Application of the CaMYB121 gene in regulating salt tolerance in chili pepper plants

CN122563976APending Publication Date: 2026-08-14HUNAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-30
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

[0006]目前,植物基因功能的验证通常依赖于稳定的遗传转化,但该方法周期长、操作复杂,特别是对于辣椒等遗传转化效率较低的作物

Benefits of technology

(1)本发明首次通过转录组分析与功能验证,辣椒MYB转录因子CaMYB121的表达水平显著受盐胁迫诱导,通过功能获得性实验(在酵母中过表达)和功能缺失性实验(在辣椒中VIGS沉默),证实了CaMYB121基因对耐盐性的调控作用,这为通过基因工程手段培育耐盐辣椒新品种提供了直接、有效的基因靶点和理论依据。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122563976A_ABST
    Figure CN122563976A_ABST
Patent Text Reader

Abstract

This invention discloses a chili pepper in the field of genetic engineering. CaMYB121 The application of genes in regulating salt tolerance in pepper plants, including peppers CaMYB121 The CDS sequence of the gene is shown in SEQ ID NO:1, and a method for verifying the chili pepper is disclosed. CaMYB121 This invention discloses a method for understanding gene function in salt tolerance, a method for reducing salt tolerance in chili pepper plants, and a gene silencing method for studying salt tolerance in chili peppers. For the first time, this invention uses transcriptome analysis and functional verification to demonstrate that the expression level of the chili pepper MYB transcription factor CaMYB121 is significantly induced by salt stress. Through gain-of-function experiments (overexpression in yeast) and loss-of-function experiments (VIGS silencing in chili peppers), the regulatory role of the CaMYB121 gene in salt tolerance was confirmed. This provides a direct and effective gene target and theoretical basis for cultivating new salt-tolerant chili pepper varieties through genetic engineering.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, and particularly relates to a chili pepper. CaMYB121 Application of genes in regulating salt tolerance in chili pepper plants. Background Technology

[0002] Chili peppers are an important vegetable and economic crop in my country and globally. However, during their cultivation, salt stress is one of the major abiotic stress factors that seriously affects their growth, development, yield, and quality. Soil salinization leads to a series of physiological damages in chili pepper plants, including osmotic stress, ion toxicity, oxidative damage, and mineral nutrient imbalance, ultimately resulting in reduced yield or even crop failure. Therefore, exploring the salt tolerance genetic resources of chili peppers and elucidating their molecular mechanisms of salt tolerance is of great significance for breeding new salt-tolerant chili pepper varieties through molecular breeding techniques.

[0003] Transcription factors play a central role in the regulatory network of plant responses to abiotic stress. Among them, the MYB transcription factor family is one of the largest transcription factor families in plants, and it is widely involved in the regulation of biotic and abiotic stresses in plants.

[0004] While the crucial role of MYB transcription factors in biotic and abiotic stresses is widely recognized, the functions of the vast MYB family members in chili pepper, a specific crop, remain largely unresolved. Currently, research on the molecular mechanisms of salt tolerance in chili pepper is still insufficient, particularly regarding how specific MYB transcription factors integrate into the salt stress response network and directly regulate its salt tolerance phenotype. (Chili pepper) CaMYB121 The function of the gene and its specific mechanism of action in salt tolerance are still unknown, which greatly limits our technological development for using this gene in molecular breeding of salt-tolerant peppers.

[0005] Therefore, identifying and functionally validating key salt tolerance-related MYB transcription factors in chili peppers can not only deepen our understanding of the molecular mechanisms of salt tolerance in chili peppers, but also provide direct and effective gene targets and theoretical basis for targeted improvement of salt tolerance in chili peppers through genetic engineering or molecular design breeding.

