Application of the sco4118 gene, recombinant vectors containing this gene, and recombinant bacteria in increasing the yield of milbemycin in *Streptomyces hygroscopicus*.

Abstract

sco4118 The application of the gene, the recombinant vector containing the gene, and the recombinant bacteria in increasing the yield of milbemycin in *Streptomyces hygroscopicus* belongs to the field of genetic engineering technology. To increase the yield of milbemycin, this invention has identified a gene encoding a TetR family AtrA regulator from *Streptomyces hygroscopicus* M145. sco4118 Gene; through heterologous overexpression in *Streptomyces berberis* BC04 sco4118 Genes were used to construct a recombinant bacterium, Osco4118, which was found to significantly increase the yield of milbemycin compared to the control strain, and can be applied to the production of milbemycin.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving sco4118 Application of the gene, recombinant vector containing the gene, and recombinant bacteria in increasing the yield of milbemycin from *Streptomyces hygroscopicus* in Harbin. Background Technology

[0002] Milbemycin is a biopesticide with high insecticidal and acaricidal activity, and is environmentally friendly and safe for humans and animals, showing broad application prospects as a plant protection pesticide and veterinary drug. However, limited by its low fermentation potency, the cost of milbemycin is still insufficient to meet the requirements for its widespread application in the field of green control of plant diseases and pests. Systematically exploring the transcriptional regulatory network of milbemycin biosynthesis, especially the regulatory mechanisms of important transcription factors, is a necessary step to achieve high yield and widespread application of milbemycin.

[0003] Statistics show that over 70% of commercially viable natural product drugs are secondary metabolites or derivatives of Streptomyces. Therefore, Streptomyces has long been considered a treasure trove for natural product drug development. However, the production levels of natural products in Streptomyces are typically low, mainly due to the complex internal regulatory network that strictly controls the biosynthesis of secondary metabolites. Transcriptional regulators are a core component of this regulatory network, playing a crucial role in determining the production and final yield of natural products. *Streptomyces hygroscopicus* (Bingcheng) Streptomyces bingchenggensis BC04 is a milbemycin industrial production strain with independent intellectual property rights obtained by our laboratory. However, our understanding of the milbemycin biosynthesis regulatory network in this strain is still very limited, which seriously hinders the process of modifying the strain through rational metabolic engineering to obtain high-yield engineered bacteria. Therefore, deciphering the milbemycin biosynthesis regulatory network in *Streptomyces hygroscopicus* is of great significance for improving the fermentation potency of milbemycin and reducing its industrial production cost.

[0004] In Streptomyces, genes involved in the biosynthesis of natural products exist in clusters and are tightly controlled by a multi-level regulatory network. AtrA-class regulators, belonging to the TetR family of transcriptional regulators widely distributed in the Streptomyces genome, often participate in the regulation of secondary metabolite synthesis. Existing research indicates that AtrA can directly regulate the expression of various secondary metabolite biosynthesis gene clusters, thereby affecting the yield of secondary metabolites. Whether and how AtrA regulators affect milbemycin biosynthesis in *Streptomyces hystericus* remains unknown. Therefore, investigating the impact of AtrA-class regulators on milbemycin biosynthesis in *Streptomyces hystericus* may provide new engineering targets for constructing high-yielding milbemycin-producing strains. Summary of the Invention

[0005] To increase the yield of milbemycin in *Streptomyces hygroscopicus*, this invention heterologously overexpresses *Streptomyces hygroscopicus* M145 derived from *Streptomyces hygroscopicus* BC04. Streptomyces coelicolor The AtrA regulator encoding gene ( sco4118 (Gene), and found that the obtained recombinant strain could increase the yield of milbemycin.

[0006] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution: The first objective of this invention is to provide sco4118 The application of genes in increasing the yield of milbemycin in *Streptomyces hygroscopicus* in Harbin. sco4118 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] In one embodiment of the invention, the application is in *Streptomyces glabra* (…). Streptomyces bingchenggensis Overexpression in BC04 sco4118 Gene.

[0008] A second objective of this invention is to provide a product containing the above-mentioned... sco4118 Application of gene recombinant vectors in increasing the yield of milbemycin in *Streptomyces hygroscopicus*.

[0009] In one embodiment of the present invention, the application involves introducing a recombinant vector into Escherichia coli and then transferring it into Streptomyces BC04.

