Application of the SlLRR-RLK94 gene in regulating salt tolerance in tomatoes and in creating salt-sensitive tomato materials

Abstract

This invention provides an application of the SlLRR-RLK94 gene in regulating salt tolerance in tomatoes and creating salt-sensitive materials. The coding sequence of the SlLRR-RLK94 gene is shown in SEQ ID NO.1. Normal expression of the SlLRR-RLK94 gene is essential for maintaining basic salt tolerance in tomatoes. This invention utilizes CRISPR / Cas9 gene editing technology to construct a vector that targets and knocks out SlLRR-RLK94. Homozygous mutants with SlLRR-RLK94 loss of function were obtained through Agrobacterium-mediated genetic transformation. Compared to the wild type, the mutants exhibited more severe growth inhibition, leaf yellowing, increased ion leakage, decreased chlorophyll content, and significantly shortened root length under salt stress, showing a significantly reduced salt tolerance and exhibiting a typical salt-sensitive phenotype. This invention clarifies the positive regulatory function of SlLRR-RLK94 in tomato salt tolerance. The created salt-sensitive mutants can not only be used for research on salt tolerance mechanisms but also serve as indicator plants for environmental salt content, possessing significant scientific research and application value.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and relates to the application of the SlLRR-RLK94 gene in regulating the salt tolerance of tomatoes and in creating salt-sensitive tomato materials, especially a method for creating salt-sensitive tomato materials using CRISPR / Cas9 gene editing technology. Background Technology

[0002] Soil salinization is a major threat to global crop production, affecting approximately 1 billion hectares of land, or about 7% of the Earth's land area. Salt stress causes osmotic imbalances in plant cells, ion toxicity, and oxidative damage, severely inhibiting plant growth and development and leading to significant yield reductions. Tomatoes are a widely cultivated crop globally, possessing high nutritional and economic value. According to statistics from the Food and Agriculture Organization of the United Nations (FAO), in 2023, my country's tomato planting area was approximately 1.1604 million hectares, with a yield of 70.2147 million tons, accounting for about one-third of the global tomato production.

[0003] Salt tolerance in plants is a complex quantitative trait regulated by numerous genes. Among the identified salt tolerance-related genes, some act as negative regulators, and their loss of function enhances salt tolerance; others act as positive regulators, and their normal expression is essential for maintaining basic salt tolerance. Loss of function or suppression of expression leads to a significant decrease in salt tolerance, resulting in a salt-sensitive phenotype. For example, the SS3 gene in rice encodes mannose-1-phosphate guanylate transferase. Loss-of-function mutations in this gene inhibit ascorbic acid (AsA) synthesis and reduce reactive oxygen species (ROS) scavenging capacity, thus making the plant more susceptible to salt stress.

[0004] Leucine-rich repeat receptor-like kinases (LRR-RLKs) are one of the largest families of receptor kinases in plants, widely involved in plant growth and development, hormone signal sensing, and responses to biotic and abiotic stresses. For example, PEPR1 recognizes the Pep3 peptide and participates in the salt stress response process; RLK7 recognizes the PIP3 peptide and amplifies the plant's salt tolerance signal through the downstream MPK3 / 6 cascade reaction, thereby enhancing salt tolerance. The function of MIK2 in abiotic stresses (such as salt and drought) exhibits interesting species-specific evolution. In Arabidopsis, MIK2 expression is induced by salt stress, and its expression level is positively correlated with salt tolerance. Natural Arabidopsis variants with high MIK2 expression levels (such as Cen-0) are less sensitive to salt stress, while lines with low expression levels (such as HR-5) are more sensitive. Furthermore, MIK2 deletion mutants are sensitive to salt stress, further confirming its role as a positive regulator of salt tolerance. In the monocotyledonous crop maize, its homolog ZmMIK2 has been shown to be a negative regulator of drought and salt stress. Knocking out ZmMIK2 and its downstream interacting factor ZmC2DP1 significantly enhanced maize's drought and salt tolerance. This functional differentiation suggests that this receptor family may have been recruited for drastically different environmental adaptation strategies during the evolution of different species.

