, runny nose, nasal congestion, cough, sore throat, headache, fatigue, and muscle pain. Patients infected with influenza usually recover within a few days or 1 to 2 weeks. However, some people with weakened immune systems, such as those over 65 years of age and infants under 5 years of age, as well as those with impaired immune systems or chronic diseases, may develop severe illness leading to hospitalization or even death. Approximately one billion cases of seasonal influenza occur annually. Influenza A and influenza B viruses are the main circulating viruses in the population, with influenza A being the primary pathogen causing seasonal influenza.

[0003] The surface of the influenza A virus envelope mainly contains two types of viral glycoproteins: hemagglutinin (HA) and neuraminidase (NA). Hemagglutinin is approximately 5-10 times more abundant than NA. It binds to sialic acid glycosides on the cell surface, allowing the influenza A virus to adhere to the cell and enter via endocytosis, which is the first step in viral infection. Due to the high antigenic variability of the influenza A virus surface glycoproteins, influenza A viruses can be classified into 18 HA and 11 NA subtypes. H1N1 and H3N2 are two relatively common circulating subtypes and can cause pandemics in populations. Influenza A pandemics have caused enormous losses to human society.

[0004] Common methods for detecting influenza virus include hemagglutination tests, antigen detection, and Real-time RT-PCR. Because the hemagglutination property of the influenza virus surface can cause agglutination of certain red blood cells (such as guinea pig red blood cells), hemagglutination tests involve mixing red blood cells and the virus in an appropriate ratio and observing the agglutination phenomenon. However, hemagglutination is easily affected by various factors and is unstable. Influenza virus antigen detection uses colloidal gold labeling and immunochromatography to detect the influenza virus nucleoprotein in the lysed sample and directly display the results as a visual signal. This method is simple and easy to operate; patients can complete the test at home by purchasing an antigen test kit and can obtain results quickly, but the false negative rate is relatively high. Real-time RT-PCR uses influenza virus detection primers and fluorescently labeled probes to identify and quantify the influenza virus. This detection method is currently the most accurate among commonly used influenza virus detection methods, but its disadvantages include high cost, susceptibility to experimental operation and environmental influences, and high requirements for testing equipment and operators.

[0005] Aptamers are oligonucleotide sequences that specifically recognize and bind to targets, obtained through in vitro screening of artificially synthesized random nucleotide sequence libraries using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology. They can participate in disease diagnosis and treatment. Aptamers offer advantages such as short screening cycles, small size and flexible structure, high affinity, and good specificity. Compared to antibodies, aptamers also have significant advantages such as high stability, ease of storage, ease of chemical modification, low cost, and low immunogenicity. These advantages make aptamers highly valuable in disease diagnosis, treatment, drug delivery, and food safety. Currently, aptamers are widely used as recognition elements in various biosensors. Summary of the Invention

[0006] The purpose of this invention is to address the shortcomings of existing technologies by providing an aptamer for specifically recognizing influenza A virus, its preparation method, and its application.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of the present invention relates to an aptamer that specifically recognizes influenza A virus, said aptamer being a nucleic acid aptamer whose nucleotide sequence comprises at least one of the sequences shown in SEQ ID NO: 1 to SEQ ID NO: 6, or a complementary sequence that specifically hybridizes with any of the sequences, or a functionally equivalent sequence that has at least 80% sequence identity with any of the above sequences and retains the binding activity of said aptamer; or a chemically modified derivative of any of the above sequences.

[0008] Furthermore, the nucleotide sequence of the nucleic acid aptamer includes at least one of the sequences shown in SEQ ID NO: 1 to SEQ ID NO: 6, or a functionally equivalent sequence that has at least 90% sequence identity with any of the above sequences and retains the binding activity of the aptamer.

[0009] Furthermore, the sequences SEQ ID NO: 1 to SEQ ID NO: 6 are specifically as follows: SEQ ID NO: 1:TTTTCGGGGGACTGCTCGGGATTGCGGATACGAT; SEQ ID NO: 2: CACCCCATCTGTCCCGTCCCCCTGCTGTGTCCCTC; SEQ ID NO: 3: CCGGACGACCCAGAAATGTGGGAGCTGCTGTTTGAA; SEQ ID NO: 4: CTTTCGGGGGACTGCTCGGGATTGCGGATACGAT; SEQ ID NO: 5: ATGTACCAAGGACTGCTTAGGATTGCGATGTAGTAT; SEQ ID NO: 6: CACACCACCGTACTCCCACCTTTGCTGCGTCCCCCA.