[0010] Further specifying, the *E. coli* is... E.coli ET12567 / pUZ8002.

[0011] In one embodiment of the present invention, the method for constructing the recombinant vector includes the following steps: double digestion of plasmid pSET152 to obtain a linear vector backbone; using the genome of Streptomyces cerevisiae M145 as a template, amplification... sco4118 Gene fragments; combining linear vector backbones with sco4118 Gene fragments are spliced ​​together to obtain a recombinant vector.

[0012] In one embodiment of the present invention, the amplification sco4118 The two primer pairs used for the gene fragment are sco4118-F1 and sco4118-R1, and sco4118-F2 and sco4118-R2; the nucleotide sequences of sco4118-F1 and sco4118-R1 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and the nucleotide sequences of sco4118-F2 and sco4118-R2 are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0013] In one embodiment of the present invention, the restriction endonuclease used in the double digestion is: Bam HI and Eco RI.

[0014] In one embodiment of the present invention, the ClonExpress MultiS kit is used to bond the linear vector backbone with... sco4118 Gene fragments are spliced ​​together.

[0015] A third object of the present invention is to provide a product containing the above-mentioned... sco4118 Application of recombinant bacteria containing genes or the above-mentioned recombinant vectors in increasing the yield of milbemycin from *Streptomyces hygroscopicus*.

[0016] In one embodiment of the present invention, the method for constructing the recombinant bacteria includes the following steps: constructing the recombinant bacteria described in claim 1. sco4118 The gene overexpression integration plasmid was transformed into E. coli, and then the overexpression integration plasmid was introduced into the starting strain through intergeneric fusion transfer experiment to obtain recombinant bacteria.

[0017] In one embodiment of the present invention, the starting strain is *Streptomyces berberis* BC04.

[0018] Further specifying, the *E. coli* is... E.coli ET12567 / pUZ8002.

[0019] In one embodiment of the present invention, the application is to culture the above-mentioned recombinant bacteria under conditions suitable for the production of milbemycin, that is, to synthesize milbemycin by sequentially culturing the recombinant bacteria in a seed culture medium and fermenting them in a fermentation culture medium.

[0020] Further specifying, the seed culture medium comprises: 5 g / L yeast extract, 10 g / L sucrose, 1 g / L skim milk powder, 3.5 g / L bacterial peptone, 0.5 g / L dipotassium hydrogen phosphate, with the remainder being water, and pH 7.2.

[0021] Further specifying, the fermentation medium consists of: 80 g / L sucrose, 20 g / L soybean meal, 1 g / L skim milk powder, 0.1 g / L ferrous sulfate, 1 g / L dipotassium hydrogen phosphate, 3 g / L calcium carbonate, with the remainder being water, and pH 7.2.

[0022] The beneficial effects of this invention are: This invention reveals genes in Streptomyces cerevisiae M145. sco4118The effect of overexpression of *Streptomyces hystericus* on milbemycin biosynthesis. This gene encodes a TetR family transcription factor that positively regulates milbemycin synthesis. Furthermore, this invention uses *Streptomyces hystericus* BC04 as the starting strain for heterologous overexpression. sco4118 Genes were used to construct a recombinant strain, Osco4118. It was found that when using the recombinant strain Osco4118 for fermentation to produce milbemycin, compared with the control strain BC04 / pSET152, the final milbemycin yield of the recombinant strain Osco4118 increased from 2531 mg / L to 4083 mg / L, an increase of 0.6 times. Attached Figure Description

[0023] Figure 1 This is a schematic diagram illustrating the construction of the recombinant plasmid pSET152::2sco4118; Figure 2 The graph shows the detection results of milbemycin content in the fermentation broth of recombinant strain Osbi_05779, control strain BC04 / pSET152, and original strain BC04. Figure 3 The graph shows the detection results of milbemycin content in the fermentation broth of recombinant strain Osco4118, control strain BC04 / pSET152, and original strain BC04. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be noted that the embodiments mentioned below are only for explaining the invention and are not intended to limit the scope of the invention. The embodiments mentioned below are only some embodiments of the invention, not all embodiments. In the art, any embodiments obtained by those skilled in the art without creative effort are protected by this invention.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The materials, reagents, culture media, and instruments used are all conventional materials, reagents, culture media, and instruments in the art, and can be obtained commercially by those skilled in the art. Unless otherwise specified, the molecular biology experimental operations involved in this invention, such as PCR amplification, enzyme digestion and ligation, and transformation, are all conventional experimental operations in the art or can be performed according to the product instructions of the corresponding reagents.