[0006] Currently, the verification of plant gene function usually relies on stable genetic transformation, but this method is time-consuming and complex, especially for crops with low genetic transformation efficiency such as peppers. Therefore, establishing a rapid, efficient experimental method that can verify the salt tolerance function of genes in heterologous systems is of great significance for high-throughput screening and identification of salt-tolerant genes and accelerating the process of salt-tolerant molecular breeding in peppers. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a chili pepper... CaMYB121Application of genes in regulating salt tolerance in chili pepper plants.

[0008] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0009] A type of chili pepper CaMYB121 Application of genes in regulating salt tolerance in pepper plants, the pepper CaMYB121 The CDS sequence of the gene is shown in SEQ ID NO:1.

[0010] The above-described application, preferably, promotes or enhances the chili pepper's... CaMYB121 Gene expression is used to improve the salt tolerance of chili pepper plants.

[0011] The above-described application, preferably, involves inhibiting or reducing the chili pepper's... CaMYB121 Gene expression is used to reduce the salt tolerance of chili pepper plants.

[0012] As a general inventive concept, the present invention also provides a method for cultivating peppers with improved salt tolerance, including increasing the salt content of peppers in the pepper plant. CaMYB121 The expression level of the gene in the chili pepper CaMYB121 The CDS sequence of the gene is shown in SEQ ID NO:1.

[0013] The above method, preferably, involves using ingredients containing chili peppers. CaMYB121 A gene expression vector was introduced into pepper plants, and the gene was overexpressed to improve the pepper's nutritional value. CaMYB121 Gene expression levels.

[0014] As a general inventive concept, this invention also provides a method for verifying chili peppers. CaMYB121 A method for determining the function of a gene in salt tolerance includes the following steps: (1) Take the chili peppers as shown in SEQ ID NO:1 CaMYB121 The gene was constructed into a yeast expression vector and transformed into a yeast strain; (2) The transgenic yeast strain obtained in step (1) and the control yeast strain were cultured under salt stress conditions respectively; (3) Compare the growth of the two strains. If the growth of the transgenic yeast strain is better than that of the control, it indicates that the chili pepper is superior. CaMYB121 The gene has the function of increasing salt tolerance.

[0015] In the above method, preferably, the yeast strain is INVSC1.

[0016] As a general inventive concept, this invention also provides a method for reducing the salt tolerance of chili pepper plants, thereby reducing the salt content of chili peppers in the plants. CaMYB121 The expression level of the gene or the activity of the protein encoded by the gene, in the chili pepper CaMYB121The CDS sequence of the gene is shown in SEQ ID NO:1.

[0017] As a general inventive concept, this invention also provides a method for gene silencing in the study of salt tolerance in chili peppers, reducing the salt content of chili peppers in chili plants. CaMYB121 The expression level of the gene in the chili pepper CaMYB121 The CDS sequence of the gene is shown in SEQ ID NO:1.

[0018] The above method, preferably, reduces the expression level of the CaMYB121 gene in the chili pepper through virus-induced gene silencing technology.

[0019] In the above method, preferably, the silencing vector used contains a nucleotide sequence as shown in SEQ ID NO:2.

[0020] As a general inventive concept, the present invention also provides the above-described application or method, wherein the salt tolerance is the tolerance to sodium salt stress, and the concentration of the sodium salt stress is 100-200 mM sodium chloride.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention is the first to verify the MYB transcription factor of chili pepper through transcriptome analysis and functional validation. CaMYB121 The expression level of [the substance] was significantly induced by salt stress, as confirmed by gain-of-function experiments (overexpression in yeast) and loss-of-function experiments (VIGS silencing in pepper). CaMYB12 The regulatory role of genes in salt tolerance provides a direct and effective gene target and theoretical basis for cultivating new salt-tolerant pepper varieties through genetic engineering.