[0005] CN202411516427 disclosed the tomato late blight resistance gene SlLRRRLK95. Plant Cell Reports (2025) 44:257 confirmed that SlLRR-RLK94 is a positive regulatory gene for tomato late blight resistance. SlLRRRLK95 and SlLRR-RLK94 are the same gene, functioning in tomato late blight resistance, differing only in name. However, as a homolog of Arabidopsis MIK2, the LRR-RLK family member SlLRR-RLK94 in tomato still has very limited research on its function in salt tolerance regulation.

[0006] CRISPR / Cas9 gene editing technology has become a routine tool for plant gene function research and molecular breeding due to its advantages such as simple design, high editing efficiency, and relatively low cost. Creating mutants of key salt-tolerance genes in plants using this technology is an effective way to rapidly and accurately analyze gene function. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention provides an application of the SlLRR-RLK94 gene in positively regulating tomato salt tolerance and in reducing tomato salt tolerance and creating salt-sensitive tomato materials. Specifically, it provides a key gene, SlLRR-RLK94, that positively regulates tomato salt tolerance, and provides specific applications and methods for this gene in reducing tomato salt tolerance and creating salt-sensitive tomato materials. This invention constructs an SlLRR-RLK94 knockout vector using CRISPR / Cas9 technology to obtain loss-of-function mutants, revealing the positive regulatory role of SlLRR-RLK94 in tomato salt tolerance. This is of great significance for the creation of salt-sensitive tomato materials and the study of salt tolerance mechanisms. Using CRISPR / Cas9 technology, by targeting and knocking out the key gene SlLRR-RLK94, which positively regulates salt tolerance in tomatoes, transgenic tomato lines with significantly reduced salt tolerance and sensitivity to salt stress were successfully obtained. This not only provides ideal material for in-depth analysis of the mechanism of action of this gene in regulating tomato salt tolerance, but also lays the foundation for the development of salt-sensitive indicator plants and other applications.

[0008] To achieve the above objectives, the present invention is implemented through the following technical solution: In a first aspect, the present invention provides the application of the gene SlLRR-RLK94 in regulating salt tolerance in tomatoes, wherein the coding region sequence of the SlLRR-RLK94 gene is shown in SEQ ID NO.1 and positively regulates salt tolerance in tomatoes.

[0009] The amino acid sequence of the protein encoded by the SlLRR-RLK94 gene is shown in SEQ ID NO.2.

[0010] In a second aspect, the present invention provides the application of the SlLRR-RLK94 gene in the creation of salt-sensitive tomato materials. By knocking out the SlLRR-RLK94 gene, the salt tolerance of the plant is reduced, thereby obtaining salt-sensitive tomato materials that are sensitive to salt stress.

[0011] Knockout involves using the CRISPR / Cas9 gene editing system to target and knock out the SlLRR-RLK94 gene.

[0012] The nucleotide sequences of the sgRNA target sites for knocking out the SlLRR-RLK94 gene, Target 1 and Target 2, are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0013] In a third aspect, the present invention provides a method for creating salt-sensitive tomato material, wherein the SlLRR-RLK94 gene in tomato is knocked out using a CRISPR / Cas9 gene editing system, thereby causing the protein encoded by the gene to lose its function or its expression level to decrease, thus reducing the salt tolerance of the tomato plant and obtaining salt-sensitive tomato material.

[0014] Includes the following steps: S1. Construct a plant CRISPR / Cas9 gene editing vector containing sgRNA targeting the SlLRR-RLK94 gene and a Cas9 protein expression cassette; S2. The constructed recombinant vector was introduced into tomato explants using Agrobacterium-mediated genetic transformation. S3. Transgenic regenerated plants were obtained through tissue culture, resistance screening, induced differentiation, and rooting culture. S4. Molecular identification of regenerated plants was performed to screen for positive plants with base insertion or deletion mutations in the target region of the SlLRR-RLK94 gene. S5. Self-pollinate and propagate positive plants, and screen to obtain homozygous mutant lines without exogenous vector sequences. These lines are salt-sensitive tomato materials with reduced salt tolerance.