[0026] The plasmid information involved in the following examples is shown in Table 1; the strain information involved is shown in Table 2; and the primer information involved is shown in Table 3.

[0027] Table 1. Plasmid information involved in the examples

[0028] Table 2. Information on the strains involved in the examples.

[0029] Table 3 Sequence information involved in the embodiments

[0030] The specific sources of *Streptomyces BC04* (ice city) and *Streptomyces M145* (sky blue) in Table 2 are as follows: Harbin Streptomyces ( Streptomyces bingchenggensis BC04 is the industrial-grade milbemycin production strain, disclosed in the following literature: ZHANG, Y. et al. Characterization of a pathway specific activator of milbemycin biosynthesis and improved milbemycin production by its overexpression in Streptomyces bingchenggensis [J]. Microb Cell Fact, 2016(15): 152.

[0031] Sky blue Streptomyces ( Streptomyces coelicolor M145 is disclosed in the following literature: Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000) Practical Streptomyces genetics. John Innes Foundation, Norwich.

[0032] The above-mentioned strains are available to the public from the Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0033] The culture medium involved in this invention is as follows: The solid culture medium required for the growth and fermentation of *Streptomyces hygroscopicus* in Harbin is SKYM medium, with the following composition: 4 g / L sucrose, 1 g / L skim milk powder, 2 g / L yeast extract, 5 g / L malt extract, 18 g / L agar powder, and the balance being water, pH 7.0-7.2.

[0034] The composition of the *Streptomyces hygroscopicus* seed culture medium in Harbin is as follows: 5 g / L yeast extract, 10 g / L sucrose, 1 g / L skim milk powder, 3.5 g / L bacterial peptone, 0.5 g / L dipotassium hydrogen phosphate, with the remainder being water, pH 7.2.

[0035] The composition of the fermentation medium for *Streptomyces hygroscopicus* in Harbin is as follows: 80 g / L sucrose, 20 g / L soybean meal, 1 g / L skim milk powder, 0.1 g / L ferrous sulfate, 1 g / L dipotassium hydrogen phosphate, 3 g / L calcium carbonate, with the remainder being water, pH 7.2.

[0036] The ClonExpress MultiS kit used in this invention was purchased from Novizan.

[0037] The detection method involved in this invention is as follows: Method for detecting milbemycin: 0.5 mL of fermentation broth from *Streptomyces hygroscopicus* was thoroughly mixed with 1.5 mL of ethanol, ultrasonically disrupted for 25 min, and extracted overnight. The pre-treated sample was then centrifuged at 12000 rpm for 10 min. The supernatant milbemycin extract was filtered through a 0.22 μm organic filter membrane and analyzed by liquid chromatography. The instrument used was an Agilent high-performance liquid chromatography (HPLC) system with a C18 column (Zorbax, 4.6 mm × 250 mm, 5 μm), a detection wavelength of 242 nm, an injection volume of 20 μL, and a mobile phase flow rate of 1.0 mL / min. Specific chromatographic conditions were as follows: 0-15 min: mobile phase A (methanol) eluted from 0% to 100%, mobile phase B (acetonitrile:methanol:water = 7:2:1, v / v) eluted from 100% to 0%; 15-17 min: mobile phase A maintained at 100%; 17-25 min: mobile phase B maintained at 100%. For 25-27 minutes, mobile phase A (methanol) was eluted from 100% to 0%, and mobile phase B was eluted from 0% to 100% in a gradient. Mobile phase B was maintained at 100%, and the column temperature was 28℃.