[0010] The names of the above sequences and their secondary structure predictions are shown in Table 1 below.

[0011] Table 1: Aptamer nucleotide sequences specifically recognizing influenza A viruses A / California / 07 / 2009 and A / Darwin / 09 / 2021: Furthermore, the aptamer is a single-stranded DNA and has a stem-loop structure or a hairpin structure.

[0012] Furthermore, the aptamer recognizes or specifically binds to the hemagglutinin of influenza A virus.

[0013] Furthermore, the influenza A virus is of the H1N1 and / or H3N2 subtypes.

[0014] Furthermore, the chemical modification includes linking markers to provide a detection signal and linking functional groups to form a composition with other molecules; The labels include fluorescent groups, isotopes, electrochemical labels, enzyme labels, and nanoluminescent materials; The functional groups include affinity ligands, thiol groups, and amino groups.

[0015] Further, the fluorescent group is a FAM fluorescent group or a Cy5 fluorescent group; the isotope is... 33 P; the electrochemical label is methylene blue; the nanoluminescent material is quantum dots or upconversion nanoparticles; the enzyme label is horseradish peroxidase or sucrase; the biotin is biotin.

[0016] Furthermore, the chemical modification includes phosphorylation, methylation, aminoation, thiolation, or isotopization at a certain position on the nucleotide sequence of the aptamer.

[0017] Furthermore, the aptamer also includes sequences that can hybridize with the aforementioned nucleic acid aptamer sequences, sequences that are reverse transcribed from the aforementioned nucleic acid aptamer sequences, and so on.

[0018] A second aspect of the present invention relates to a method for preparing an aptamer that specifically recognizes influenza A virus, the aptamer being as described in any of the first aspects of the present invention, comprising the following steps: (1) Biotin labeling using influenza A viruses H1N1 and H3N2 as target proteins: (2) Obtain the library that binds to the magnetic beads, conjugate the target protein to the magnetic beads, wash and remove non-specific bindings to obtain the magnetic beads and aptamers that are specifically conjugated to the target protein. (3) Dissociate the magnetic bead from its adapter; (4) Desalting the aptamer sample yields the aptamer that specifically recognizes influenza A virus.

[0019] Furthermore, in step (1), the hemagglutinin protein of influenza A virus H1N1 and H3N2 is used as the target protein.

[0020] Furthermore, in step (2), reverse screening and forward screening are used to remove non-specific bindings, and the reverse screening uses influenza B virus hemagglutinin protein as the reverse screening protein.

[0021] Furthermore, in step (2), SELEX technology or magnetic microfluidic chip technology is used for screening.

[0022] Furthermore, in step (4), the aptamer is obtained by PCR amplification and single-strand separation.

[0023] Preferably, the method for preparing the above-mentioned nucleic acid aptamers includes the following steps: (1) Using the hemagglutinin HA of influenza A virus A / California / 07 / 2009 or A / Darwin / 09 / 2021 as the target protein, biotin labeling was performed on HA using Thermo Scientific™ EZ-Link™ NHS-PEG4-Biotin: First, 170 μL of ultrapure water was added to 2 mg of NHS-PEG4-Biotin, and then an appropriate amount of NHS-PEG4-Biotin solution was added to the target protein and incubated on ice for 2 h; (2) Obtain a random oligonucleotide library that binds to magnetic beads, conjugate the target protein to the magnetic beads, wash to remove non-specifically bound sequences, and obtain a magnetic bead-aptamer complex that is specifically conjugated to the target protein. (3) Dissociate the specifically bound aptamer from the magnetic bead; (4) Desalt, PCR amplify and single-strand separation are performed on the dissociated aptamer samples to obtain enriched secondary libraries, and the screening steps are repeated until high-affinity specific aptamers are obtained.