[0022] (2) The present invention also provides a method for verifying the chili pepper in a yeast heterologous expression system. CaMYB121 A simple method for assessing the salt tolerance function of transgenic yeast is presented. This method leverages the rapid growth and simple culture characteristics of yeast to quickly and intuitively identify transgenic yeast by observing its growth phenotype under salt stress. CaMYB121 Salt tolerance biological function of genes. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1This invention provides an analysis of differentially expressed genes (DEGs) and weighted co-expression network (WGCNA) at six developmental stages of pepper plants under salt treatment (NR1-NR6) and control conditions (CR1-CR6) in Example 1: A. Volcano plots of DEGs at six time points (CR1 vs. NR1, CR2 vs. NR2, CR3 vs. NR3, CR4 vs. NR4, CR5 vs. NR5, CR6 vs. NR6). Red: significantly upregulated genes (p<0.05 and log2 fold change >2); Blue: significantly downregulated genes (p<0.05 and log2 fold change <2). 2) Gray: Genes with no significant differences. B. Clustering dendrogram of gene expression profiles after filtering out the lowest 30% of genes. C. Module-trait correlation analysis between the WGCNA module and salt treatment, with correlation coefficients and corresponding p-values ​​shown in parentheses. The MEyellow module showed the highest positive correlation with salt treatment. D. Transcriptional heatmap of 20 MYB genes in the MEyellow module. E. Log2 fold change of differential expression of 8 MYB genes across all six salt treatment time points.

[0025] Figure 2 The transient silencing of CaMYB121 in chili peppers under salt stress in Example 3 of this invention is illustrated by the following: A. Phenotype of CaMYB121-silenced chili pepper plants after 15 days of salt treatment. B. Transcriptional level of CaMYB121 in inoculated chili pepper plants determined by RT-qPCR. C. Root length and weight of control and silencing-treated chili pepper plants after 15 days of treatment with 150 mM sodium chloride. (An asterisk indicates a significant difference according to Student's test, P < 0.05) P<0.01 P<0.001 P<0.0001 ).

[0026] Figure 3 The figures for PRO content (A) and MDA level (B) in pepper plants in Example 4 of this invention, after treatment with 150 mM sodium chloride for 2 weeks, are given. (An asterisk indicates a significant difference as determined by Student's test, P < 0.05) P<0.01 P<0.001 P<0.0001 ).

[0027] Figure 4 In Example 5 of this invention, after being treated with 150 mM sodium chloride for one week, the Na+ content of the inoculated pepper plants was... + (A) K + Concentration (B) and Na + / K + Determination of content ratio (C). (An asterisk indicates a significant difference as determined by Student's test, P < 0.05) P<0.01 P<0.001 P<0.0001 ).

[0028] Figure 5 The growth phenotype of the transgenic yeast in Example 6 of the present invention is shown in which yeast cells carrying the recombinant plasmid pYES2-NTB-CaMYB121 are cultured on SG / -Ura medium after being continuously diluted (10-fold and 100-fold). Detailed Implementation

[0029] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0030] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0031] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0032] Example 1: Salt tolerance-related genes CaMYB121 Identification and expression analysis 1. Materials and Methods (1) Plant materials and treatment: The annual pepper '6421' (a germplasm resource collected by the applicant and currently preserved in the germplasm resource nursery of the pepper team of the College of Horticulture, Hunan Agricultural University, which can also be guaranteed to be sold for at least 20 years; the applicant has published this germplasm resource in the journal Molecular Plant, "PepperHub, an Informatics Hub for the Chili Pepper Research Community") was used as the experimental material. Salt treatment was applied to 40-day-old pepper seedlings. Salt treatment group and control group were set up, with at least 3 biological replicates in each group. The salt treatment group was irrigated with nutrient solution containing 200 mM NaCl, while the control group was treated with only an equal amount of nutrient solution (Control-Root, CR). Root samples were collected from the plants at 0.5, 1, 3, 6, 12 and 24 hours after treatment (corresponding to CR1 / NR1 to CR6 / NR6, respectively), flash-frozen in liquid nitrogen and stored at -80℃.

