Aptamers that specifically bind to SA, SERS nanoprobes, applications and methods

Abstract

This invention discloses an aptamer specifically binding to Staphylococcus aureus (SA), a SERS nanoprobe, its applications, and methods, belonging to the fields of biodetection technology and nanobiomaterials. The aptamer includes a core binding motif as shown in SEQ ID NO.3, and the complete sequence is shown in SEQ ID NO.2 and SEQ ID NO.1. The aptamer screened using live whole-bacteria SELEX technology exhibits high affinity for Staphylococcus aureus and excellent SERS compatibility. The SERS nanoprobe constructed based on it provides stable signals, and the developed sandwich magnetic separation enrichment method demonstrates high sensitivity and strong specificity for Staphylococcus aureus.

Description

Technical Field

[0001] This invention belongs to the field of biodetection technology and nanobiomaterials, and particularly relates to an aptamer that specifically binds to SA, a SERS nanoprobe, its uses and methods. Background Technology

[0002] Staphylococcus aureus (SA) is a Gram-positive coccus widely distributed on skin, mucous membranes, and in food processing environments. It is a significant pathogen causing foodborne illnesses, wound infections, bacteremia, and even toxic shock syndrome. The various enterotoxins it produces are heat-stable and cannot be completely inactivated by conventional cooking methods, making it a major cause of acute food poisoning in dairy products, cooked foods, and pastries. Furthermore, methicillin-resistant Staphylococcus aureus (MRSA) has been listed as a high-priority drug-resistant pathogen by the WHO.

[0003] Currently, mainstream detection methods for Staphylococcus aureus have significant limitations. Traditional bacterial culture methods (ISO6888-1:2021, GB 4789.10-2016) have high sensitivity, but take at least 24-72 hours; qPCR can be completed in a few hours, but it relies on specialized instruments, and the nucleic acid extraction step is easily affected by food matrices; ELISA or colloidal gold immunochromatography methods using monoclonal antibodies as recognition elements have large batch-to-batch antibody variations, poor thermal stability, and high non-specific binding rates in protein-rich food matrices, affecting detection accuracy.

[0004] Surface-enhanced Raman scattering (SERS) is an optical detection technique that enhances molecular Raman signals by several orders of magnitude based on the hotspot effect of nanostructures. It offers advantages such as characteristic peak fingerprint recognition, narrow linewidth, and low fluorescence background, making it particularly suitable for multiplex detection. Combining SERS technology with the high affinity of nucleic acid aptamers holds promise for developing a new generation of rapid pathogen detection platforms.

[0005] However, existing aptamer-SERS detection methods still face challenges: (1) SERS nanoparticles are prone to uncontrolled aggregation in complex sample matrices, resulting in unstable signals; (2) After aptamers are directly adsorbed onto the surface of metal nanoparticles, their spatial orientation is random, resulting in low exposure of effective binding sites; (3) There is a lack of efficient enrichment steps, leading to insufficient signal-to-noise ratio in samples with low bacterial counts; (4) There are not yet sufficient public reports on high-affinity aptamers that can bind to SERS nanoprobes with high compatibility against the whole-cell target of Staphylococcus aureus. Summary of the Invention

[0006] To address the aforementioned shortcomings in the prior art, this invention provides an aptamer that specifically binds to SA (Staphylococcus aureus), a SERS nanoprobe, its uses, and a method.

[0007] To achieve the above objectives, the technical solution adopted by the present invention to solve its technical problem is as follows: The purpose of this invention is to provide an aptamer that specifically binds to Staphylococcus aureus, comprising a core binding motif as shown in SEQ ID NO. 3.

[0008] Furthermore, the nucleic acid sequence of the aptamer, including the core binding motif shown in SEQ ID NO.3, is shown in SEQ ID NO.1; Or it may be a nucleic acid sequence containing a core binding motif as shown in SEQ ID NO.3, having more than 75% homology with the nucleic acid sequence shown in SEQ ID NO.1, and specifically binding to Staphylococcus aureus.