[0038] In this invention sco4118 The nucleotide sequence of the gene is shown in SEQ ID NO.1. sbi_05779 The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0039] SEQ ID NO.1: atgcatgttcaggattctcattggtcgtccgcgtcggccgtcgcgcccggcggtgcgatgagtacggcggcgggcggcgcacacggggacgcgggacggagcgcgcccttgcgcgtggacgcccagcgcaatctggagcacgtgctgcgcgctgcgcgggaggtgttcggcgagctggggtacggcgcgccgatggaggacgtggcgcggcgcgcgcgggtcggtgtcggcacggtgtaccggcgctttccgagcaaggacgtgctggtgcgccggatagccgaggaggagacggcacggctgaccgaccaggcccgcacggcgctcgggcaggaggacgagccgtggtcggcgctgtcccgcttcctgcggacgtcggttgcctcgggcgccggccggctgctgccgccgcaggtgctgcgggtcggggtgtcggacgacgccgggaccgacggcggcgtgggcggtcccggtgcagcggccgccggtgatccgcgggtgccgcagcagcggatacagccgggcaccggcgagctgcggctggtgtccgaggagtccgccgcggccagggcgtccgccgtcggaggttccgccgcggacgccgcgggccctgtcgcaacctctgccgcaggacctgcggcaggagctgtggcgggtcccgtcgcgggttccgtggtcggggacgacggcgccgcggcgctgctggaggtcgtgggccggctcgtggagcgggcgcgcacggccggtgagctgcggcccgacgtgtcggtgtcggacgtgctgctggtcatagccacggcggcgccctcgctgccggacccggcccagcaggcggcggcctcggcccggctgctggacatcctgctggaggggctgcggtcgcggccggtgtga; SEQ ID NO.2: .

[0040] Comparative example: overexpression sbi_05779 Construction and application of the recombinant Streptomyces hygroscopicus strain Osbi_05779 Transcriptome analysis of *Streptomyces hystericus* BC04 revealed that the expression levels of the AtrA regulator in the TetR family of proteins were among the top three. Therefore, this invention attempts to overexpress the gene encoding the AtrA regulator in *Streptomyces hystericus* BC04. Osbi_05779 The study investigated the effects of this gene on the fermentation of *Streptomyces BC04* in Harbin to produce milbemycin.

[0041] 1. Construction of the recombinant expression vector pSET152::sbi_05779 Polymerase chain reaction (PCR) was performed using the Q5 high-fidelity enzyme system. The genome of *Streptomyces BC04* from Harbin was used as a template, and sbi_05779-F and sbi_05779-R were used as primers to amplify the genome. sbi_05779 Gene fragment. The PCR reaction system was as follows: 10×KOD Buffer 5 μL, 2 mM dNTPs 5 μL, template DNA 10 pg-1000 ng, 10 μM forward and reverse primers 2 μL each, 25 mM MgSO4 2 μL, 1 U / μL KOD plus DNA polymerase 1 μL, DMSO 3 μL, and ddH2O to a final volume of 50 μL. The PCR reaction conditions were as follows: 94℃ for 4 min; 94℃ for 1 min, 65℃ for 30 sec, 68℃ for 3 min, 31 cycles; 68℃ for 10 min. Bam HI and Eco RI was used to double-digest plasmid pSET152 to obtain the linear vector backbone. The digestion system was: 1-2 μg plasmid pSET152, 10 μL 10×M buffer, and 10 μL BSA. Bam HI 3 μL, Eco Add 3 μL of RI and bring the total volume to 100 μL with ddH2O. Use the ClonExpress MultiS kit to process the PCR-obtained... sbi_05779 Gene fragments were spliced ​​with a linear vector backbone. The splicing system was as follows: vector pSET152 60-70 ng. sbi_05779 Gene fragment 15-16 ng, 5×CEMultiS Buffer 2 μL, Exnase MultiS 1 μL, ddH2O to a final volume of 10 μL. The splicing product was then transformed into *E. coli* JM109, plated, and clones were picked and cultured in small tubes containing apramycin (final concentration 100 μg / mL). Plasmids were extracted using a plasmid extraction kit, and after electrophoresis, enzyme digestion and sequencing verification were performed to obtain the recombinant plasmid pSET152::sbi_05779.

[0042] 2. Construction of recombinant strain Osbi_05779 The recombinant plasmid pSET152::sbi_05779 was transformed into *Escherichia coli* ET12567 / pUZ8002, and then introduced into *Streptomyces BC04* via conjugation transfer. The conjugates were then picked onto SKYM medium containing apramycin (final concentration 16 μg / mL) and nalidixic acid (final concentration 25 μg / mL), and cultured at 28°C for 9 days. The results were then validated. sbi_05779 Gene transcriptional expression levels are overexpressed. sbi_05779The recombinant strain Osbi_05779.