[0033] (2) Transcriptome sequencing and analysis: 0.5–5 μg of total RNA from each sample was used for library construction. Sequencing libraries were prepared using the NEB Next Ultra Directional RNA Library Prep Kit (NEB) and index tags were added. The libraries were quantified using Qubit, fragment sizes were detected using an Agilent 2100 Bioanalyzer, and precise quantification was performed using the StepOnePlus Real-Time PCR System. Cluster generation was performed on a cBot using the HiSeq SR Cluster Kit, followed by 150 bp paired-end sequencing on an Illumina HiSeq 4000 platform. The raw reads were quality assessed using FastQC software, and low-quality reads (Q<20), reads containing adapters, and reads with excessively high N ratios were removed using Trimmomatic software to obtain clean reads. The clean reads were aligned to the reference genome (http: / / ted.bti.cornell.edu / cgi-bin / pepper / index) using STAR software. The read counts aligned to each gene were counted using featureCounts to obtain the original expression matrix. Gene expression levels were normalized using FPKM (Fragments Per Kilobase of transcripts per Million mapped reads) for subsequent differentially expressed gene analysis. Differential expression analysis was performed using DESeq2 (R package). The input was the original counts matrix, and the formula included processing conditions. A volcano plot was generated using |log2(Fold Change)| ≥ 1 and padj (corrected p-value) < 0.05 as the threshold for significantly differentially expressed genes.

[0034] (3) Weighted gene co-expression network analysis: An expression matrix was constructed using gene expression levels (FPKM values) obtained from transcriptome sequencing. After filtering out low-expression genes, a soft threshold β was calculated using the R software package WGCNA to construct a scale-free network. Hierarchical clustering was performed based on the topological overlap matrix between genes, and gene modules were divided using the dynamic pruning tree method. The characteristic genes of each module were calculated, and correlation analysis was performed between them and salt treatment to screen key modules that were significantly correlated with traits (|r|>0.6, p<0.05).

[0035] 2. Results (1) Differential expression analysis showed that in comparisons of CR1 vs. NR1, CR2 vs. NR2, CR3 vs. NR3, CR4 vs. NR4, CR5 vs. NR5, and CR6 vs. NR6, 1,047, 1,708, 2,124, 2,382, 2,339, and 1,981 differentially expressed genes (DEGs) were identified, respectively. Figure 1 A).

[0036] (2) Weighted Gene Co-expression Network Analysis: Weighted gene co-expression network analysis (WGCNA) was used to analyze the samples from the control group and the treatment group, and 17 different gene modules were identified. Figure 1 B). Among them, the MEyellow module had the highest correlation coefficient with salt treatment (correlation coefficient = 0.85, p < 0.0001). Figure 1 C). This indicates that the genes in this module may be closely related to salt tolerance in peppers.

[0037] (3) Key gene screening: The MEyellow module contains 1804 genes, of which 129 are transcription factors. The MYB transcription factor family has the most members (20), accounting for 15.5%. Figure 1 (D) This indicates that this family may play an important role in salt tolerance in peppers. Further analysis of the expression patterns of 20 MYB genes showed that, compared with the control group, eight members were consistently and significantly upregulated at all six time points. Figure 1 A and 1D). Through a comprehensive comparison of expression levels and log2(FC) values, it was found that... CaMYB121 The expression of gene (gene ID: Caz02g28840) was most significantly upregulated, and its expression changes were the most stable at different time points. Figure 1 (D and 1E), and were therefore selected as the objects for subsequent functional analysis. The above results indicate that... CaMYB121 Genes are significantly associated with salt tolerance in chili peppers.

[0038] Example 2: Salt-tolerant transcription factors CaMYB121 Cloning 1. RNA extraction and cDNA synthesis: Using the chili pepper variety zhangshugang (S8) as material (a germplasm resource collected by the applicant and currently preserved in the chili pepper germplasm resource nursery of the College of Horticulture, Hunan Agricultural University, which can also be guaranteed for sale for at least 20 years; the applicant has published this germplasm resource in the journal Nature Communications under the title "Genomes of cultivated and wild Capsicumspecies provide insights into pepper domestication and population differentiation"), young leaves were taken, flash-frozen in liquid nitrogen, and then ground into powder. Total RNA was extracted using the Novizan RNA Extraction Kit (catalog number: RC411-01), and the specific operation was performed according to the kit instructions. Using the extracted total RNA as a template, first-strand cDNA was synthesized using the Novizan Reverse Transcription Kit (catalog number: R312).