[0009] Furthermore, the apparent equilibrium dissociation constant Kd between the aptamer and whole Staphylococcus aureus is no greater than 50 nM.

[0010] Furthermore, the aptamer also includes primer-binding regions located at both ends of the nucleic acid sequence as shown in SEQ ID NO.1, the specific sequence of which is shown in SEQ ID NO.2.

[0011] Furthermore, the 3' end of the aptamer is connected to a spacer sequence consisting of 8 to 15 deoxyadenine nucleotides.

[0012] Furthermore, the aptamer has a functional modification group attached to its 5' or 3' end.

[0013] Furthermore, the functional modification group is selected from one or more of biotin, fluorescent groups (including but not limited to FAM, Cy3, Cy5, TAMRA), thiol (-SH), amino (-NH2), or cholesterol.

[0014] Another object of the present invention is to provide the use of the above-described aptamer that specifically binds to Staphylococcus aureus in the preparation of products for the detection of Staphylococcus aureus.

[0015] Furthermore, the products are SERS nanoprobes, SERS sensors, kits, or solid-phase trapping materials.

[0016] Another object of the present invention is to provide a SERS nanoprobe having a core-shell structure, comprising, from the inside out: Gold nanoparticle cores with a diameter of 30-60 nm; Raman reporter layer adsorbed on the surface of gold nanoparticle core; A SiO2 protective shell, 5–15 nm thick, surrounds the Raman reporter molecular layer; and The aforementioned aptamer is coupled to the outer surface of the SiO2 protective shell.

[0017] Furthermore, the outer surface of the SiO2 protective shell is modified with polyethylene glycol.

[0018] Furthermore, the aptamer is connected to the outer surface of the SiO2 protective shell via amino-aldehyde covalent coupling or biotin / streptavidin non-covalent coupling.

[0019] Furthermore, the Raman reporter molecule in the Raman reporter molecule layer is one of 4-mercaptobenzoic acid, DTNB, 4-nitrothiophenol, or methylene blue.

[0020] Another object of the present invention is to provide a method for in vitro detection of Staphylococcus aureus for non-disease diagnostic purposes, specifically: S1. Prepare aptamer-functionalized magnetic beads (Apt-MB) by coupling aptamers modified with 5' biotin with streptavidin-coated magnetic nanoparticles. S2. Incubate Apt-MB with the sample to be tested, and capture and enrich Staphylococcus aureus in the sample by magnetic separation; S3. Add the SERS nanoprobe to the bacterial-magnetic bead complex of S2 and incubate to form a sandwich complex; S4. Remove free SERS nanoprobes by magnetic separation, and then collect SERS signals after resuspending them. S5. Using the intensity of the characteristic peak of the Raman reporter molecule as a quantitative signal, determine the concentration of Staphylococcus aureus in the sample based on the standard curve.

[0021] Furthermore, in step S2, the incubation temperature is 37°C and the incubation time is 20-40 min; in step S3, the incubation time is 15-30 min.

[0022] Furthermore, the excitation wavelength of the SERS signal in S4 is 633 nm or 785 nm; the quantitative signal is 1590 cm⁻¹ of 4-MBA. -1 Characteristic peak intensity.

[0023] Another object of the present invention is to provide the use of the above-described aptamer or SERS nanoprobe that specifically binds to Staphylococcus aureus in the preparation of products for the detection of Staphylococcus aureus in food samples, environmental water samples or in vitro clinical samples; the use is not for the direct purpose of disease diagnosis.

[0024] The beneficial effects of this invention are: 1. The aptamer exhibits high affinity and excellent SERS compatibility. SA-Apt-66 was screened using live whole-cell SELEX technology and has a Kd of no more than 50 nM for whole-cell Staphylococcus aureus. The 3' end polyA spacer sequence design significantly improves the orientation accessibility of the aptamer on the surface of the SERS nanoprobe.

[0025] 2. SERS nanoprobe signals are stable. The SiO2 shell effectively blocks Raman reporter molecules, suppressing signal drift in complex matrices, making it suitable for quantitative analysis.