[0024] A third aspect of the present invention relates to a kit for detecting influenza A virus, said kit containing an aptamer that specifically recognizes influenza A virus as described in any of the first aspects of the present invention, or an aptamer prepared by the preparation method described in the second aspect of the present invention.

[0025] Furthermore, the kit also includes a positive control or a negative control.

[0026] Furthermore, the positive control is a monomer and / or trimer of hemagglutinin from influenza A virus A / California / 07 / 2009 or A / Darwin / 09 / 2021.

[0027] Furthermore, the kit typically also includes necessary buffer solutions, deionized water, amplification reagents, and small consumables.

[0028] A fourth aspect of the invention is the use of an aptamer as described in any of the first aspects of the invention, the use being selected from at least one of the following uses: use in the preparation of a medicament for alleviating influenza A virus infection, use in the preparation of an influenza A virus detection reagent, and use in the screening of medicaments for treating influenza A virus infection.

[0029] The present invention adopts the above technical solution and has the following technical effects compared with the prior art: (1) High affinity and high specificity: The present invention obtained 6 core aptamers (SEQ ID NO: 1-6) by screening with SELEX technology. The aptamers showed extremely high selectivity for H1N1 and H3N2 subtypes and basically did not recognize other subtype influenza viruses or irrelevant proteins.

[0030] (2) Easy to produce and modify: The aptamer of the present invention is a chemically synthesized oligonucleotide, which has the advantages of good batch-to-batch consistency, low cost and easy large-scale preparation compared with monoclonal antibodies. At the same time, the aptamer is very easy to introduce reporter groups or functional groups such as fluorescent, biotin, and thiol groups during or after synthesis, which makes it easy to develop into various forms of detection reagents, such as ELISA kits, colloidal gold test strips, fluorescent biosensors, etc.

[0031] (3) Stable properties and wide range of applications: Nucleic acid aptamers have excellent thermal and chemical stability and can be stored at room temperature or 4°C for a long time, overcoming the disadvantages of antibodies requiring cold chain transportation and storage. The detection kits developed based on this are particularly suitable for rapid on-site detection and environmental sample monitoring. Attached Figure Description

[0032] Figure 1 This is a graph showing the aptamer affinity determination results for hemagglutinin specifically recognizing influenza A virus A / California / 07 / 2009 (H1N1) in one embodiment of the present invention; Figure 2 This is a graph showing the aptamer affinity assay results for hemagglutinin specifically recognizing influenza A virus A / Darwin / 09 / 2021 (H3N2) in one embodiment of the present invention. Figure 3 This is a Dot Blot experiment result of aptamer binding specificity in one embodiment of the present invention. Detailed Implementation

[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental materials in the following embodiments that do not specify their source are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise stated, all parts are parts by weight, and all percentages are percentages by mass. Unless otherwise defined or stated, all professional and scientific terms used in the present invention have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention.

[0034] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.

[0035] Example 1: Screening of nucleic acid aptamers (SELEX method using magnetic beads) This embodiment relates to the screening process of nucleic acid aptamers in this invention. Six nucleic acid aptamers that specifically recognize H1N1 and H3N2 hemagglutinin proteins were obtained using the SELEX method with magnetic beads, as detailed below: (a) Material preparation 1. Random ssDNA library: purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0036] 2. Positive screening targets: Hemagglutinin protein of influenza A virus A / California / 07 / 2009 (H1N1) and hemagglutinin protein of A / Darwin / 09 / 2021 (H3N2) (purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd.).

[0037] 3. Reverse screening target: Hemagglutinin protein of influenza B virus B / Austria / 1359417 / 2021 (purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd.), used to remove non-specific binding sequences.

[0038] 4. Buffer preparation: Phosphate buffer (DPBS; 0.1 M sodium phosphate, 0.15 M sodium chloride; pH 7.2).

