A method for preparing dwarf corn

Abstract

This disclosure pertains to the field of plant genetic engineering. Specifically, it relates to mutant ZmBr2 nucleic acid and mutant ZmBr2 protein, and provides a method for improving plant traits, as well as a kit for improving plant traits. The method provided in this disclosure, by expressing gene-editing tools in maize, can successfully introduce a stop codon into the ZmBr2 gene in advance, precisely creating truncated variants of the ZmBr2 protein, obtaining maize mutants with reduced plant height and ear height. This facilitates the breeding or preparation of new lodging-resistant, densely planted, dwarf, high-yielding maize varieties, as well as the improvement of existing varieties, which has significant application value for breeding work.

Description

[0001] Priority and related applications

[0002] This application claims priority to Chinese Patent Application No. 202510945140.4, filed on July 9, 2025. The entire contents of the above-cited patent application are incorporated herein by reference. Technical Field

[0003] This invention relates to the field of plant genetic engineering, specifically to a method for preparing dwarf corn. Background Technology

[0004] Corn, as one of the world's most important food crops, is considered one of the "world's three major staple foods" along with wheat and rice, and is widely cultivated globally. As a vital food source for humanity, corn provides essential energy and nutrition to billions of people worldwide. It is rich in carbohydrates, protein, vitamins, and minerals, and can be processed into a variety of foods, such as corn flour, corn flakes, and corn oil, to meet diverse dietary needs. Corn is also an indispensable feed ingredient for livestock, with approximately 70% to 80% of corn production used for animal feed. It provides livestock with abundant energy, playing a crucial role in promoting animal growth and increasing meat and dairy production, thus ensuring a stable global supply of meat and dairy products, earning it the title of "King of Feed." Furthermore, corn plays a significant role in the industrial sector, with a wide range of applications, including the production of starch, alcohol, fuel ethanol, and bioplastics. In particular, the production of fuel ethanol helps reduce dependence on traditional fossil fuels and lower greenhouse gas emissions, which is of profound significance for ensuring energy security and environmental protection.

[0005] In recent years, the global corn planting area has shown a steady upward trend. According to the latest data, the global corn planting area has exceeded 190 million hectares, accounting for approximately 30% of the global grain planting area. Corn is one of the world's highest-yielding food crops. Given the continued growth in global demand for corn, increasing corn yield under limited land resources is particularly crucial. Over the past 90 years, although the yield per corn plant in the United States has not increased significantly, the yield per acre has increased more than sevenfold, mainly due to the breeding and promotion of high-density planting tolerant varieties. Plant height is a key factor affecting the breeding of high-density planting tolerant varieties. Appropriately reducing plant height can not only increase the number of plants per unit area and increase the total yield per unit area, but also effectively prevent lodging, which is crucial for enhancing the plant's tolerance to high density and lodging resistance. Therefore, the genetic improvement of plant height traits to dwarf the plant has become an important direction in the field of corn breeding.

[0006] Plant height is a complex quantitative trait controlled by multiple genes. Currently, over 60 genes related to maize dwarfing have been reported both domestically and internationally. These genes mainly involve processes such as the synthesis, metabolism, and signal transduction of different types of hormones. However, only a small number of the reported dwarfing genes can be directly applied to maize dwarfing breeding. Summary of the Invention

[0007] Therefore, the technical problem to be solved by the present invention is to provide a method for preparing dwarf corn.

[0008] Therefore, the present invention provides the following technical solution:

[0009] In a first aspect, embodiments of the present invention provide a mutant maize endogenous dwarf 2 (ZmBr2) nucleic acid, characterized in that the CDS sequence of the mutant ZmBr2 nucleic acid, relative to the CDS sequence of the parental ZmBr2 nucleic acid, undergoes base substitution, insertion and / or deletion in the region corresponding to the target sequence shown in SEQ ID NO:23.

[0010] For example, “base substitution, insertion and / or deletion occurring in the region corresponding to the target sequence shown in SEQ ID NO:23” includes base substitution, insertion, deletion or combination mutation at any position in the region corresponding to the target sequence shown in SEQ ID NO:23.

[0011] In the exemplary embodiments provided in this disclosure, the type of base substitution is replacing base G with base A.

[0012] In an exemplary embodiment provided in this disclosure, the mutation comprises replacing the G base at positions 5, 7, 11, 15, 16 and / or 20 of the target sequence shown in SEQ ID NO:23 with the A base.

[0013] In an exemplary embodiment provided in this disclosure, the mutation includes replacing the G bases at positions 15 and 16 of the target sequence shown in SEQ ID NO:23 with the A base.

[0014] In an exemplary embodiment provided in this disclosure, the mutation includes a base insertion based on the replacement of the G bases at positions 15 and 16 of the target sequence shown in SEQ ID NO:23 with the base A. The base insertion corresponds to the insertion of three bases “CGC” between the T base at position 9 and the C base at position 10 of the target sequence shown in SEQ ID NO:23.

[0015] In the exemplary embodiments provided in this disclosure, the base deletion corresponds to the deletion of bases 4-20 in the target sequence shown in SEQ ID NO:23.

[0016] In the exemplary embodiments provided in this disclosure, the mutated target sequence includes any of the sequences shown in SEQ ID NO:24-29.

[0017] In the exemplary embodiments provided in this disclosure, the mutated Zmbr2 nucleic acid contains the sequence shown in SEQ ID NO:4, 30, 32, 34, 36 or 38.

[0018] In a second aspect, embodiments of the present invention provide a mutant ZmBr2 protein, characterized in that the protein is encoded by the mutant Zmbr2 nucleic acid described in any one of the first aspects.

[0019] In the exemplary embodiments provided in this disclosure, the protein comprises the amino acid sequence shown in SEQ ID NO:5, 31, 33, 35, 37 or 39.

[0020] Thirdly, embodiments of the present invention provide a polynucleotide, characterized in that the polynucleotide comprises the mutant Zmbr2 nucleic acid described in any one of the first aspects.

[0021] For example, the polynucleotide described in the embodiments of the present invention is an isolated polynucleotide. Biological samples and maize by-products comprising any of the above polynucleotides are also provided. In some embodiments, the by-products are processed products made from maize plants with a mutated Zmbr2 gene or their seeds, including: (a) maize meal (defatted or non-defatted); (b) extracted maize protein, oil, sugar, syrup, and starch; (c) maize fermentation products; (d) maize-based animal feed or human food (e.g., feed and food containing maize meal); (e) pharmaceuticals; (f) unprocessed or processed biomass (e.g., cellulose and / or lignocellulose materials; silage); and (g) various industrial products.

[0022] Fourthly, embodiments of the present invention provide the application of the mutant Zmbr2 nucleic acid described in any of the first aspects or the mutant ZmBr2 protein described in any of the second aspects in improving plant traits, wherein the plant trait is reduced plant height or ear height, and the plant is maize.