[0026] 3. The sandwich magnetic separation enrichment method offers high sensitivity. The magnetic enrichment step of Apt-MB concentrates the target bacteria in samples with low bacterial counts, significantly improving the SERS signal-to-noise ratio and achieving a detection limit of 10. 1 CFU / mL level (see Example 3 for specific data).

[0027] 4. High specificity. The SERS signal of the system constructed in this invention is significantly higher for Staphylococcus aureus than that for common non-target bacteria such as Escherichia coli and Salmonella (signal ratio not less than 8:1).

[0028] 5. Simple to operate and compatible with portable Raman spectrometers. The entire process requires no nucleic acid amplification, and the total detection time is approximately 1-2 hours. It can be used with handheld portable Raman spectrometers for rapid on-site detection. Attached Figure Description

[0029] Figure 1 A schematic diagram of the structure of a SERS nanoprobe with a core-shell structure (Au@4-MBA@SiO2-Apt) and a schematic diagram of the sandwich detection principle; Figure 2 The image shows a representative SERS spectrum of a SERS nanoprobe with a core-shell structure. Figure 3 The standard curve of the sensitivity of the MB-SERS assay for Staphylococcus aureus is shown. Figure 4 This is a bar chart showing the specificity of the MB-SERS assay for Staphylococcus aureus and various non-target bacteria. Detailed Implementation

[0030] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0031] The Staphylococcus aureus standard strain (ATCC 6538), Escherichia coli (ATCC 25922), Salmonella typhimurium (ATCC 14028), Listeria monocytogenes (ATCC 19115), and Bacillus subtilis (ATCC 6633) used in this invention are all commercially available type strains.

[0032] Example 1: Whole-cell SELEX screening of SA-Apt-66 1. Initial Library Preparation An initial random ssDNA library was constructed with the structure: 5'-ATCCGTCACACCTGCTCT-(N36)-TGAGCGTCCATTCTTGCA-3' (SEQ ID NO.4), where N36 consists of 36 random bases. The library diversity was no less than 10. 14 One independent sequence. Binding buffer (BB): 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4, with 0.5 mg / mL BSA and 0.1 mg / mL salmon sperm DNA added.

[0033] 2. Positive screening The Staphylococcus aureus standard strain (ATCC 6538) was cultured in TSB medium at 37°C until mid-log (OD600 = 0.6–0.8). After collection, it was washed twice with 1×PBS, resuspended in BB medium, and the density was adjusted to 5×10⁻⁶. 8 CFU / mL (rounds 1-3). Denature the ssDNA library at 95℃ for 5 min, anneal on ice for 5 min, add an equal volume of bacterial suspension, incubate at 37℃ with shaking for 60 min (rounds 1-3), centrifuge at 800×g for 5 min, wash 3 times with BB, elute the bound ssDNA at 95℃, and collect the supernatant for later use.

[0034] 3. Reverse screening (introduced in round 3) The eluted ssDNA was incubated sequentially with *Escherichia coli* (ATCC 25922), *Salmonella typhimurium* (ATCC 14028), and *Listeria monocytogenes* (ATCC 19115) (5 × 10⁻⁶ each). 8 (CFU / mL, 30 min), centrifuge to collect the supernatant and remove non-specific binding sequences.

[0035] 4. PCR amplification and sequence identification Asymmetric PCR (5:1 primer ratio) amplification was performed, followed by secondary ssDNA library preparation using streptavidin magnetic beads. Ten rounds of screening were conducted. Target concentrations ranged from 5 × 10⁻⁶. 8 Reduced to 5×10 6The concentration of CFU / mL was reduced, and the incubation time was shortened from 60 min to 20 min. Illumina high-throughput sequencing was performed on the 9th and 10th rounds of libraries. Bioinformatics analysis identified high-abundance sequences, and 10 candidate aptamers were synthesized and evaluated. SA-Apt-66 (core sequence SEQ ID NO.1) was ultimately determined to have the lowest Kd value; its predicted secondary structure includes a stable stem-loop structure, and the core binding motif (GCATGAACAGTATCCGTACGATCAG) shown in SEQ ID NO.3 is located at the apex of the hairpin loop.