[0039] (ii) Immobilization of reverse screening proteins with carboxyl magnetic beads Take 50 μL of carboxyl magnetic beads and wash them four times with 200 μL of ultrapure water. Use a magnet to hook the beads and discard the supernatant. Take 100 μL of NHS and 100 μL of EDC, thaw them slowly at room temperature, add the NHS to the EDC and mix well, then add the mixture to the washed magnetic beads. Incubate on a shaker at room temperature for 20 min (shake occasionally if the beads clump together). Use a magnet to hook the beads and discard the supernatant. Wash them twice with 200 μL of LPBS. Take 5 μL of influenza B virus (B / Austria / 1359417 / 2021) hemagglutinin protein, add 10 μL of pH 4.2 NaAC solution and mix well, then add the mixture to the magnetic beads. Incubate on a shaker at room temperature for 60 min (shake occasionally if the beads clump together). Use a magnet to hook the beads and discard the supernatant. Add 100 μL of 1 M pH 8.5 ethanolamine to the magnetic beads from the previous step. Incubate on a shaker at room temperature for 10 min. Using a magnet to fish for the magnetic beads, discard the supernatant and wash four times with 200 μL DPBS. Label the remaining beads as reverse-sieving magnetic beads.

[0040] (III) Immobilization of positively screened proteins with carboxyl magnetic beads: Take 50 μL of carboxyl magnetic beads and wash them four times with 200 μL of ultrapure water. Use a magnet to catch the beads and discard the supernatant. Take 50 μL of prepared NHS and 50 μL of EDC, thaw them slowly at room temperature, add NHS to the EDC and mix well, then add the mixture to the magnetic beads. Incubate on a shaker at room temperature for 20 min (shake occasionally if the beads aggregate). Use a magnet to catch the beads, discard the supernatant, and wash twice with 200 μL of DPBS. Take 5 μL of hemagglutinin protein from A / California / 07 / 2009 and A / Darwin / 09 / 2021, add 10 μL of NaAC (pH 4.2), and add the mixture to the magnetic beads. Incubate on a shaker at room temperature for 1 h (shake occasionally if the beads aggregate). Use a magnet to catch the beads and discard the supernatant. Add 100 μL of 1 M ethanolamine (pH 8.5) to the magnetic beads. Incubate on a shaker at room temperature for 10 min (shake occasionally if the magnetic beads aggregate). Use a magnet to catch the magnetic beads, discard the supernatant, and wash four times with 200 μL DPBS. Label the beads as positive sieve beads for later use.

[0041] (iv) Reverse screening: 1. Take the library powder, centrifuge at 14000 g for 10 min, add 138 μL of DPBS, vortex to dissolve the powder, centrifuge at 14000 g for 10 min, and aliquot into PCR tubes. Place in a PCR instrument for annealing, program at 95 ℃ for 10 min, then immediately in an ice-water bath for 5 min to equilibrate to room temperature.

[0042] 2. Add 10 μL of 0.1 mg / mL 6His peptide to the refolded library, mix well, and then add to 50 μL of magnetic beads. Mix gently by pipetting and incubate on a shaker at room temperature for 60 min. Use a magnet to pick up the magnetic beads and aspirate the supernatant, labeling the supernatant as "pool-". Wash the magnetic beads four times with 200 μL of DPBS each time, picking up the beads with a magnet and discarding the supernatant. Add 200 μL of ultrapure water to the magnetic beads and boil in a water bath for 10 min. Use a magnet to pick up the beads again, labeling the supernatant as "Elution-".

[0043] (v) Positive screening: Add pool- to 50 μL of positive sieve magnetic beads, mix slowly by pipetting, and incubate on a shaker at room temperature for 60 min. Magnetize the beads and discard the supernatant. Wash the magnetic beads four times with 200 μL of DPBS each time, magnetizing the beads and discarding the supernatant. Add 200 μL of ultrapure water to the magnetic beads and boil in a water bath for 10 min, magnetizing the beads again. Label the supernatant as Elution+.

[0044] (vi) ePCR and gel electrophoresis: Add 2 mL of ePCR mix to Elution+ and transfer to a 50 mL centrifuge tube, mixing well. Add 8 mL of EM90oil and vortex on a high-power vortex mixer to prepare an emulsion. Aliquot the emulsion into 90 μL PCR tubes and run PCR for 25 cycles. The program is: 95 ℃ for 2 min; 95 ℃ for 1 min, 57 ℃ for 1 min, 72 ℃ for 1 min, 25 cycles. Transfer the ePCR product to a 10 mL centrifuge tube, add n-butanol to the top 10 mL, mix well, and centrifuge at 10000 g for 10 min. After centrifugation, separate the layers, aspirate the clear supernatant, and transfer the lower amplification product to a small EP tube (approximately 100 μL). Transfer 90 μL to the small centrifuge tube, add 100 μL of urea loading buffer, mix well, and heat in a PCR instrument at 95 ℃ for 10 min. Then perform 8% denaturing PAGE gel electrophoresis at 300 V for 30 min.