[0039] 2. Primer design and PCR amplification According to the pepper genome database CaMYB121 The CDS sequence of the gene (Caz02g28840) was used to design specific amplification primers using Primer 6 software. The primer sequences are as follows: CaMYB121-F (SEQ ID NO:3): 5′- ATGGTAGCTATGATGGGGTG -3′; CaMYB121-R (SEQ ID NO:4): 5′-TTAGAAAATAAAACCTCCAT-3′.

[0040] Using the synthesized cDNA as a template, PCR amplification was performed. The total volume of the PCR reaction system was 50 μL, including 1 μL of cDNA, 2 μL each of primers, 25 μL of 2 × Phanta Max Master Mix (Dye Plus), and ddH2O to make up to 50 μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 40 s, and 72℃ final extension for 5 min, for 35 cycles.

[0041] 3. Product recovery and sequencing: After the PCR product is detected by 1% agarose gel electrophoresis, the target band is cut and recovered, ligated into the pEASY®-Blunt E1 Expression Vector (catalog number: CE111), transformed into DH5α Chemically Competent Cell (catalog number: TSC-C14), and single colonies are picked for sequencing verification.

[0042] 4. Result shows that the complete CDS sequence of the pepper CaMYB121 gene was successfully cloned, with a length of 774 bp, and its nucleotide sequence is shown in SEQ ID NO:1.

[0043] CaMYB121 The CDS sequence of the gene (Caz02g28840) is shown in SEQ ID NO:1.

[0044] SEQ ID NO:1 ATGGTAGCTATGATGGGGTGGGGAGCTAATTCTGATCAACAAGGATGGAGGAAAGGGCCTTGGACTCCTGAAGAGGATAAGATGCTTTCTGAGTACGTTAAGTTGCATGGTGAGGGAAGATGGAGTTCTGTAGCTCGATGTGCAGGTTTGAACAGGACGGGGAAGAGTTGCAGGCTCAGGTGGGTGAACTACTTGAGGCCTGGACTTAAAAGAGGCCACATAACACCTCAAGAGGAAGGCATTATTATTGAATTGCATGCCTTATGGGGCAACAAATGGTCAACTATAGCCCGTTACTTGCCAGGAAGGACAGATAACGAGATAAAAAATTACTGGAGGACACATTTCAAGAAGAAGGAAAAAGCTTCAGGAAAGCAAGACAAGAGGAAAATTATAAGACAGAAAAACCAACCACAACCAAACTGCACCATAGCCACGATTGATAAAAAGTTGTCACCTCAAGCAGAAGAAGTAGTGATCATGAAGAGTGATGACAGTAACGCGTATACTAATTATTACCATAAGAATATAATGGATCAGGATCCAGTTGTGGAATTGCCACCAGTGACAACTTGTTCAGACACATCGTATGCATGGACGGATACTTTTCTGATGGATGGTTTCTGGGGAGGATTATGGAACTTAGATGATCATTCACTGATGCAGGCAACTAATGACAAGTGCAAGGTGGCAAATATCCAAAATCAACCAGCTAATTGCACTTATGCAACTGATTATGCAGTTAACTTACATAATGGAGGTTTTATTTTCTAA Example 3: Salt-tolerant transcription factors CaMYB121 VIGS Silence and its Functional Verification 1. Materials and Methods (1) Construction of VIGS vector: According to CaMYB Based on the CDS sequence of gene 121, specific amplification primers CaMYB121-VIGS-F (SEQ ID NO:5) and CaMYB121-VIGS-R (SEQ ID NO:6) were designed.