[0036] 5. Determination and comparison of Kd of 10 candidate aptamers Table 1. Ten candidate aptamer sequences obtained from SELEX screening and their apparent dissociation constants (Kd) upon binding with whole Staphylococcus aureus cells.

[0037] Note: SA-Apt-66 is the 36 nt core aptamer sequence shown in SEQ ID NO.1 of this invention; SEQ ID NO.2 is the full-length sequence after connecting the immobilized primer binding regions to both ends of SEQ ID NO.1; SEQ ID NO.3 is the core binding motif located inside SEQ ID NO.1. The sequence used for Kd determination was SA-Apt-66 with a 5' end FAM label; the sequence used for SERS probe construction was SA-Apt-66 with a 5' end amino modification and a 3' end polyA10 spacer arm.

[0038] The affinity of 10 synthesized candidate aptamers (SA-Apt-01 to SA-Apt-66) was compared. The apparent equilibrium dissociation constant (Kd) of each aptamer with whole Staphylococcus aureus cells was determined by flow cytometry using fluorescence saturation binding. The specific procedure is as follows: FAM-labeled candidate aptamers at their 5' ends were prepared at concentrations of 0.1, 0.5, 1, 5, 10, 25, 50, 100, 250, and 500 nM (dissolved in BB buffer containing 0.5 mg / mL BSA). These aptamers were incubated with a fixed number of Staphylococcus aureus cells (ATCC 6538, approximately 5 × 10⁷ CFU / mL) at 4°C for 60 min (to prevent endocytosis). After washing three times with PBS, the mean fluorescence intensity (MFI) was measured by flow cytometry (Ex 488 nm / Em 530 nm). A nonlinear curve was fitted using the unit-point specific binding model in GraphPad Prism 9.0 software, with aptamer concentration (nM) on the x-axis and MFI on the y-axis. The fitting parameters, including Kd, MFImax, and background fluorescence, were output.

[0039] The Kd values ​​of the 10 candidate aptamers obtained from the fitting are summarized in Table 1. SA-Apt-66 (SEQ ID NO.1) had the lowest Kd value (18.3 ± 2.1 nM, R² = 0.991), which was significantly better than the other 9 candidate aptamers (all Kd > 25 nM), confirming SA-Apt-66 as the aptamer with the best affinity, and serving as the recognition element for the subsequent construction of the SERS sensor. Meanwhile, using an equimolar concentration (100 nM) random sequence library (N36 Library) as a negative control, its MFI ≤ 12% of the SA-Apt-66 signal, demonstrating that the binding has high sequence specificity.

[0040] Note: SA-Apt-66 is the sequence shown in SEQ ID NO.1 of this invention (the full-length 36 nt sequence including the flanking primer region). The sequence used for Kd determination was the NH2-functionalized form with a 3' polyA10 spacer arm added (SEQ ID NO.1), which was incubated with whole Staphylococcus aureus ATCC 6538 cells at 4°C to reduce nonspecific background.

[0041] Example 2: Preparation and characterization of SERS nanoprobes with core-shell structure (Au@4-MBA@SiO2-Apt) 1. Preparation of AuNPs The sodium citrate reduction method was used to prepare approximately 40 nm AuNPs. The specific process is as follows: After heating a 0.01% HAuCl4 aqueous solution to boiling, 1% sodium citrate (100:3, v / v) was added and stirred continuously for 15 min. After cooling, UV-Vis confirmed that the surface plasmon resonance peak was about 524 nm, and DLS determined that the particle size was about 45 nm (PDI<0.15).

[0042] 2. 4-MBA layer modification Add 4-MBA ethanol solution to AuNPs and incubate at room temperature for 2 h. 4-MBA forms a self-assembled monolayer through Au-S bonds. Centrifuge to remove free 4-MBA.

[0043] 3. SiO2 shell coating Au@4-MBA was transferred to 30% ethanol / water (v / v, pH 10.5), and TEOS was slowly added dropwise. The mixture was stirred at room temperature for 12 h. The amount of TEOS was controlled to make the SiO2 shell thickness about 5~10 nm. Au@4-MBA@SiO2 was obtained by centrifugation and washing.