[0045] (vii) Recovery of ssDNA: After electrophoresis, the gel was cut and boiled. The ssDNA was concentrated with n-butanol. The ssDNA was then dialyzed overnight with DPBS using a 3.5KD dialysis bag. This screening process was repeated 10 times. Finally, the Elution+ from the first round and the Elution+ and Elution- from the last round were used for high-throughput sequencing.

[0046] Example 2: Secondary Structure Prediction This embodiment involves the prediction of the secondary structure of the nucleic acid aptamers prepared in Example 1, as detailed below: Aptamers possess specific and complex three-dimensional shapes, characterized by three- or four-stranded structures such as stems, hairpins, protrusions, loops, and pseudoknots. In this embodiment, the secondary structures of 20 aptamers were predicted using RNA Structure (https: / / rna.urmc.rochester.edu / RNAstructureWeb / ). The aptamer sequences were input into the online RNA Structure software, and the Fold, MaxExpect, and ProbKnot algorithms were used to predict the structures with the lowest free energy and the secondary structures composed of highly probable base pairs (including pseudoknots). The results show that the top-ranking aptamers can form multiple stable stem-loop structures. In particular, IAVH1Apt-1-34, IAVH1Apt-2-36, IAVH1Apt-3-36, IAVH1Apt-4-34, IAVH1Apt-5-36, and IAVH1Apt-6-36 are representative, with the most significant structural features. The specific nucleotide information of these six sequences is shown in Table 1 below: Table 1: Aptamer nucleotide sequences specifically recognizing influenza A viruses A / California / 07 / 2009 and A / Darwin / 09 / 2021: Example 3: Determination of the binding affinity of aptamers to hemagglutinin from A / California / 07 / 2009 (H1N1) and A / Darwin / 09 / 2021 (H3N2) In this embodiment, biolayer interference (BLI) technology was used to determine the binding affinity of the nucleic acid aptamers prepared in Example 1 to the hemagglutinin of influenza A virus A / California / 07 / 2009 (H1N1) and A / Darwin / 09 / 2021 (H3N2). The biolayer interference binding experiment was performed at 30°C using a biomolecular interaction apparatus, as detailed below: (a) Solution and sample preparation 1. Equilibration buffer-1: ddH2O.

[0047] 2. Binding buffer: Add 250 μL of 1M MgCl2 solution and 50 μL of 20% Tween 20 solution to 50 mL of PBS solution. Equilibration buffer-2 and dissociation buffer are also used for interaction tests.

[0048] 3. 100 nM aptamer solution: Take 1.5 μL of 100 μM aptamer stock solution and add it to 1.5 mL of binding buffer. Mix well by pipetting.

[0049] 4. Preparation of hemagglutinin protein solutions of different concentrations of A / California / 07 / 2009 (H1N1) and A / Darwin / 09 / 2021 (H3N2): The HA protein of A / California / 07 / 2009 (H1N1) was serially diluted with binding buffer (PBS + 5mM MgCl2 + 0.02% Tween 20) to concentrations of 150nM, 75nM, 37.5nM, and 18.75nM for later use; the HA protein of A / Darwin / 09 / 2021 (H3N2) was serially diluted with the same binding buffer to concentrations of 150nM, 75nM, 37.5nM, 18.75nM, 9.38nM, and 2.34nM for later use.

[0050] 5. Dilute the synthesized biotin-labeled aptamer to 100 nM.

[0051] (ii) Sampling Depending on the sensing location, equilibration buffer-1, aptamer solution, equilibration buffer-2, H1N1 hemagglutinin protein solutions of different concentrations, and dissociation buffer were added to the black 96-well plates.