[0023] Fifthly, embodiments of the present invention provide a method for obtaining dwarf maize, characterized in that it includes modifying all or part of the cells of a parent plant through breeding methods to cause base deletion, addition, or substitution in the endogenous ZmBr2 gene of the plant, thereby obtaining a maize plant containing the mutant Zmbr2 nucleic acid described in any one of the first aspects; the plant is maize.

[0024] In the exemplary embodiments provided in this disclosure, the breeding method includes gene editing, physical mutagenesis, and / or chemical mutagenesis.

[0025] The exemplary embodiments provided in this disclosure include the following steps:

[0026] a) Using gene editing tools to perform gene editing in maize cells, maize seeds, maize tissues or maize parts to obtain gene-edited maize cells, maize seeds, maize tissues or maize parts;

[0027] b) Regenerate the gene-edited maize cells, maize seeds, maize tissues, or maize parts described in step a) to obtain maize plants;

[0028] The gene editing tools include CRISPR / Cas nucleases or their derivatives, zinc finger nucleases ZFNs or their derivatives, transcription activator-like effectors TALEs or their derivatives; and / or sgRNAs or their derivatives targeting the ZmBr2 gene.

[0029] In the exemplary embodiments provided in this disclosure, the CRISPR / Cas nuclease or its derivative tools include a base editor, which includes the A3A-PBE plant base editor or the QBEmax base editor.

[0030] In the exemplary embodiments provided in this disclosure, the base editor is a QBEmax base editor, and the amino acid sequence of the QBEmax base editor is shown in SEQ ID NO:6.

[0031] In the exemplary embodiments provided in this disclosure, the spacer sequence of the sgRNA is shown as any one of SEQ ID NO:7-11.

[0032] In the exemplary embodiments provided in this disclosure, the spacer subsequence of the sgRNA is shown in SEQ ID NO:8.

[0033] In the exemplary embodiments provided in this disclosure, the sgRNA derivatives include recombinant vectors or recombinant cells containing the sgRNA.

[0034] In a sixth aspect, embodiments of the present invention provide a kit for obtaining dwarf maize, characterized in that it includes a method for causing base deletion, addition, or substitution in the endogenous ZmBr2 gene of the plant to obtain maize plants containing the mutant Zmbr2 nucleic acid described in any one of the first aspects; the plant is maize.

[0035] In the exemplary embodiments provided in this disclosure, the products include gene editing, physical mutagenesis, and / or chemical mutagenesis products.

[0036] In an exemplary embodiment provided in this disclosure, the gene editing product includes a QBEmax base editor and sgRNA; the amino acid sequence of the QBEmax base editor is shown in SEQ ID NO:6; and the spacer sequence of the sgRNA is shown in SEQ ID NO:8.

[0037] In the exemplary embodiments provided in this disclosure, the sgRNA derivatives include recombinant vectors or recombinant cells containing the sgRNA.

[0038] In a seventh aspect, embodiments of the present invention provide a method for producing maize progeny seeds, characterized in that it includes:

[0039] The first corn plant was crossed with the second corn plant;

[0040] Wherein, both the first corn plant and the second corn plant contain the mutant Zmbr2 nucleic acid as described in any one of the first aspects or the mutant ZmBr2 protein as described in any one of the second aspects;

[0041] Wherein: (i) the first corn plant is a female parent and the second corn plant is a male parent; or (ii) the second corn plant is a female parent and the first corn plant is a male parent; and one or more corn offspring seeds are harvested from the female parent.

[0042] In an exemplary embodiment provided in this disclosure, the male parent contains the mutant Zmbr2 nucleic acid shown in SEQ ID NO:4, and the female parent contains the mutant Zmbr2 nucleic acid shown in any one of SEQ ID NO:30, 32, 34, 36 or 38.

[0043] In the exemplary embodiments provided in this disclosure, both the first corn plant and the second corn plant are non-GMO corn plants.

[0044] In the exemplary embodiments provided in this disclosure, the endogenous ZmBr2 gene or its allele in the offspring seeds contains the mutant Zmbr2 nucleic acid as described in any of the first aspects.

[0045] In an exemplary embodiment provided in this disclosure, the method further includes planting the offspring seeds and obtaining offspring plants, wherein the offspring plants are hybrid maize plants and exhibit reduced plant height or ear height.

[0046] Eighthly, embodiments of the present invention provide a dwarf corn variety, characterized in that it comprises the mutant Zmbr2 nucleic acid as described in any of the first aspects, or the mutant ZmBr2 protein as described in any of the second aspects, or the recombinant vector as described in the third aspect; or is obtained by the method described in any of the fifth aspects; or is obtained by the kit described in any of the sixth aspects; or is obtained by the method described in any of the seventh aspects.

[0047] In the exemplary embodiments provided in this disclosure, the dwarf corn is corn seed, plant, pollen, embryo, endosperm, ear, kernel, leaf, root, stem, anther, tissue culture or cell.

[0048] The technical solution of this invention has the following advantages:

[0049] 1. The T9 target site in exon 5 of the maize ZmBr2 gene was discovered and verified for the first time as a preferred target site for efficient editing using the QBEmax base editor, which can efficiently obtain stop codon mutations;

[0050] 2. By performing specific base substitution, insertion, or deletion mutations on the ZmBr2 gene, ZmBr2 protein truncated variants can be precisely created, thereby obtaining dwarf maize materials with significantly reduced plant height and ear height.

[0051] 3. The obtained Zmbr2 mutation can be stably inherited and can be screened to obtain non-transgenic edited materials without exogenous editing vector sequences, thereby improving maize plant type while maintaining good agronomic traits and yield potential.

[0052] definition:

[0053] In this document, unless otherwise stated, scientific and technical terms used have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are widely used terms and routine procedures in their respective fields. For example, standard recombinant DNA and molecular cloning techniques used in this disclosure are well known to those skilled in the art and are described more fully in the following literature: Sambrook, J., Fritsch, EF, and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter referred to as "Sambrook"). Meanwhile, for a better understanding of this disclosure, definitions and explanations of relevant terms are provided below.

[0054] As used herein, the term “and / or” covers all combinations of items connected by the term and should be regarded as if each combination had been listed separately herein. For example, “A and / or B” covers “A,” “A and B,” and “B.” For example, “A, B, and / or C” covers “A,” “B,” “C,” “A and B,” “A and C,” “B and C,” and “A and B and C.”

[0055] As used herein, the terms "comprising," "including," and "including" should be understood to mean having at least the features referred to therein, while not excluding any other unspecified features.

[0056] As used in this article, the term "plant" includes the entire maize plant, whether immature or mature, including maize seeds, plants, pollen, embryo, endosperm, ears, kernels, leaves, roots, stems, anthers, tissue cultures, cells, or any plant from which seeds, kernels, or anthers have been removed. Any seed or embryo that can produce a plant is also considered a maize plant.

[0057] As used in this article, the terms “gene” and “genome” encompass not only chromosomal DNA, which is present in the cell nucleus, but also organelle DNA, which is present in subcellular components of the cell, such as mitochondria and plastids.