[0044] 4. Surface coupling of aptamers After amination with APTES on the SiO2 surface, activation with glutaraldehyde led to the covalent linking of 5' amino-modified SA-Apt-66 (NH2-SA-Apt-66-polyA10, with 10 dA spacer sequences appended to the 3' end of SEQ ID NO.1) via aldehyde-imine bonds. The remaining aldehyde groups were blocked with BSA, and the sample was centrifuged and washed to obtain the SERS nanoprobe (Au@4-MBA@SiO2-Apt).

[0045] 5. Characterization Results The prepared SERS nanoprobes were verified by TEM, and the core-shell structure is shown in the figure. Figure 1 The left-hand side of the figure shows, from the inside out, the gold nanoparticle core, the 4-MBA Raman reporter molecule layer, the SiO2 protective shell layer, and the SA-Apt-66 aptamer recognition layer. The right-hand side shows, in enlarged font, the process of Apt-MB capturing bacteria, SERS nanoprobe binding to form a sandwich complex, and SERS signal detection after magnetic separation. Here, "SERS label" refers to Au@4-MBA@SiO2-Apt nanolabel.

[0046] Figure 2 The SERS spectrum excited at 785 nm is shown, with the horizontal axis representing the Raman shift (cm). -1 The vertical axis represents SERS intensity (au); the two characteristic peaks of 4-MBA are marked in the figure (approximately 1080 cm⁻¹). -1 Approximately 1590 cm -1 DLS measurements showed that the hydrodynamic particle size increased by approximately 10–20 nm after binding to the aptamer, confirming successful aptamer coupling; colloidal stability tests (0.15 MPBS, stored at 4°C for 4 weeks) indicated that the nanoprobes did not exhibit significant aggregation.

[0047] 6. polyA 10 The effect of interval sequences on SERS sensor performance: verification by control experiments To prove the 3' end polyA in claim 5 10 To demonstrate the technical necessity of the spacer sequence, after completing the above preparation and characterization (steps 1–5), the following control experiment was set up: Control probe A (without polyA spacer): SA-Apt-66 modified with 5' end NH2 (only the aminated version of SEQ ID NO.1, without polyA tail, 36 nt) was modified with Au@4-MBA@SiO2 nanoparticles according to the same coupling process (APTES functionalization-EDC / NHS activation-covalent coupling) to obtain probe A.

[0048] Experimental probe B (containing polyA) 10Spacing): that is, Au@4-MBA@SiO2-Apt(NH2-SA-Apt-66-polyA) prepared in step (4) of this embodiment. 10 , SEQ ID NO.1).

[0049] Testing conditions: Take 10 5 100 μL of CFU / mL Staphylococcus aureus (ATCC 6538) was incubated with Apt-MB (streptavidin magnetic beads, 1 mg / mL) at 37°C for 30 min, followed by magnetic separation. Then, 100 μL of probe A or probe B (OD≈0.5) was added, and the mixture was reacted at 37°C for 20 min. After washing with PBS and excitation at 785 nm, the 1590 cm⁻¹ value was recorded. -1 SERS signal at location (n=3).

[0050] Table 2. Effect of polyA10 spacer sequence on the performance of SERS nanoprobes (I) 1590 (au, n=3)

[0051] Results (Table 2): Probe A (without polyA): I 1590 = 4240 ± 480 au (%CV = 11.3%); Probe B (polyA) 10 ): I 1590 = 5800 ± 180 au (%CV = 3.1%). Contains polyA 10 The spacer arm probe B showed an approximately 37% increase in signal intensity and a 72% decrease in coefficient of variation, indicating that polyA 10 The spacing effectively reduces the spatial steric hindrance between the SiO2 surface and the aptamer functional binding domain, maintains the correct folding of the recognition ring, and improves capture efficiency and signal repeatability.