[0045] CaMYB121-VIGS-F (SEQ ID NO:5): 5'-CTGTGAGTAAGGTTACCGAATTCGCAAGACAAGAGGAAAATTA-3' CaMYB121-VIGS-R (SEQ ID NO:6): 5'-CGCGTGAGCTCGGTACCGGATCCATTAGTTGCCTGCATCAGTG-3' SEQ ID NO:2 GCAAGACAAGAGGAAAATTATAAGACAGAAAAACCAACCACAACCAAACTGCACCATAGCCACGATTGATAAAAAGTTGTCACCTCAAGCAGAAGAAGTAGTGATCATGAAGAGTGATGACAGTAACGCGTATACTAATTATTACCATAA GAATATAATGGATCAGGATCCAGTTGTGGAATTGCCACCAGTGACAACTTGTTCAGACACATCGTATGCATGGACGGATACTTTTCTGATGGATGGTTTCTGGGGAGGATTATGGAACTTAGATGATCATTCACTGATGCAGGCAACTAAT Using the cDNA obtained in Example 2 as a template, the silencing target fragment shown in SEQ ID NO:2 was amplified by PCR. The amplified product was then double-digested with enzymes and inserted into the virus-induced gene silencing vector pTRV2, which had also been digested with the same enzymes, to construct the recombinant silencing vector pTRV2-CaMYB121. Empty pTRV2 was used as a negative control.

[0046] 2. Agrobacterium infection and plant treatment: Recombinant plasmid pTRV2-CaMYB121 and helper plasmid pTRV1 were transformed into Agrobacterium GV3101 competent cells, respectively. Equal volumes of the two positive Agrobacterium cultures were mixed and injected into the cotyledons of 'S8' pepper seedlings.

[0047] 3. Silencer efficiency detection: 3-4 weeks after inoculation, once new leaves have emerged, new leaves from both the control and experimental groups were collected, and total RNA was extracted. The expression level of the CaMYB121 gene was detected using real-time quantitative PCR (qRT-PCR) to verify the silencing efficiency. The pepper Actin gene was used as an internal control; the primer sequences are as follows. qCaMYB121-F (SEQ ID NO:7): 5'-TGTGCAGGTTTGAACAGGAC-3' qCaMYB121-R (SEQ ID NO:8): 5'-TGCCTTCCTCTTGAGGTGTT-3' qActin-F (SEQ ID NO:9): 5'-CGCCATACTGGTGGTGATGGT-3' qActin-R (SEQ ID NO:10): 5'-CCCAGTTGCTGACAATTCCG-3' The qRT-PCR reaction was performed on a real-time PCR instrument. The specific program was as follows: pre-denaturation at 95℃ for 30s; cycling reaction at 95℃ for 10s, 60℃ for 30 cycles for 40 times; the melting curve was acquired using the instrument's default melting curve acquisition program.

[0048] 4. Salt treatment and phenotypic observation: After successful verification of silencing efficiency, CaMYB121 Silent plants (pTRV2-CaMYB121) and negative control plants (pTRV2) were divided into two groups. One group was irrigated with 150 mM NaCl solution (salt stress), while the other group was watered normally (control). After 15 days of treatment, the overall phenotype of the plants was observed and photographed. Figure 2 A), measure root length and plant fresh weight.

[0049] 5. Experimental Results: (1) Verification of silencing efficiency: RT-qPCR results showed that, compared with the control plants injected with pTRV2, the silencing efficiency of plants injected with pTRV2-CaMYB121 was significantly lower. CaMYB121 The transcriptional level of genes decreased significantly. Figure 2 B) indicates that VIGS's silence was successful.