[0058] "Genetically modified organism" or "genetically modified cell" refers to an organism or cell whose genome contains exogenous polynucleotides or modified genes or expression regulatory sequences. For example, exogenous polynucleotides can be stably integrated into the genome of an organism or cell and inherited across generations. Exogenous polynucleotides can be integrated into the genome alone or as part of a recombinant DNA construct. Modified genes or expression regulatory sequences are sequences in the genome of an organism or cell that contain single or multiple deoxynucleotide substitutions, deletions, and additions.

[0059] As used herein, “polynucleotide,” “nucleic acid sequence,” “nucleotide sequence,” “DNA sequence,” or “nucleic acid fragment” are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or modified nucleotide bases. Nucleotides are designated by their single-letter names as follows: “A” for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), “C” for cytidine or deoxycytidine, “G” for guanosine or deoxyguanosine, “U” for uridine, “T” for deoxythymidine, “R” for purine (A or G), “Y” for pyrimidine (C or T), “K” for G or T, “H” for A, C, or T, “I” for inosine, and “N” for any nucleotide.

[0060] As used herein, the terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” are used interchangeably to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” may also include modified forms, including but not limited to glycosylation, lipid linkage, sulfation, γ-carboxylation, hydroxylation, and ADP-ribosylation of glutamate residues.

[0061] Sequence “identity” has a generally accepted meaning in the art, and the percentage of sequence similarity between two nucleic acid or polypeptide molecules or regions can be calculated using publicly available techniques. Sequence similarity can be measured along the full length of a polynucleotide or polypeptide or along a region of that molecule. (See, for example: Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., Stockton Press, New York, 1991). Although there are many methods for measuring the similarity between two polynucleotides or polypeptides, the term "similarity" is well known to those skilled in the art (Carrillo, H. & Lipman, D., SIAM J Applied Math 48:1073 (1988)).

[0062] In peptides or proteins, suitable conserved amino acid substitutions are known to those skilled in the art and can generally be performed without altering the biological activity of the resulting molecule. Typically, those skilled in the art recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter its biological activity (see, for example, Watson et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin / Cummings Pub.co., p. 224).

[0063] As used herein, a "promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of this disclosure, a promoter is a promoter capable of controlling gene transcription in a cell, regardless of whether it originates from the cell. A promoter can be a constitutive promoter, a tissue-specific promoter, a developmental regulatory promoter, or an inducible promoter.

[0064] As used herein, "sample" or "sample" refers to whole or incomplete corn plant tissue (e.g., ground corn seeds or corn plant tissue, chopped corn plant tissue, or freeze-dried tissue). It may also be an extract containing whole or incomplete seeds or corn plant tissue. Biological samples may include flour, meal, syrup, oil, starch, and grains containing all or part of corn plant byproducts. In some embodiments, the biological sample is "non-renewable" (i.e., cannot be regenerated into soybean plant or soybean plant parts).

[0065] As used herein, "knockdown" refers to the artificial manipulation (e.g., genetic manipulation) that downregulates the expression and / or activity of a target gene (usually an endogenous target gene) in maize plants or cells relative to wild-type plants that have not undergone such manipulation. Expression can occur at the transcriptional or translational level. Knockdown of a target gene can result in a reduction in its function. Knockdown of a target gene also includes, for example, mutating its encoded product (e.g., point mutations) that lead to a decrease in activity, such as biological activity.

[0066] As used herein, "knockout" refers to the artificial manipulation (e.g., genetic manipulation) that renders a target gene (usually an endogenous target gene) in soybean plants or cells substantially non-expressed relative to wild-type plants that have not undergone such manipulation; that is, substantially no functional expression product is produced, and / or a substantially non-functional product is expressed. Expression can occur at the transcriptional or translational level. Knockout of a target gene can result in loss of its function. Knockout of a target gene also includes, for example, mutating its encoded product (e.g., point mutation) to result in loss of activity, such as biological activity.

[0067] As used in this article, the maize Brachytic2 gene, abbreviated as ZmBr2 gene or Br2 gene, is a gene encoding an ATP-binding cassette (ABC) transporter that mainly regulates the polar transport of auxin in maize stalks and plays a key role in plant morphogenesis (Li X, Chen Y, Zhang L, et al. Brachytic2 mutation is ableto counteract the main pleiotropic effects of brown midrib3 mutant in maize[J]. BMC Plant Biology, 2022, 22 (1): 1-16.). The exemplary wild-type ZmBr2 gene in this article is shown in SEQ ID NO: 1 and its homologous genes, and the CDS sequence of the wild-type ZmBr2 gene is shown in SEQ ID NO: 2.

[0068] As used in this article, “reduced Zmbr2 gene expression” refers to a mutation that reduces gene function but does not completely eliminate it compared to the unmutated or wild-type allele.

[0069] As used herein, "mutation" can be any type of base substitution, for example, replacing base G with base A; "mutation" can also be an increase of 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 15 bp, 20 bp, 25 bp or more in the location of DNA double-strand breaks in the Zmbr2 genome compared to the wild type; "mutation" can also be a decrease of 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 15 bp, 20 bp, 25 bp or more in the location of DNA double-strand breaks in the Zmbr2 genome compared to the wild type.

[0070] As used herein, "mutated" or "edited" refers to a variant of the ZmBr2 protein that is precisely truncated by mutating the endogenous maize ZmBr2 gene. In some embodiments, this mutation results in the expression of the protein shown in SEQ ID NO:5, 31, 33, 35, 37, or 39 of the Zmbr2 gene.

[0071] In some implementations, maize plants with the mutant Zmbr2 gene, compared to their wild-type counterparts, exhibit reduced plant height or ear height while maintaining essentially the same yield per plant, resulting in greater lodging resistance. Plant height can be reduced by at least 30%, 40%, 50%, 60%, or 70%; ear height can be reduced by at least 60%, 70%, 80%, 85%, or 90%.

[0072] As used in this article, “trait” refers to the physiological, morphological, biochemical, or physical characteristics of a cell or organism.

[0073] As used in this article, "agronomic traits" specifically refer to measurable parameters of crop plants, including but not limited to: leaf greenness, grain yield, growth rate, total biomass or accumulation rate, fresh weight at maturity, dry weight at maturity, fruit yield, seed yield, total nitrogen content of plants, nitrogen content of fruits, nitrogen content of seeds, nitrogen content of plant vegetative tissues, total free amino acid content of plants, free amino acid content of fruits, free amino acid content of seeds, free amino acid content of plant vegetative tissues, total protein content of plants, protein content of fruits, protein content of seeds, protein content of plant vegetative tissues, herbicide resistance and drought resistance, nitrogen uptake, root lodging, harvest index, stem lodging, plant height, ear height, ear length, disease resistance, cold resistance, salt tolerance, and tiller number, etc.