[0052] like Figure 3 As shown, I 1590 The intensity increased with increasing bacterial concentration; it showed a good linear relationship (R²>0.99) in the range of 10^3 to 10^6 CFU / mL, and the detection limit (S / N=3) reached the order of 10^1 CFU / mL, covering the detection range of 10^1 to 10^7 CFU / mL, indicating that the MB-SERS detection method has high analytical sensitivity.

[0053] Example 3 Sensitivity determination of MB-SERS detection method 1. Preparation of Apt-MB 5' biotin-modified SA-Apt-66 (Biotin-SA-Apt-66, SEQ ID NO.2, 1 nmol / mg magnetic beads) and streptavidin-coated magnetic nanoparticles (1 mg / mL) were incubated in BB at room temperature for 60 min by rotation. After magnetic separation, the mixture was washed three times in BB and resuspended for later use (Apt-MB).

[0054] ATCCGTCACACCTGCTCTGCACGGTAGCATGAACAGTATCCGTACGATCAGCGGTGAGCGTCCATTCTTGCA (SEQ ID NO. 2).

[0055] 2. Preparation of standard bacterial solutions Staphylococcus aureus (ATCC 6538) was serially diluted to prepare a final concentration of 10. 1 ~10 7 CFU / mL standard bacterial culture (simultaneously validated by plate count method), with sterile BB as blank control.

[0056] 3. Sandwich testing operation ① Bacterial capture: Add 1 mL of bacterial solution of each concentration to 100 μL Apt-MB, incubate with shaking at 37℃ for 30 min, separate magnetically, and wash twice with BB.

[0057] ② Probe binding: Resuspend in 200 μL BB, add 100 μL SERS probe (OD about 0.5), incubate at 37℃ for 20 min, magnetically separate, and wash twice with BB.

[0058] ③ SERS detection: Resuspend in 50 μL of deionized water, excite at 785 nm, and acquire SERS spectra (integrate for 5 s, repeat 3 times). At 1590 cm⁻¹ -1 Peak intensity (I) 1590 ( ) as a quantitative signal.

[0059] 4. Results and Analysis See results Figure 3 The horizontal axis of the graph represents the concentration of Staphylococcus aureus (CFU / mL, logarithmic scale), and the vertical axis represents 1590 cm⁻¹. -1 SERS peak intensity (au) at [location]; the linear detection range (10¹~10¹) is marked in the figure. 6 (CFU / mL) and limit of detection (LOD).

[0060] like Figure 3 As shown, I 1590 Intensity varies with bacterial concentration (logarithmic scale) at 10 1 ~10 6It exhibits good linearity within the CFU / mL range (R²>0.99), and the limit of detection (S / N=3) reaches 10. 1 The CFU / mL level indicates that the MB-SERS detection method has high analytical sensitivity.

[0061] 5. Standard curve equation and detection limit calculation (1) Equation of the standard curve I obtained from 3 sets of parallel experiments 1590 The logarithm of the mean (n=3) versus the concentration of Staphylococcus aureus (log 10 (C), C unit CFU / mL) plotted ( Figure 3 ), using GraphPad Prism 9.0 software to test 10 3 ~10 6 Linear regression analysis was performed on the data within the CFU / mL linear dynamic range, and the fitted equation obtained was: I 1590 = 2255.4 × log 10 (C) 5510.2 In the formula, I 1590 1590 cm -1 The SERS signal intensity (au) is given by C, where C is the concentration of Staphylococcus aureus (CFU / mL). R² = 0.9945, and the linear range is 10. 3 ~10 6 CFU / mL.

[0062] In the low concentration range of 10¹ to 10² CFU / mL, the signal increases with concentration but has not yet entered a strictly linear phase; in the 10¹ to 10² CFU / mL range... 6 ~10 7 In the high concentration range of CFU / mL, the signal tends to saturate (≥9200 au).

[0063] (2) Calculation of detection limit The limit of detection (LOD) is calculated using the signal-to-noise ratio (S / N) = 3 criterion, and the calculation formula is as follows: LOD signal threshold = I 1590 Mean + 3 × SD_blank In the formula, blank control (BB buffer without bacteria) I 1590 Mean = 85 au, Standard deviation SD_blank = 22 au (n=3).