[0050] (2) Salt tolerance phenotype analysis: Under normal conditions, there was no significant difference in growth between silent plants and control plants. After 15 days of stress with 150 mM NaCl, CaMYB121 Silent plants exhibited a clear salt-sensitive phenotype: salt treatment inhibited root development in peppers and significantly reduced salt tolerance. Figure 2 A). Quantitative analysis of root length and plant weight showed that the root length and fresh weight of the silent plants under salt stress were significantly lower than those of the control plants. Figure 2 C). This result proves that silence... CaMYB121 The gene significantly reduced the salt tolerance of chili peppers.

[0051] Example 4: CaMYB121 Determination of proline and malondialdehyde content in silent plants Leaves from plants treated with 150 mM NaCl for 2 weeks in Example 3 were taken, and the following indicators were measured according to the relevant kit instructions: Proline (PRO) content: determined by spectrophotometry.

[0052] Malondialdehyde (MDA) content: determined by spectrophotometry.

[0053] The operating procedures were performed according to the instructions from Beijing Bosheng Biotechnology Co., Ltd. The specific process is as follows: 0.1 g of plant tissue was placed in an ice bath and homogenized with 1 mL of extraction buffer. The homogenate was treated in a boiling water bath for 10 minutes, then cooled to room temperature, and subsequently centrifuged at 10,000 × g for 10 minutes at room temperature. The supernatant was collected for subsequent analysis. Proline content was determined by absorbance measurement at 520 nm using a proline content detection kit (catalog number AKAM003M). Malondialdehyde (MDA) content was determined by absorbance measurement at 450 nm, 532 nm, and 600 nm using a MDA content detection kit (catalog number AKFA013M). Each treatment was performed in triplicate, with each replicate measured three times.

[0054] The results are as follows Figure 3 As shown, under normal growth conditions (without the addition of NaCl). CaMYB121 There were no significant differences in PRO content and MDA levels between silent plants and negative control plants. However, after treatment with 150 mM NaCl for 2 weeks, CaMYB121 The PRO content in silent plants was significantly higher than that in the negative control group. Figure 3 A) indicates that silent plants accumulated more osmotic regulators to cope with salt stress. Meanwhile, CaMYB121 The MDA level in silent plants was also significantly higher than that in the negative control group. Figure 3 B).

[0055] The above results further confirm that CaMYB121 Silence weakens the pepper plant’s tolerance to salt stress, causing the plant to suffer more severe osmotic stress and oxidative damage under salt stress.

[0056] Example 5: CaMYB121 Na in silent plants + and K + Measurement Tissues from the CaMYB121 silent plants and negative control plants treated with 150 mM NaCl for one week in Example 3 were collected from roots, stems, and leaves, respectively. The tissues were washed with deionized water, dried, and ground. Atomic absorption spectrometry was used to determine the Na content in each part. + and K + Ion concentration, and calculate Na + / K + Each treatment group should have at least three biological replicates.

[0057] The results are as follows Figure 4 As shown, under salt stress conditions, compared with the negative control plants, CaMYB121 Na in the roots, stems, and leaves of silent plants + The concentrations of all samples increased significantly, while K... + The concentrations of Na in all tissues decreased significantly, leading to a decrease in Na2 concentration. + / K + This indicates a significant imbalance. CaMYB121 Genes play a crucial role in maintaining ion homeostasis within pepper cells, particularly in reducing Na+. + Accumulate and maintain K + It plays a key role in maintaining stability.

[0058] Example 6: Salt-tolerant transcription factors CaMYB121 Heterologous expression and functional validation in yeast Two transgenic yeast strains were constructed: coding sequences (CDSs) were cloned into the EcoRI and BamHI sites of the pYES2 vector, and the plasmids were transformed into yeast strain INVSC1 using the lithium acetate method. Strains carrying the CaMYB121 gene or the empty pYES2 vector (control group) were screened and cultured on SD-Ura solid medium for 2-3 days, and positive colonies were selected for qRT-PCR analysis. Validated positive clones from the experimental and negative control groups were cultured in SD-Ura liquid medium until the OD600 reached 0.2, followed by serial dilutions (10⁻⁶ oz / mL). 0 10 -1 10 -2 The transgenic strains were seeded on SG-Ura solid medium plates containing different salt concentrations and cultured for 7 days. The growth performance of the transgenic strains and control strains was evaluated.