[0074] As used herein, “gene editing tools” include RNA-dependent DNA endonucleases or base editing tools. In some embodiments, the base editing tools disclosed herein may be selected from the QBEmax base editing system (see patent CN119591727A, whose expressed QBEmax amino acid sequence is shown in SEQ ID NO:6).

[0075] If any definition in the foregoing is inconsistent with any definition in any patent or non-patent reference cited herein, or in any other patent or non-patent reference elsewhere, it shall be understood that the foregoing definition will be used herein. Attached Figure Description

[0076] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0077] Figure 1 This is the linear spectrum of the A3A-PBE expression vector;

[0078] Figure 2 This is the linear spectrum of the QBEmax expression vector;

[0079] Figure 3 This is a verification of target site editing efficiency;

[0080] Figure 4 This is a diagram showing the binding positions of PCR primers in the target gene sequence;

[0081] Figure 5 These are the results of agarose gel electrophoresis analysis of 4CV-mu1 T0 generation plants and wild-type plants;

[0082] Figure 6 These are sequencing results from 4CV-mu1 T0 generation plants and wild-type plants;

[0083] Figure 7 These are the results of agarose gel electrophoresis analysis of 4CV-mu1 T1 generation plants and wild-type plants;

[0084] Figure 8 These are sequencing results from 4CV-mu1 T1 generation plants and wild-type plants;

[0085] Figure 9 These are the results of residual testing of carrier components in 4CV-mu1 T1 generation plants and wild-type plants;

[0086] Figure 10 The results are from agarose gel electrophoresis analysis of 6WC-mu1~5 T0 generation plants and wild-type plants;

[0087] Figure 11 These are sequencing results from 6WC-mu1~5 T0 generation plants and wild-type plants;

[0088] Figure 12 The results are from agarose gel electrophoresis analysis of 6WC-mu1~5 T1 generation plants and wild-type plants.

[0089] Figure 13 These are sequencing results from 6WC-mu1~5 T1 generation plants and wild-type plants;

[0090] Figure 14 These are the test results for residual carrier components in 6WC-mu1~5 T1 generation plants and wild-type plants;

[0091] Figure 15 These are photographs of plant height and ear phenotype of the 4CV-mu1 and 6WC-mu1~5 mutants and their corresponding control materials (top: differences in plant height and ear position; bottom: comparison of ear appearance).

[0092] Figure 16 It is the field phenotype of AI335. Detailed Implementation

[0093] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.

[0094] For experiments not specifically described in the examples, the procedures or conditions should be followed according to the conventional experimental procedures described in the literature in this field. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.

[0095] Example 1: Target Site Design

[0096] This invention has found that editing the maize endogenous gene brachytic2 (ZmBr2) to create a stop codon causes premature termination of the ZmBr2 gene, resulting in a maize mutant with reduced plant height. The type of editing (e.g., replacing C with T or G with A) and the location of the substitution significantly affect editing efficiency and the creation of the stop codon, thus impacting the plant trait—reduced plant height. Therefore, this embodiment screened the editing types. Details are as follows:

[0097] (a) Target design

[0098] Using the maize B73 genome as a reference gene, the gene structure information of the ZmBr2 target gene (see SEQ ID NO:1, its CDS nucleotide sequence is shown in SEQ ID NO:2, and the encoded amino acid sequence is shown in SEQ ID NO:3) was obtained through genome annotation. Gene homology analysis was performed using the Gramene database. By searching for the gene locus ID, homologous genes of the target gene were found in the paralogues entry (https: / / ensembl.gramene.org / Zea_mays / Info / Index).

[0099] The genomic sequence, CDS sequence, and amino acid sequence of ZmBr2 from the maize inbred line PH4CV were selected for target site design. This invention selected the fifth exon of the ZmBr2 gene as the target region for editing, and designed five target sites within this region. Table 1 shows the five designed target sites, and Table 2 shows the corresponding gRNAs for the five designed target sites.

[0100] Table 1. Target site sequences

[0101]

[0102] Table 2: Zmbr2 gene gRNA design

[0103]

[0104] (II) Carrier Synthesis

[0105] The sgRNA from step (I) was ligated into the backbone of the base editing tool vector using a cleavage-ligation method to obtain a recombinant expression vector containing the base editing system and each gRNA. The base editing tool vectors selected were the A3A-PBE plant base editing system (see Ji X, Si X, Zhang Y, Zhang H, Zhang F, Gao C. Conferring DNA virus resistance with high specificity in plants using virus-inducible genome-editing system. Genome Biol. 2018 Nov 15;19(1):197.) and the QBEmax base editing system (see patent CN119591727A, whose expressed QBEmax amino acid sequence is shown in SEQ ID NO:6). The reaction system is shown in Table 3 below, and the reaction procedure is shown in Table 4 below. The obtained recombinant vectors were then subjected to routine transformation, screening, and sequencing to obtain recombinant expression vectors containing the base editing system and each gRNA with correct sequences. The linear maps of the expression vectors containing the A3A-PBE base editor and QBEmax base editor with sgRNA are shown below. Figure 1-2 .

[0106] Table 3: Reaction System

[0107]

[0108] Table 4: Enzyme digestion and ligation reaction procedure:

[0109]

[0110] (III) Verification of Editing Efficiency

[0111] Recombinant expression vectors containing the base editing system and various gRNAs were transformed into maize protoplasts. The resulting maize protoplasts were then used to test the editing efficiency of the target sites using next-generation sequencing. The results are as follows: Figure 3As shown in the figure, taking T8 as an example, C1 represents the first C at the target site of T8, and so on. The vertical axis represents the efficiency of C being replaced with T after base editing. Since the PAM "NGG" (N is any base) recognized by the base editor selected in this embodiment is located on the antisense strand of the gene, the detection results shown in this embodiment are all C>T editing on the antisense strand, which corresponds to G>A on the sense strand in the following text according to the base complementary pairing principle. In the protoplast editing efficiency results of A3A-PBE editing, it can be seen that the CT replacement efficiency of the T9 and T15 target sites is relatively high; in the protoplast editing efficiency results of QBEmax editing, the mutation efficiency of the T15 target site is very low, and only the editing efficiency of the T9 target site is still relatively high. Therefore, the present invention screened the T9 target site as the preferred mutation target site, and subsequent gene editing experiments were carried out in plants.

[0112] Example 2: Transformation of maize plants

[0113] Example 1 identified preferred gene editing targets in the maize variety PH4CV. In this example, the editing tool was transformed into maize plants for validation. Specifically, maize varieties PH4CV and PH6WC were selected for transformation experiments. The QBEmax gene editing vector targeting the T9 site from Example 1 was transformed into the recipient maize varieties PH4CV and PH6WC using Agrobacterium-mediated transformation. The specific steps are as follows:

[0114] (a) Transformation of Agrobacterium

[0115] The QBEmax gene editing vector targeting the T9 target site from Example 1 was transformed into Agrobacterium using conventional methods.