[0052] (III) Determination of the dissociation constant Using the ForteBio Octet molecular interaction instrument, biotinylated aptamers were immobilized on streptavidin (SA) biosensors. After baseline equilibration, the aptamers bound to and dissociated from HA protein solutions of different concentrations, and the changes in interference spectral shifts were monitored in real time. The measurement parameters were set in the instrument software according to the following procedure: Solution equilibration-1 (Baseline 1), equilibration time 60 s; aptamer immobilization (Loading), reaction time 300 s; Solution equilibration-2 (Baseline 2), equilibration time 300 s; aptamer-protein binding (Association), reaction time 300-1200 s; aptamer-protein dissociation (Dissociation), dissociation time 300-1200 s. During the detection, the plate rotation speed was 1000 rpm. The detection temperature was 30℃.

[0053] (iv) Software analysis combined with dissociation constant K D All data were acquired using Fortebio Data Acquisition 6.4 software and analyzed and calculated using Fortebio Data Analysis 6.4 software to obtain the binding dissociation constant K.D Using Data Analysis software, the binding and dissociation curves were aligned, and a 1:1 binding model was used for global fitting to calculate the binding rate constant (K). a ), dissociation rate constant (K) dis and equilibrium dissociation constant (K) D The results are shown in Tables 2 and 3. Figure 1 , Figure 2 As shown.

[0054] Table 2: Affinity constants of aptamers specifically recognizing influenza A virus and hemagglutinin from A / California / 07 / 2009 (H1N1). Table 3: Affinity constants of aptamers specifically recognizing influenza A virus and hemagglutinin from A / Darwin / 09 / 2021 (H3N2) As shown in Table 2, Table 3 and Figure 1 , Figure 2 As shown, all six aptamers exhibited excellent binding affinity to the HA proteins of A / California / 07 / 2009 (H1N1) and A / Darwin / 09 / 2021 (H3N2), with their K... D The values ​​are all in the nM or even pM range, which is better than most antibodies and can be used to build highly sensitive sensors.

[0055] Example 4: Experimental Study on Aptamer Binding Specificity This embodiment utilizes the six nucleic acid aptamers from Example 3. Based on Dot Blot experiments, the binding specificity of the six aptamers with A / California / 07 / 2009 (H1N1) and A / Darwin / 09 / 2021 (H3N2) was characterized. To demonstrate the subtype binding specificity of the candidate aptamers to different influenza virus HA proteins, the broad binding spectrum of each subtype within the same subtype, and the differences in the binding ability of nucleic acid aptamers to the HA proteins of different strains of the same subtype, this embodiment additionally selected different influenza viruses B / Austria / Specific binding experiments were conducted on influenza B virus 1359417 / 2021 (influenza B) with COVID-19 coronavirus, influenza viruses of the same type but different subtypes A / Anhui / 1 / 2005 (H5N1) and A / Shanghai / 1 / 2013 (H7N9), and different strains of the same subtype A / California / 04 / 2009 (H1N1) and A / Switzerland / 9715293 / 2013 (H3N2). The details are as follows: 1. Protein Spotting: Equal amounts (0.25 μg) of the same concentration of target proteins A / California / 07 / 2009 (H1N1) and A / Darwin / 09 / 2021 (H3N2) hemagglutinin, A / California / 04 / 2009 (H1N1) hemagglutinin, A / Switzerland / 9715293 / 2013 (H3N2) hemagglutinin, A / Anhui / 1 / 2005 (H5N1) hemagglutinin, A / Shanghai / 1 / 2013 (H7N9) hemagglutinin, reverse screening protein B / Austria / 1359417 / 2021 (influenza B) hemagglutinin, coronavirus COVID-19 surface protein (RBD-Fc), group A streptococcal lysate, and BSA protein were spotted onto an NC membrane and fixed by drying at room temperature. Proteins can be immobilized on the NC membrane through electrostatic and hydrophobic interactions between the protein and the NC membrane.

[0056] 2. Blocking and incubation: Block other unbound protein sites on the NC membrane with 3% BSA solution. After washing the NC membrane strips with washing buffer, incubate with the same concentration of Cy5-labeled aptamer (100 nM).