[0043] 3. Fermentation verification of recombinant strain Osbi_05779 The recombinant strain Osbi_05779, the control strain BC04 / pSET152, and the original strain BC04 were inoculated onto SKYM solid medium and cultured at 28°C for 9 days. Spores of about 1 square centimeter were scraped off and inoculated into the seed culture medium of *Streptomyces hygroscopicus*, and cultured at 28°C and 250 rpm for 46 hours. Then, at an inoculation rate of 6%, the inoculated medium was inoculated into the fermentation medium of *Streptomyces hygroscopicus*, and cultured at 28°C and 250 rpm for 9 days to obtain the fermentation broths of strains Osbi_05779, BC04 / pSET152, and BC04, respectively.

[0044] The control strain BC04 / pSET152 was constructed as follows: the empty plasmid pSET152 was transformed into *Escherichia coli* ET12567 / pUZ8002, and then introduced into *Streptomyces cerevisiae* BC04 via conjugation transfer. The conjugate was then picked onto SKYM medium containing apramycin (final concentration 16 μg / mL) and nalidixin (final concentration 25 μg / mL), and cultured at 28°C for 9 days to obtain the control strain BC04 / pSET152.

[0045] The content of milbemycin in the fermentation broth of strains Osbi_05779, BC04 / pSET152 and BC04 was determined by HPLC, and the results are as follows: Figure 2 As shown in the figure, the milbemycin yield of the recombinant strain Osbi_05779 (2639 mg / L) was approximately 0.04 times higher than that of the control strain BC04 / pSET152 (2531 mg / L). This indicates that the milbemycin gene was overexpressed. sbi_05779 The recombinant strain had no significant effect on increasing the yield of milbemycin produced by fermentation of *Streptomyces BC04* from Harbin.

[0046] Example: Heterologous overexpression sco4118 Construction and application of the recombinant Streptomyces hygroscopicus strain Osco4118 This invention discovered that the AtrA regulator is conserved in Streptomyces, and subsequently identified the gene encoding the AtrA regulator in Streptomyces cerevisiae M145. sco4118 (Gene), attempting to heterologously overexpress the gene from Streptomyces cerevisiae M145 in Streptomyces BC04 from Harbin. sco4118 The gene was identified and its effect on the fermentation of *Streptomyces berberine* BC04 to produce milbemycin was verified.

[0047] 1. Construction of the recombinant expression vector pSET152::2sco4118 Polymerase chain reaction (PCR) was performed using a Q5 high-fidelity enzyme system. The genome of *Streptomyces cerevisiae* M145 was used as a template, and primer pairs sco4118-F1 and sco4118-R1, and sco4118-F2 and sco4118-R2 were used to amplify the genome. sco4118 Gene fragment. The PCR reaction system was as follows: 5 μL 10×KOD Buffer, 5 μL 2 mM dNTPs, 10 pg-1000 ng template DNA, 2 μL each of 10 μM forward and reverse primers, 2 μL 25 mM MgSO4, 1 μL 1 U / μL KOD plus DNA polymerase, 3 μL DMSO, and ddH2O to a final volume of 50 μL. The PCR reaction conditions were as follows: 94℃ for 4 min; 94℃ for 1 min, 65℃ for 30 sec, 68℃ for 3 min, 31 cycles; 68℃ for 10 min.

[0048] use Bam HI and Eco RI was used to double-digest plasmid pSET152 to obtain the linear vector backbone. The digestion system was: 1-2 μg plasmid pSET152, 10 μL 10×M buffer, and 10 μL BSA. Bam HI 3 μL, Eco Add 3 μL of RI and bring the total volume to 100 μL with ddH2O. Use the ClonExpress MultiS kit to analyze the two PCR-obtained samples. sco4118 Gene fragments were spliced ​​with a linear vector backbone. The splicing system was as follows: vector pSET152 60-70 ng. sco4118 Gene fragment 15-16 ng, 5×CE MultiS Buffer 2 μL, Exnase MultiS 1 μL, ddH2O to a final volume of 10 μL. The splicing product was then transformed into *E. coli* JM109, plated, and clones were picked and cultured in small tubes containing apramycin (final concentration 100 μg / mL). Plasmids were extracted using a plasmid extraction kit, and after electrophoresis, enzyme digestion and sequencing verification were performed to obtain the recombinant plasmid pSET152::2sco4118 (a schematic diagram of the construction of this recombinant plasmid is shown below). Figure 1 (As shown).