[0116] (II) Transformation of maize plants

[0117] 1) Sterilize the maize (varieties PH4CV or PH6WC), then remove the immature embryos as explants, and place the test tubes containing the explants on ice to wait for transformation.

[0118] 2) Take the bacterial suspension from step (1) and add culture medium for shaking. Activate the shaken bacterial suspension by streak plating. Then scrape off the Agrobacterium tumefaciens plate that has been activated at least twice consecutively and resuspend it in the infection solution. Heat the centrifuge tube with embryos from step 1) and then place it on ice. Change the infection solution, centrifuge, and then add bacterial suspension for infection.

[0119] 3) After removing the embryos and drying them, disperse them on a co-culture medium for co-culture. Carefully search for and remove explants contaminated with bacteria. Transfer intact and healthy embryos with the scutellum facing up to the recovery culture medium. Transfer intact and healthy embryos with the scutellum facing up to the selection culture medium to obtain callus tissue.

[0120] 4) Select vigorous embryogenic callus clones with a large population, induce more than 3 plants from the same clone, transfer the clone to a rooting tank with rooting medium, and after the explants grow roots, transplant them into plastic pots with nutrient soil. After one week, transfer the regenerated plants to the greenhouse for management.

[0121] Example 3: Obtaining T0 generation edited plants and identifying mutation types

[0122] (a) Identifying PH4CV mutant types

[0123] A *Agrobacterium*-mediated transformation method was used to transform the QBEmax gene editing vector targeting the T9 target site into recipient maize PH4CV. After glufosinate resistance selection, T0 generation plants were obtained. The target site editing type of the T0 generation plants was identified using targeted PCR and sequencing. Mutant plants with the expected editing at the target site were selected for self-pollination, and T1 generation seeds were harvested from individual plants. The harvested T1 generation seeds were then further cultivated in a greenhouse to obtain T1 generation plants. Genomic DNA was extracted from individual T1 generation plants, and the target gene editing type was identified using PCR and sequencing. The specific steps are as follows:

[0124] 1. Extraction of maize genomic DNA

[0125] Plant genomic DNA was extracted using the ammonium acetate method.

[0126] The extraction reagent formulations are shown in Table 5 below:

[0127] Table 5: Formulation of Plant Genomic DNA Extraction Reagents

[0128]

[0129] The specific steps are as follows:

[0130] (1) Take 10~100 mg of plant leaves, place them in a 2 mL centrifuge tube, and add 2 steel balls.

[0131] (2) After quick freezing with liquid nitrogen, grind the powder thoroughly in a grinder.

[0132] (3) Add 400 μl of LG Buffer1 to each tube.

[0133] (4) Add 200 μl of LG Buffer2 to each tube and shake well. Let stand at -20℃ for 10 min.

[0134] (5) Centrifuge at 12000 rpm for 15 min.

[0135] (6) Transfer 350 μl of supernatant to another clean 1.5 mL centrifuge tube, add 350 μL of isopropanol, mix thoroughly by inverting, and let stand at room temperature for 10 min.

[0136] (7) Centrifuge at 12000 rpm for 15 min.

[0137] (8) Discard the supernatant, add 500 μL of 75% ethanol, and shake thoroughly on a shaker.

[0138] (9) Centrifuge at 12000 rpm for 10 min.

[0139] (10) Discard the supernatant and invert the DNA to dry.

[0140] Dissolve the DNA in 60-100 μL of ddH2O and store at -20°C.

[0141] 2. Editing type identification

[0142] Using the obtained genome as a template, PCR amplification primers were designed based on the target sequence, as shown in Table 6 below.

[0143] Table 6. Primers used for detection are listed below.

[0144]

[0145] The binding sites of PCR amplification primers in the target gene sequence are as follows: Figure 4 As shown, the sequence of the target gene to be amplified (wild-type example) is as follows:

[0146] GCTACCTGCTCATCGGCATGTCCTCCGCGGCGCTGCTGTTCAACACGGTGCAGCACGTGTTCTGGGACACGGTGGGCGAGAACCTGACCAAGCGGGTGCGCGAGAAGATGTTCGCCGCCGTGCTCCGCAACGA GATCGCCTGGTTCGACGCGGACGAGAACGCCAGCGCGCGTGGCCGCCAGGCTAGCGCTGGACGCCCAGAACGTGCGCTCCGCCATCGGGGACCGCATCTCCGTCATCGTCCAGAACTCGGCGCTGA (see SEQ. ID NO:14)

[0147] Note: The sequence with a single underline is the position of the Br2-T9-F / Br2-T9-R primer pair, and the sequence with a wavy line is the target site sequence.

[0148] Preparation of PCR reaction solution: At room temperature, prepare the reaction solution by adding 2×Rapid Taq Master Mix, forward primer, reverse primer, and ddH2O in the correct proportions to a centrifuge tube and vortexing to mix, as shown in the table below:

[0149] Table 7. PCR Reaction System

[0150]

[0151] Table 8. PCR Reaction Procedure

[0152]

[0153] Note: N / A = Not applicable

[0154] Agarose gel electrophoresis: After PCR amplification, 3 μL of the amplification product was electrophoresed on a 1.0% agarose gel (1 g agarose was added to 100 mL of 1×TAE buffer, heated in a microwave oven until melted, and then 2 μL of StarGreen safe nucleic acid dye was added). The detection conditions were 100 V for 30 min. A low molecular weight DNA concentration gradient (DL5000) was used as the molecular weight standard.

[0155] Sanger sequencing: PCR amplification products with band sizes matching expectations are purified by agarose gel electrophoresis, and the target band is excised and sent to a sequencing company for Sanger sequencing. The sequencing results are compared with wild-type sequences to determine the sequence changes that occurred after the sample was edited.

[0156] The agarose gel electrophoresis results of the T0 generation plants are as follows: Figure 5 As shown (Note: M is the molecular weight standard DL5000 (lanes from top to bottom are 5,000, 3,000, 2,000, 1,500, 1,000, 750, 500, 250, 100 bp), lane 1 is the T0 generation gene-edited maize line 4CV-mu1-T0 (obtained by gene editing of wild-type PH4CV); lane 2 is the wild-type control PH4CV; lane 3 is the water control. Sequencing results are as follows...). Figure 6 As shown in the figure, the blue highlighted areas represent the sgRNA regions. PH4CV (top) is the wild-type control, and 4CV-mu1-T0 is the T0 generation gene-edited maize. As shown in the figure, two mutations occurred in the T0 generation gene-edited maize: GG>AA and G>A (the mutated sequences correspond to SEQ ID NO:29). The mutated 4CV-mu1-Zmbr2 CDS sequence is shown in SEQ ID NO:4. Figure 5 and Figure 6It can be seen that two mutations occurred in the target site region of T0 generation gene-edited maize, namely GG>AA and G>A (the specific locations are shown in the attached figure). Figure 6 (As shown in the red box). Analysis revealed that the aforementioned nucleotide mutation resulted in a stop codon mutation at position 888 of the expressed ZmBr2 protein, causing premature termination of protein translation. Its amino acid sequence is shown in SEQ ID NO:5.