[0057] 3. Signal detection: Remove unbound aptamers and wash the NC membrane with washing buffer. Detect the fluorescence signal of each protein spot on the NC membrane. The intensity of these fluorescence signals directly reflects the binding ability between the aptamer and the protein.

[0058] The results are as follows Figure 3 As shown, the Cy5-labeled IAVH1Apt-2-36 exhibited strong fluorescent signal spots only at the puncta of (A / California / 04 / 2009 (H1N1), A / California / 07 / 2009 (H1N1), A / Darwin / 09 / 2021 (H3N2), and A / Switzerland / 9715293 / 2013), while no obvious fluorescent signal was detected at other different subtype HA proteins (H5N1 and H7N9), influenza B HA protein, and negative control protein (**p<0.01). At the same protein concentration (0.25 μg), the aptamer had a stronger binding affinity to the hemagglutinin of H1N1 and H3N2 than others (**p<0.01). This result confirms that the aptamer provided by this invention can specifically recognize H1N1 and H3N2 subtype influenza A viruses, while exhibiting good differentiation against other subtypes.

[0059] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the description and illustrations of the present invention should be included within the protection scope of the present invention.

Claims

1. An aptamer that specifically recognizes influenza A virus, characterized in that, The aptamer is a nucleic acid aptamer whose nucleotide sequence includes at least one of the sequences shown in SEQ ID NO: 1 to SEQ ID NO: 6; or a complementary sequence that specifically hybridizes with any of its sequences; or a functionally equivalent sequence that has at least 80% sequence identity with any of the above sequences and retains the binding activity of the aptamer; or a chemically modified derivative of any of the above sequences.

2. The aptamer according to claim 1, characterized in that, The nucleic acid aptamer is a single-stranded DNA and has a stem-loop structure or a hairpin structure.

3. The aptamer according to claim 1, characterized in that, The aptamer recognizes or specifically binds to the hemagglutinin of influenza A virus. The influenza A virus in question is of the H1N1 and / or H3N2 subtypes.

4. The aptamer according to claim 1, characterized in that, The chemical modifications include linking markers to provide detection signals and linking functional groups to form compositions with other molecules. The labels include fluorescent groups, isotopes, electrochemical labels, enzyme labels, and nanoluminescent materials; The functional groups include affinity ligands, thiol groups, and amino groups.

5. The aptamer according to claim 1, characterized in that, The chemical modifications include phosphorylation, methylation, aminoation, thiolation, or isotopization at a position on the nucleotide sequence of the aptamer.

6. A method for preparing an aptamer according to any one of claims 1-5, characterized in that, Includes the following steps: (1) Biotin labeling using influenza A viruses H1N1 and H3N2 as target proteins: (2) Obtain the library that binds to the magnetic beads, conjugate the target protein to the magnetic beads, wash and remove non-specific bindings to obtain the magnetic beads and aptamers that are specifically conjugated to the target protein. (3) Dissociate the magnetic bead from its adapter; (4) Desalting the aptamer sample yields the aptamer that specifically recognizes influenza A virus.

7. The preparation method according to claim 6, characterized in that, In step (1), the hemagglutinin protein of influenza A virus H1N1 and H3N2 is used as the target protein. In step (2), reverse screening and forward screening are used to remove non-specific bindings, and the reverse screening uses influenza B virus hemagglutinin protein as the reverse screening protein. In step (2), SELEX technology or magnetic microfluidic chip technology is used for screening; In step (4), the aptamer is obtained by PCR amplification and single-strand separation.

8. A kit for detecting influenza A virus, characterized in that, The kit contains an aptamer that specifically recognizes influenza A virus as described in any one of claims 1-5 or an aptamer prepared by the method described in claims 6-7.

9. The reagent kit according to claim 8, characterized in that, The kit also includes a positive control or a negative control; The positive control is a monomer or / and trimer of hemagglutinin from influenza A virus H1N1 or H3N2.

10. An application of the aptamer as described in any one of claims 1-5, characterized in that, The application is selected from at least one of the following applications: application in the preparation of medicines to alleviate influenza A virus infection, application in the preparation of influenza A virus detection reagents, and application in the screening of medicines for the treatment of influenza A virus infection.

Images