[0064] LOD signal threshold = mean + 3 × SD_blank = 85 + 3 × 22 = 151 au.

[0065] At the lowest test concentration of 10 1 At CFU / mL, the measured I 1590 = 210 ± 38 au, S / N = (210 85) / 22 = 5.68 > 3, which meets the LOD criterion.

[0066] Therefore, the limit of detection (LOD) for the MB-SERS detection method was determined to be 10. 1 CFU / mL (i.e., 10 CFU / mL), detection range is 10. 1 ~10 7 CFU / mL (spanning 6 orders of magnitude), with a linear dynamic range of 10. 3 ~10 6 CFU / mL (R² = 0.9945).

[0067] For quantitative analysis, the concentration of Staphylococcus aureus in the sample is calculated using the following formula (applicable within the linear range): log 10 (C) = (I 1590 + 5510.2) / 2255.4 Example 4 Specificity Verification Escherichia coli (ATCC 25922), Salmonella Typhimurium (ATCC 14028), Listeria monocytogenes (ATCC 19115), Bacillus subtilis (ATCC 6633), and a blank control were selected as non-target groups. All strains were adjusted to approximately 10⁵ CFU / mL, and MB-SERS detection was performed according to the procedure described in Example 3. I1590 was recorded, with three replicates per group. The results of the replicate assays for specificity verification are summarized in Table 3, and the corresponding bar chart is shown below. Figure 4 Table 3 shows the results of this experiment, comparing SERS signal intensity (n=3, mean ± standard deviation); red bars represent target bacteria, and blue bars represent non-target control bacteria.

[0068] Table 3. Summary of SERS signal intensity of Staphylococcus aureus and various non-target control bacteria detected by MB-SERS method (I 1590 ,au,n=3,~10 5 CFU / mL

[0069] Note: All experimental data are expressed as mean ± standard deviation (Mean ± SD, n=3). One-way ANOVA was performed on the SERS signal intensity of each group using IBM SPSS Statistics 27.0 software to test for significant differences between groups. If the ANOVA was significant (p<0.05), Tukey's HSD post-hoc test was further performed to determine the specific differences between groups.

[0070] Figure 4 The results showed that the SERS signal generated by the system for Staphylococcus aureus was significantly higher than that of the non-target control groups (the difference was statistically significant), and the ratio of the signal to the highest signal of non-target bacteria was not less than 8:1, indicating that the detection system has high specificity for bacterial species identification. Specific peak intensity values ​​are shown in Table 3.

[0071] One-way ANOVA: F(5, 12) = 1540.1, p<0.0001, indicating that there are highly significant differences among the 6 groups.

[0072] Tukey post-hoc testing: Staphylococcus aureus (target bacteria) group I 1590 The values ​​of (7800 ± 310 au) were significantly different from those of Escherichia coli (610 ± 55 au), Salmonella typhimurium (590 ± 62 au), Listeria monocytogenes (540 ± 48 au), Bacillus subtilis (520 ± 44 au), and the blank control (85 ± 18 au) (p < 0.001). Figure 4 (Note: The text is marked with ***). There was no significant difference in signal among the non-target bacterial groups (p>0.05).

[0073] The ratio of the target bacterial signal to the highest non-target bacterial signal (Escherichia coli, 610 au) is 12.8:1, which is higher than the specificity threshold requirement of 8:1 described in the claims, indicating that the detection system has good specificity for bacterial species identification.

[0074] Example 5: Validation of Spiked Recovery in Milk Samples Commercially available whole milk was diluted with PBS at a volume ratio of 1:4, centrifuged at 4000×g for 10 min, and Staphylococcus aureus (ATCC 6538) was artificially added to a final concentration of 10. 2 10 3 10 4 CFU / mL, with sterile milk dilution as a negative control, and 3 replicates for each.