[0157] In summary, the identified PH4CV mutant types are shown in Table 9 below. The mutation types are derived from the wild-type target sequence CAACGAGATCGCCTGGTTCG (SEQ ID NO:23).

[0158] Table 9. Types of PH4CV mutants

[0159]

[0160] (II) Identification of PH6WC mutant types

[0161] Following the same experimental procedures, the QBEmax gene editing vector targeting the T9 target site was transformed into the recipient maize PH6WC. After screening and identification, the types of PH6WC mutants identified are shown in Table 10 below:

[0162] Table 10. Mutation Types

[0163]

[0164] T0 generations of gene-edited maize plants 6WC-mu1, 6WC-mu2, 6WC-mu3, 6WC-mu4, and 6WC-mu5 were selected for individual plant editing type identification. PCR and sequencing results are attached. Figures 1-2 ).

[0165] Referring to the wild-type target sequence SEQ ID NO:8, the underlined sites in Table 10 are the base mutation sites.

[0166] In the T0 generation, the 6WC-mu1 underwent the expected editing, namely, the G bases at positions 5, 7, 11, 15, 16, and 20 of the target sequence were all replaced with the A base (corresponding to SEQ ID NO:24). The mutated 6WC-mu1-Zmbr2 CDS sequence is shown in SEQ ID NO:30, which causes the amino acid at positions 855-890 to be mutated from EIAWFD to KIT*FN, prematurely terminating protein translation and creating a Br2-truncation mutant, the amino acid sequence of which is shown in SEQ ID NO:31.

[0167] In the T0 generation, the 6WC-mu2 sequence underwent the expected editing, with the G bases at positions 5, 15, 16, and 20 of the target sequence being replaced with base A (corresponding to SEQ ID NO:25). The mutated 6WC-mu2-Zmbr2CDS sequence is shown in SEQ ID NO:32, resulting in the mutation of amino acids 855-890 from EIAWFD to KIA*FN, prematurely terminating protein translation and creating a mutant with a ZmBr2 truncation, the amino acid sequence of which is shown in SEQ ID NO:33.

[0168] In the T0 generation, the 6WC-mu3 underwent the expected editing, that is, the 15th-16th bases of the target sequence were replaced by AA instead of GG (corresponding to SEQ ID NO:26). The mutated 6WC-mu3-Zmbr2 CDS sequence is shown in SEQ ID NO:34, which leads to the mutation of tryptophan at position 888 into a stop codon, causing premature termination of protein translation and creating a mutant with ZmBr2 truncation, whose amino acid sequence is shown in SEQ ID NO:35.

[0169] In the T0 generation, the expected editing occurred in 6WC-mu4, with a deletion of 17 bp from bases 4 to 20 of the target sequence (corresponding to SEQ ID NO:27). The mutated 6WC-mu4-Zmbr2CDS sequence is shown in SEQ ID NO:36. Due to the frameshift mutation, the stop codon is located in the 3'-UTR of Zmbr2, and the extra bases at the end are part of the 3'-UTR sequence. A novel amino acid sequence mutant was created after amino acid position 883, and its amino acid sequence is shown in SEQ ID NO:37.

[0170] In the T0 generation, the 6WC-mu5 underwent the expected editing, with three bases "CGC" added between the 9th T base and the 10th C base in the target sequence, and the 15th-16th bases were replaced by AA instead of GG (corresponding to SEQ ID NO:28). The mutated 6WC-mu5-Zmbr2 CDS sequence is shown in SEQ ID NO:38, which causes the amino acid at positions 856-888 to be mutated from IAW to IAA*, resulting in premature termination of protein translation and the creation of a ZmBr2 truncated mutant, the amino acid sequence of which is shown in SEQ ID NO:39.

[0171] Example 4: Screening, genetic stability, and identification of exogenous vector-free T1 generation plants

[0172] The T0 generation edited plants 4CV-mu1 with a PH4CV background and 6WC-mu1~5 with a PH6WC background obtained in Example 3 were self-pollinated, and T1 generation seeds were harvested. The T1 generation seeds were sown to obtain T1 generation plants, and genomic DNA was extracted from each plant for vector residue detection and target site editing type detection.

[0173] (a) Detection of exogenous vector sequence in T1 generation plants

[0174] To obtain gene-edited plants without exogenous editing vector sequences, specific primers were designed for detection in the gRNA expression cassette, QBEmax editor expression cassette, and BAR region of the selection marker gene of the editing vector. Primer information is shown in Table 11.

[0175] Table 11. Specific Primers

[0176]

[0177] Twenty-one T1 generation dwarf maize plants were selected, and genomic DNA was extracted from the T1 generation plants using the method described in Example 3. The obtained genomic DNA was used as a template for PCR amplification using the primers shown in Table 11. The PCR reaction system and amplification procedure were performed according to the method in Example 3.

[0178] Taking 4CV-mu1 as an example, the detection results are as follows: Figure 9 As shown. When using Zmbr2 internal control primers for amplification, all samples obtained the expected amplification bands, indicating that the extracted genomic DNA quality met the detection requirements and the PCR system was functioning normally. When using vector-specific primers for amplification, the plasmid positive control was able to amplify the expected bands, while no amplification products were detected in the wild-type control and the water control. Further analysis of T1 generation plants revealed that some plants did not show any vector-related amplification bands (lanes 4, 6, 7, 8, 10, and 18), indicating that these plants did not contain detectable exogenous editing vector sequences. Plants in lane 4 were selected as an example for subsequent editing type detection and field trait verification.

[0179] Similarly, after testing, multiple mutant materials obtained in the PH6WC genetic background were screened to obtain plants carrying the target mutation and without detected exogenous editing vector sequences, as shown in the results. Figure 14As shown, no vector-related amplification bands were detected in plants in lanes 3, 4, 6, 9, 11, and 15 of 6WC-mu1; lanes 1, 2, 6, 9, 17, and 21 of 6WC-mu2; lanes 2, 6, 7, 11, and 15 of 6WC-mu3; lanes 1, 4, 6, 10, 11, and 12 of 6WC-mu4; and lanes 8, 9, 10, 17, 20, and 21 of 6WC-mu5, indicating that these plants do not contain detectable exogenous editing vector sequences. For example, lane 4 of 6WC-mu1, lane 6 of 6WC-mu2, lane 6 of 6WC-mu3, lane 11 of 6WC-mu4, and lane 9 of 6WC-mu5 were selected for subsequent editing type detection and field trait verification.

[0180] (II) Identification of Editing Types of T1 Generation Plants

[0181] Genomic DNA from plants selected in (a) without exogenous editing vector sequences was amplified by PCR and analyzed by Sanger sequencing using primers Br2-T9-F and Br2-T9-R.