[0015] In a preferred embodiment, the tomato explant is a cotyledon, and the Agrobacterium is GV3101.

[0016] In a preferred embodiment, the molecular identification includes transgene-positive detection using Cas9-specific primers and target region sequencing analysis.

[0017] The method for constructing the CRISPR / Cas9 gene editing vector includes the following steps: S1. Using the mRNA of wild-type tomato early powder 2 as a template, reverse transcription was performed. The resulting reverse transcription product, tomato genomic cDNA template, was then used for PCR amplification with specific primers. The specific primers are as follows: CR94-F: ATATATGGTCTCGATTGGTCACATTCCTGCCGAAATGTTTTAGAGCTAGAAATAGC CR94-R: ATTATTGGTCTCGAAACAAGCTATAGGAGAATTAACCAATCTCTTAGTCGACTCTAC S2. The PCR product obtained in step S1 is digested with enzymes and then ligated into the M2CRISPR vector. S3. Transform the ligation product CR-94 obtained in step S2 into competent E. coli cells and culture them in LB solid medium containing kanamycin. After picking positive single clones, shake the cells to extract plasmids. PCR verification is performed using the specific primers, and the cells are then sequenced. If the sequencing result is correct, it is a successful CRISPR / Cas9 gene editing vector.

[0018] In a fourth aspect, the present invention provides an application of the salt-sensitive tomato material created by the above method, which is used as an indicator plant to indicate whether the salt content in the environment exceeds the standard, or as a salt-sensitive model material in the study of plant salt tolerance mechanism.

[0019] The beneficial effects of this invention are: Currently, the positive regulatory function of SlLRR-RLK94 in tomato salt tolerance has not been reported. LRR-RLKs are one of the largest receptor kinase families in plants, widely involved in plant growth and development, hormone signal sensing, and responses to biotic and abiotic stresses. This invention clarifies that the SlLRR-RLK94 gene is essential for maintaining normal salt tolerance in tomatoes. Homozygous loss-of-function mutants CR94-10-1 and CR94-11-5 were successfully created using CRISPR / Cas9 technology. Compared to the wild type, the mutants exhibited more severe growth inhibition, leaf yellowing, increased ion leakage, decreased chlorophyll content, and significantly shortened root length under salt stress. This confirms that knocking out this gene can effectively reduce tomato salt tolerance, yielding stable salt-sensitive materials. This material not only provides a valuable genetic tool for in-depth research on the mechanism of tomato salt tolerance but can also serve as a novel "salt-sensitive indicator plant" for environmental monitoring, possessing significant scientific research and application value. Attached Figure Description

[0020] Figure 1 The expression level of the SlLRR-RLK94 gene at each time point of salt treatment; Figure 2 A schematic diagram of the SlLRR-RLK94 gene structure and the location of the CRISPR / Cas9 target site; Figure 3 This is a comparison of the phenotypes and physiological parameters of wild-type (WT) and SlLRR-RLK94 knockout mutants (CR94-10-1 and CR94-11-5) under treatment with 0 mM NaCl and 150 mM NaCl. Detailed Implementation

[0021] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0022] The coding region sequence of the SlLRR-RLK94 gene is shown in SEQ ID NO.1.

[0023] The amino acid sequence of the protein encoded by the SlLRR-RLK94 gene is shown in SEQ ID NO.2.

[0024] Example 1: Expression analysis of SlLRR-RLK94 gene in response to salt stress 1. Cultivation of tomato plants After soaking the seeds of Early Pink No. 2 tomato in pure water for 24 hours, they were evenly placed on moist filter paper and germinated in a 28℃ incubator. After 5 days, they were transferred to soil and cultured at 28℃ with 16 hours of light and 8 hours of darkness until they reached the 4-5 leaf stage.