[0049] 2. Construction of recombinant strain Osco4118 The recombinant plasmid pSET152::2sco4118 was transformed into *Escherichia coli* ET12567 / pUZ8002, and then introduced into *Streptomyces BC04* via conjugation transfer. The conjugates were then picked onto SKYM medium containing apramycin (final concentration 16 μg / mL) and nalidixic acid (final concentration 25 μg / mL) and cultured at 28°C for 9 days. The results were then validated. sco4118 Gene transcriptional expression levels are overexpressed. sco4118 The recombinant strain Osco4118.

[0050] 3. Fermentation verification of recombinant strain Osco4118 The recombinant strain Osco4118, the control strain BC04 / pSET152, and the original strain BC04 were inoculated onto SKYM solid medium and cultured at 28°C for 9 days. Spores of approximately 1 square centimeter were scraped and inoculated into the seed culture medium of *Streptomyces hygroscopicus*, and cultured at 28°C and 250 rpm for 46 hours. Then, at a 6% inoculation rate, the inoculated broth was added to the fermentation medium of *Streptomyces hygroscopicus*, and cultured at 28°C and 250 rpm for 9 days, yielding fermentation broths of strains Osco4118, BC04 / pSET152, and BC04, respectively. The construction method of the control strain BC04 / pSET152 was the same as that of the comparative example.

[0051] The content of milbemycin in the fermentation broth of strains Osco4118, BC04 / pSET152, and BC04 was determined by HPLC, and the results are as follows: Figure 3 As shown in the figure, the milbemycin yield of the recombinant strain Osco4118 (4083 mg / L) was approximately 0.6 times higher than that of the control strain BC04 / pSET152 (2531 mg / L). This indicates that overexpression of milbemycin derived from Streptomyces cerevisiae M145 is effective. sco4118 Recombinant strains of the gene can be used to increase the yield of milbemycin produced by fermentation of Streptomyces BC04 from Harbin.

[0052] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be defined by the claims.

Claims

1. A kind sco4118 The application of genes in increasing the yield of milbemycin in *Streptomyces hygroscopicus* is characterized by, The sco4118 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The application is in the case of Streptomyces glaciers in Harbin ( Streptomyces bingchenggensis Overexpression in BC04 sco4118 Gene.

3. A device comprising the contents of claim 1 sco4118 Application of gene recombinant vectors in increasing the yield of milbemycin in *Streptomyces hygroscopicus*.

4. The application according to claim 3, characterized in that, The application involves introducing a recombinant vector into Escherichia coli and then transferring it into Streptomyces BC04.

5. The application according to claim 3, characterized in that, The method for constructing the recombinant vector includes the following steps: double digestion of plasmid pSET152 to obtain a linear vector backbone; using the genome of Streptomyces cerevisiae M145 as a template, amplification... sco4118 Gene fragments; combining linear vector backbones with sco4118 Gene fragments are spliced ​​together to obtain a recombinant vector.

6. The application according to claim 5, characterized in that, The amplification sco4118 The two primer pairs used for the gene fragment are sco4118-F1 and sco4118-R1, and sco4118-F2 and sco4118-R2; the nucleotide sequences of sco4118-F1 and sco4118-R1 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and the nucleotide sequences of sco4118-F2 and sco4118-R2 are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

7. The application according to claim 5, characterized in that, The restriction endonuclease used in the double digestion is: Bam HI and Eco RI.

8. A device comprising the contents of claim 1 sco4118 The application of the recombinant strain of the gene or the recombinant vector described in claim 3 in increasing the yield of milbemycin from *Streptomyces hygroscopicus*.

9. The application according to claim 8, characterized in that, The method for constructing the recombinant bacteria includes the following steps: constructing the recombinant bacteria described in claim 1. sco4118 The gene overexpression integration plasmid was transformed into E. coli, and then the overexpression integration plasmid was introduced into the starting strain through intergeneric fusion transfer experiment to obtain recombinant bacteria.

10. The application according to claim 9, characterized in that, The starting strain was *Streptomyces berberis* BC04.

Images