[0182] 4CV-mu1 results are as follows Figure 7 and Figure 8 As shown, compared with wild-type PH4CV, the T1 generation plant 4CV-mu1-T1 still maintains the same editing type at the Zmbr2 target site as the T0 generation, namely, the occurrence of GG→AA and G→A mutations. The identification results of the T1 generation plants 6WC-mu1~5 are shown below. Figures 12-13 As shown, the editing type at the Zmbr2 target site remains consistent with that of the T0 generation. The results indicate that the Zmbr2 editing sites obtained in both maize varieties are stably inherited in offspring.

[0183] In summary, the method of this invention can obtain gene-edited maize materials carrying the Zmbr2 target mutation and without exogenous editing vector sequences, providing basic materials for subsequent breeding applications.

[0184] Example 5 Field trait verification

[0185] (a) Field screening of mutants

[0186] The experiment employed artificial sowing, a randomized block design, and three replicates; the net area of ​​each plot was 24 m² (5 m × 4.8 m), with 168 seeds sown per plot, and the designed density was 4500 plants / 667 m².

[0187] (II) Field identification of hybrid varieties

[0188] The experiment adopted a randomized block design with 3 replicates; the net area of ​​each plot was 12 m² (5 m × 2.4 m), 84 seeds were sown in each plot, and the design density was 4500 plants / 667 m².

[0189] (III) Survey Indicators and Statistical Analysis

[0190] Target traits, including plant height and ear position, were measured from 10 normal plants in each plot 10-30 days after silking, and the average value was calculated. The hybrid trials also investigated stem diameter, ear length, ear diameter, number of rows per ear, number of kernels per row, 100-kernel weight, and yield. All data were analyzed using one-way ANOVA, with significance determined at the α=0.05 level.

[0191] (iv) Mutant trait analysis and screening of preferred materials

[0192] 1. Comparison of 4CV-mu1 and PH4CV

[0193] The results are as follows Figure 15 As shown, 4CV-mu1 exhibited significant dwarfing compared to the PH4CV control. The plant height of 4CV-mu1 decreased from 217.18 cm to 136.72 cm, a reduction of approximately 37.05%; the ear position decreased from 71.22 cm to 16.67 cm, a reduction of approximately 76.59%, with both plant height and ear position showing significant reductions (Table 12).

[0194] Morphological investigation showed that 4CV-mu1 and PH4CV were generally consistent in terms of anthocyanin color intensity in filaments, anthocyanin color intensity in anthers, grain type, and anthocyanin color intensity in glumes of the rachis, with no obvious abnormal phenotypes observed. Regarding yield-related traits, 4CV-mu1 showed no significant difference in ear length and ear diameter compared to the control, but its yield per plant was significantly reduced; this result may be influenced by factors such as the genetic background of the inbred line and the expression of dwarf traits.

[0195] Overall, 4CV-mu1 exhibited a stable dwarf phenotype, and apart from changes in agronomic traits related to the target trait, the plants showed normal overall growth and development.

[0196] Table 12. Characteristic Survey of 4CV-mu1 and PH4CV

[0197]

[0198] Note: The data in the table are mean ± standard deviation. Different lowercase letters after the same indicator data indicate significant differences between different treatments (P < 0.05).

[0199] 2. Comparison of 6WC-mu1~6WC-mu5 with PH6WC

[0200] Compared with the PH6WC control, 6WC-mu1, 6WC-mu2, 6WC-mu3, 6WC-mu4, and 6WC-mu5 all showed significant dwarfing. The comparison results are as follows: Figure 15 As shown in Table 13, the plant height decreased by approximately 50.08%–63.60% and the ear position decreased by approximately 71.09%–81.97% for each material. The different degrees of dwarfing among different mutant genotypes indicate that different mutations of the same target site can lead to different plant height and ear position behaviors.

[0201] Table 13. Plant height and ear height of 6WC-mu1~6WC-mu5 and PH6WC

[0202]

[0203] Note: The data in the table are mean ± standard deviation. Different lowercase letters after the same indicator data indicate significant differences between different treatments (P < 0.05).

[0204] Morphological investigation showed no significant differences between 6WC-mu1~6WC-mu5 and PH6WC in anthocyanin color intensity in the filaments, anthocyanin color intensity in the anthers, grain type, and anthocyanin color intensity in the glumes of the rachis. (See attached photograph of ear morphology.) Figure 15 As shown, considering plant height, ear position, ear traits, and ease of subsequent production and application, 6WC-mu3 was identified as the preferred material in the 6WC-mu series.

[0205] Based on the stable dwarf target trait exhibited by 4CV-mu1 under the PH4CV background, and the moderate plant height, low ear position, and good yield-related traits exhibited by 6WC-mu3 in the 6WC-mu series mutants, 4CV-mu1 was selected as the preferred male parent candidate and 6WC-mu3 as the preferred female parent candidate, and hybridization combination tests were conducted.

[0206] Example 6: Testing of hybrids from preferred mutant combinations

[0207] A hybridization test was conducted using 6WC-mu3 as the female parent and 4CV-mu1 as the male parent to obtain 6WC-mu3×4CV-mu1 (named AI335). Xianyu 335, a hybridization of the corresponding wild-type parent PH6WC×PH4CV, was used as a control. The hybridization test was used to evaluate the performance of dwarfism in the hybrid offspring, changes in plant type-related agronomic traits, and yield-related traits.

[0208] The results are as follows Figure 16As shown, AI335 exhibited significant dwarfing compared to the control variety Xianyu 335. The plant height of AI335 decreased from 312.77 cm to 214.70 cm, a reduction of approximately 31.36%; the ear position decreased from 124.23 cm to 56.23 cm, a reduction of approximately 54.74%. This result indicates that the hybrids bred from the selected mutants still maintain stable dwarf and low ear position phenotypes (Table 14). The stem diameter of AI335 was 24.93 mm, while that of the control variety Xianyu 335 was 22.52 mm, an increase of approximately 10.70%, which was statistically significant (Table 14). The increased stem diameter, combined with the reduced plant height and ear position, is beneficial for enhancing plant mechanical strength and lodging resistance. Regarding related traits, there were no significant differences between AI335 and the control variety Xianyu 335 in yield, ear length, ear diameter, number of rows per ear, and number of kernels per row, with only a slight decrease in 100-kernel weight (Table 14).

[0209] In summary, the superior dwarf mutants obtained through gene editing and screening can achieve targeted and efficient improvement of maize plant type after being combined with hybrids, while fully preserving the overall yield potential and achieving a synergistic balance between dwarf lodging resistance and yield level.

[0210] Table 14. Characteristic Survey of AI335 and Control Xianyu 335

[0211]

[0212] Note: The data in the table are mean ± standard deviation. Different lowercase letters after the same indicator data indicate significant differences between different treatments (P < 0.05).

[0213] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A mutant maize endogenous dwarf 2 (Zmbr2) nucleic acid, characterized in that, The CDS sequence of the mutant Zmbr2 nucleic acid, relative to the CDS sequence of the parental ZmBr2 nucleic acid, exhibits base substitutions, insertions, and / or deletions in the region corresponding to the target sequence shown in SEQ ID NO:

23.