[0075] The detection was completed according to the operating procedure described in Example 3. The detection concentration was converted based on the standard curve, and the spiked recovery rate (RR) was calculated. RR (%) = C_detected / C_spiked × 100% In the formula, RR For spiked recovery rate; C_detected The sample detection concentration (CFU / mL) was calculated based on the standard curve of Example 3. C_spiked The theoretical concentration (CFU / mL) of the target bacteria artificially added to the sample.

[0076] Table 4. Recovery results of Staphylococcus aureus spiked in milk diluted matrix (n=3)

[0077] As shown in Table 4, the spiked recoveries of samples at three concentration levels in the milk-diluted matrix were 93.0%–105.0%, with relative standard deviations not exceeding 9.0%. This indicates that the SERS nanoprobes protected by the SiO2 shell have stable signals in complex protein matrices, and the magnetic separation enrichment step effectively reduces matrix interference. The method has good matrix adaptability and practical application potential.

[0078] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

Claims

1. An aptamer that specifically binds to Staphylococcus aureus, said nucleic acid aptamer being a single-stranded DNA containing a core binding motif as shown in SEQ ID NO.

3.

2. The aptamer specifically binding to Staphylococcus aureus according to claim 1, characterized in that, Nucleic acid sequences of aptamers including the core binding motif shown in SEQ ID NO.3 are shown in SEQ ID NO.1; Alternatively, it may be a derived sequence based on SEQ ID NO.1 with 1 to 3 base substitutions, deletions, or additions; the derived sequence retains the core binding motif shown in SEQ ID NO.3, maintains the ability to form the corresponding stem-loop structure, and specifically binds to the whole Staphylococcus aureus with a Kd not greater than 50 nM.

3. The aptamer specifically binding to Staphylococcus aureus according to claim 2, characterized in that, The aptamer also includes primer-binding regions located at both ends of the nucleic acid sequence as shown in SEQ ID NO.1, the specific sequence of which is shown in SEQ ID NO.

2.

4. The aptamer specifically binding to Staphylococcus aureus according to claim 3, characterized in that, The aptamer has a spacer sequence of 8 to 15 deoxyadenine nucleotides attached to its 3' end.

5. Use of the aptamer that specifically binds to Staphylococcus aureus as described in any one of claims 1 to 4 in the preparation of products for the detection of Staphylococcus aureus.

6. The use according to claim 5, characterized in that, The products are SERS nanoprobes, SERS sensors, kits, or solid-phase trapping materials.

7. A SERS nanoprobe, characterized in that, The SERS nanoprobe has a core-shell structure, comprising, from the inside out: Gold nanoparticle core; Raman reporter layer adsorbed on the surface of gold nanoparticle core; A SiO2 protective shell covering the Raman reporter molecular layer; and The aptamer according to any one of claims 1 to 4 is coupled to the outer surface of the SiO2 protective shell.

8. The SERS nanoprobe according to claim 7, characterized in that, The Raman reporter molecule in the Raman reporter layer is one of 4-mercaptobenzoic acid, DTNB, 4-nitrothiophenol, or methylene blue.

9. The use of the aptamer specifically binding to Staphylococcus aureus as described in any one of claims 1 to 4 or the SERS nanoprobe as described in claim 7 or 8 in the preparation of products for the detection of Staphylococcus aureus in food samples, environmental water samples or in vitro clinical samples; said use is not for the direct purpose of disease diagnosis.

10. A method for in vitro detection of Staphylococcus aureus for non-disease diagnostic purposes, characterized in that, Includes the following steps: S1. The aptamer modified with 5' biotin was coupled with streptavidin-coated magnetic nanoparticles to prepare aptamer-functionalized magnetic beads Apt-MB. S2. Incubate Apt-MB with the sample to be tested, and capture and enrich Staphylococcus aureus in the sample by magnetic separation; S3. The SERS nanoprobe described in claim 7 is added to the bacteria-magnetic bead complex in S2 and incubated to form a sandwich complex. S4. Remove free SERS nanoprobes by magnetic separation, and then collect SERS signals after resuspending them. S5. Using the intensity of the characteristic peak of the Raman reporter molecule as a quantitative signal, determine the concentration of Staphylococcus aureus in the sample based on the standard curve.

Images