[0059] The results are as follows Figure 5 As shown, under normal conditions (0M NaCl), carrying CaMYB121 No growth difference was observed between yeast cells carrying the empty vector and those carrying the empty vector. However, under salt stress, yeast cells carrying the empty vector pYES2 failed to grow at a sodium chloride concentration of 1.3 M, while those overexpressing the empty vector pYES2 failed to grow. CaMYB121 Yeast cells can grow normally at this concentration. These results indicate that... CaMYB121This enhanced the salt tolerance of the transgenic yeast. In summary, our findings suggest... CaMYB121 This gene has a positive regulatory function on salt tolerance in chili peppers, and salt-tolerant chili pepper materials can be bred by overexpressing this gene. Furthermore, the results of this embodiment also indicate that... CaMYB121 Yeast cells expressing the gene showed significantly better growth than control cells on high-concentration sodium chloride medium. This result clearly demonstrates that the yeast heterologous expression system and detection method provided by this invention can be effectively used to verify and evaluate [the gene]. CaMYB121 Salt tolerance function of genes. This method is simple to operate, quick to complete, and yields reliable results, providing strong theoretical and experimental basis for further in-depth functional studies in plants.

[0060] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0061] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A type of chili pepper CaMYB121 The application of genes in regulating salt tolerance in pepper plants is characterized by, The chili pepper CaMYB121 The CDS sequence of the gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, By promoting or enhancing the chili pepper CaMYB121 Gene expression is used to improve the salt tolerance of chili pepper plants.

3. The application according to claim 1, characterized in that, By inhibiting or reducing the chili pepper CaMYB121 Gene expression is used to reduce the salt tolerance of chili pepper plants.

4. A method for cultivating chili peppers with improved salt tolerance, characterized in that, Including increasing the pepper content in pepper plants CaMYB121 The expression level of the gene, the CDS sequence of the pepper CaMYB121 gene is shown in SEQ ID NO:

1.

5. The method according to claim 4, characterized in that, By containing chili peppers CaMYB121 A gene expression vector was introduced into pepper plants, and the gene was overexpressed to improve the pepper's nutritional value. CaMYB121 Gene expression levels.

6. A method for verifying chili peppers CaMYB121 A method for the function of genes in salt tolerance, characterized in that, Includes the following steps: (1) Take the chili peppers as shown in SEQ ID NO:1 CaMYB121 The gene was constructed into a yeast expression vector and transformed into a yeast strain; (2) The transgenic yeast strain obtained in step (1) and the control yeast strain were cultured under salt stress conditions respectively; (3) Compare the growth of the two strains. If the growth of the transgenic yeast strain is better than that of the control, it indicates that the chili pepper is superior. CaMYB121 The gene has the function of increasing salt tolerance.

7. A method for reducing the salt tolerance of chili pepper plants, characterized in that, Reduce the amount of peppers in pepper plants CaMYB121 The expression level of the gene or the activity of the protein encoded by the gene, in the chili pepper CaMYB121 The CDS sequence of the gene is shown in SEQ ID NO:

1.

8. A gene silencing method for studying salt tolerance in chili peppers, characterized in that, Reduce the amount of peppers in pepper plants CaMYB121 The expression level of the gene in the chili pepper CaMYB121 The CDS sequence of the gene is shown in SEQ ID NO:

1.

9. The method according to claim 7 or 8, characterized in that, The chili pepper was reduced using virus-induced gene silencing technology. CaMYB121 Gene expression levels, wherein the silencing vector used contains a nucleotide sequence as shown in SEQ ID NO:

2.

10. The application according to any one of claims 1-3 or the method according to any one of claims 4-9, characterized in that, The salt tolerance refers to the tolerance to sodium salt stress, where the concentration of the sodium salt stress is 100-200 mM sodium chloride.