2. The mutant Zmbr2 nucleic acid according to claim 1, characterized in that, The base substitution type is to replace base G with base A.

3. The mutant Zmbr2 nucleic acid according to claim 2, characterized in that, The mutation involves replacing the G base at positions 5, 7, 11, 15, 16 and / or 20 of the target sequence shown in SEQ ID NO:23 with the A base.

4. The mutant Zmbr2 nucleic acid according to claim 3, characterized in that, The mutation involves replacing the G bases at positions 15 and 16 of the target sequence shown in SEQ ID NO:23 with the A base.

5. The mutant Zmbr2 nucleic acid according to claim 4, characterized in that, The base insertion corresponds to inserting three bases "CGC" between the 9th T base and the 10th C base of the target sequence shown in SEQ ID NO:

23.

6. The mutant Zmbr2 nucleic acid according to claim 1, characterized in that, The base deletion corresponds to the deletion of bases 4-20 in the target sequence shown in SEQ ID NO:

23.

7. The mutant Zmbr2 nucleic acid according to any one of claims 1-6, characterized in that, The mutated target sequence includes any of the sequences shown in SEQ ID NO:24-29.

8. The mutant Zmbr2 nucleic acid according to any one of claims 1-7, characterized in that, The mutant Zmbr2 nucleic acid contains the sequence shown in SEQ ID NO:4, 30, 32, 34, 36 or 38.

9. A mutant ZmBr2 protein, characterized in that, The protein is encoded by the mutant Zmbr2 nucleic acid as described in any one of claims 1-8.

10. The mutant ZmBr2 protein according to claim 9, characterized in that, The protein contains the amino acid sequence shown in SEQ ID NO:5, 31, 33, 35, 37 or 39.

11. A polynucleotide, characterized in that, The polynucleotide comprises the mutant Zmbr2 nucleic acid as described in any one of claims 1-8.

12. The use of the mutant Zmbr2 nucleic acid according to any one of claims 1-8 or the mutant ZmBr2 protein according to any one of claims 9-10 in improving plant traits, wherein the plant trait is reduced plant height or ear height, and the plant is maize.

13. A method for obtaining dwarf corn, characterized in that, This includes modifying all or part of the cells of the parent plant through breeding methods to cause base deletion, addition, or substitution in the endogenous ZmBr2 gene of the plant, thereby obtaining a maize plant containing the mutant ZmBr2 nucleic acid as described in any one of claims 1-8 or expressing the mutant ZmBr2 protein as described in any one of claims 9-10; the plant is maize.

14. The method according to claim 13, characterized in that, The breeding methods include gene editing, physical mutagenesis, and / or chemical mutagenesis.

15. The method according to claim 14, characterized in that, Includes the following steps: a) Using gene editing tools to perform gene editing in maize cells, maize seeds, maize tissues or maize parts to obtain gene-edited maize cells, maize seeds, maize tissues or maize parts; b) Regenerate the gene-edited maize cells, maize seeds, maize tissues, or maize parts described in step a) to obtain maize plants; The gene editing tools include CRISPR / Cas nucleases or their derivatives, zinc finger nucleases ZFNs or their derivatives, transcription activator-like effectors TALEs or their derivatives; and / or sgRNAs or their derivatives targeting the ZmBr2 gene.

16. The method according to claim 15, characterized in that, The CRISPR / Cas nuclease or its derivatives include a base editor, which includes the A3A-PBE plant base editor or the QBEmax base editor.

17. The method according to claim 16, characterized in that, The base editor is a QBEmax base editor, and the amino acid sequence of the QBEmax base editor is shown in SEQ ID NO:

6.

18. The method according to any one of claims 15-17, characterized in that, The spacer sequence of the sgRNA is shown in any one of SEQ ID NO:7-11.

19. The method according to claim 18, characterized in that, The spacer sequence of the sgRNA is shown in SEQ ID NO:

8.

20. The method according to claim 18 or 19, characterized in that, The sgRNA derivatives include recombinant vectors or recombinant cells containing the sgRNA.

21. A kit for obtaining dwarf corn, characterized in that, The invention includes methods for causing base deletions, additions, or substitutions in the endogenous ZmBr2 gene of the plant to obtain maize plants containing the mutant ZmBr2 nucleic acid of any one of claims 1-8 or expressing the mutant ZmBr2 protein of any one of claims 9-10; the plant is maize.

22. The kit according to claim 21, characterized in that, The products include gene editing, physical mutagenesis, and / or chemical mutagenesis products.

23. The reagent kit according to claim 22, characterized in that, The gene editing product includes a QBEmax base editor and sgRNA; the amino acid sequence of the QBEmax base editor is shown in SEQ ID NO:6; the spacer sequence of the sgRNA is shown in SEQ ID NO:

8.

24. The reagent kit according to claim 23, characterized in that, The sgRNA derivatives include recombinant vectors or recombinant cells containing the sgRNA.

25. A method for producing maize progeny seeds, characterized in that, include: The first corn plant was crossed with the second corn plant; Wherein, both the first corn plant and the second corn plant contain the mutant Zmbr2 nucleic acid as described in any one of claims 1-8 or express the mutant ZmBr2 protein as described in any one of claims 9-10; Wherein: (i) the first corn plant is a female parent and the second corn plant is a male parent; or (ii) the second corn plant is a female parent and the first corn plant is a male parent; and one or more corn offspring seeds are harvested from the female parent.

26. The method according to claim 25, characterized in that, The male parent contains the mutant Zmbr2 nucleic acid shown in SEQ ID NO:4, and the female parent contains the mutant Zmbr2 nucleic acid shown in any one of SEQ ID NO:30, 32, 34, 36 or 38.

27. The method according to claim 25 or 26, characterized in that, Both the first and second corn plants are non-GMO corn plants.

28. The method according to any one of claims 25-27, characterized in that, The endogenous ZmBr2 gene or its allele in the offspring seeds contains the mutant Zmbr2 nucleic acid as described in any one of claims 1-8.

29. The method according to any one of claims 25-28, characterized in that, The method also includes planting the offspring seeds and obtaining offspring plants, the offspring plants being hybrid maize plants exhibiting reduced plant height or ear height.

30. A type of dwarf corn, characterized in that, It comprises the mutant Zmbr2 nucleic acid as described in any one of claims 1-8, or expresses the mutant ZmBr as described in any one of claims 9-10.

2. Protein, or comprising the polynucleotide of claim 11; or obtained by the method of any one of claims 13-20; or obtained by the kit of any one of claims 21-24; or obtained by the method of any one of claims 25-29.

31. The dwarf corn according to claim 30, characterized in that, The dwarf corn refers to corn seeds, plants, pollen, embryos, endosperm, ears, kernels, leaves, roots, stems, anthers, tissue cultures, or cells.

Images