[0025] 2. Treatment and sampling of tomato seedlings When tomato seedlings reached the 4-5 leaf stage, salt stress treatment was applied. The seedlings were placed in hydroponic containers. The treatment group was cultured in 1 / 4 Hoagland nutrient solution containing 150 mM NaCl, while the control group was cultured in 1 / 4 Hoagland nutrient solution without NaCl. Tomato leaf samples were collected at 0, 0.5, 2, 6, 12, and 24 hours after treatment, with three independent biological replicates at each time point. All samples were immediately frozen in liquid nitrogen after collection and stored at -80°C for later use.

[0026] 3. RNA extraction, reverse transcription, and real-time quantitative PCR reaction (1) Take an appropriate amount of fully ground powder and add it to 1 mL of pre-cooled Trizol. Shake well and let stand at room temperature for 5 min.

[0027] (2) Take the supernatant and add 200 μL of chloroform, shake to mix, and centrifuge at 4℃ and 12000 r / min for 10 min. Transfer the supernatant to a new centrifuge tube, add an equal volume of pre-cooled isopropanol, invert 8-10 times to mix, and centrifuge at 4℃ and 12000 r / min for 10 min.

[0028] (3) Discard the supernatant, add 1 mL of freshly prepared 75% ethanol, wash the precipitate, and centrifuge at 4℃ and 12000 r / min for 5 min.

[0029] (4) Discard the supernatant, open the lid and let it stand until the remaining ethanol has completely evaporated, then add 25 μL RNase Free dH2O to fully dissolve the precipitate.

[0030] (5) Take 3 μL of RNA and use 1% agarose gel electrophoresis to detect the purity and quality of the extracted RNA. The extracted RNA was reverse transcribed into cDNA template using the mRNA reverse transcription reagent PrimeScript™ RT Master Mix (purchased from TaKaRa), and the expression level of SlLRR-RLK94 gene at each time point was detected using the real-time fluorescence quantitative reagent ChamQ Universal SYBR qPCR Master Mix (purchased from Novizan).

[0031] Table 1 Primers used for real-time quantitative PCR SlLRR-RLK94 CGAAATAGGGAAGATGAAGT ATCATTCAGTTGTCTCAGG Actin GTCCTCTTCCAGCCATCCAT ACCACTGAGCACAATGTTACCG Data from real-time quantitative PCR were analyzed, and relative expression levels were calculated using the 2-ΔΔCt method. The results showed that salt treatment significantly upregulated the expression level of SlLRR-RLK94, indicating that the expression of the SlLRR-RLK94 gene is induced by salt. Figure 1 ).

[0032] The above reverse transcription system is as follows: Total RNA 3.0 μL <![CDATA[RNase Free dH2O]]> 5.0 μL Total 10.0 μL The reaction conditions were 37℃ for 15 min and 85℃ for 5 sec.

[0033] The above real-time quantitative PCR reaction system is as follows: Forward Primer 0.4 μL Reverse Primer 0.4 μL cDNA template 2.0 μL <![CDATA[RNase Free dH2O]]> 7.2 μL Total 20.0 μL The reaction conditions are as follows:

[0034] Example 2: Construction of the CRISPR / Cas9 knockout vector for the SlLRR-RLK94 gene 1. sgRNA target design and primer synthesis Based on the genomic sequence of SlLRR-RLK94, the CRISPOR online design tool was used to screen for target sequences with high specificity and low off-target risk in its key functional domains (exon regions). The nucleotide sequences of the sgRNA target Target1 and Target2 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and are as follows: Figure 2 As shown, the target site selected in this embodiment is adjacent to the PAM sequence (NGG) at its 3' end. This target site is located on an exon of the coding region of the SlLRR-RLK94 gene, and it is expected that cleavage will lead to loss of gene function. The specific sequence is as follows: SEQ ID NO.3: GGTCACATTCCTGCCGAAATAGG; SEQ ID NO. 4: AGTTAATTCTCCTATAGCTTTGG.

[0035] Synthesize forward and reverse oligonucleotide primers with BsaI sticky ends based on the target sequence: CR94-F: ATATATGGTCTCGATTGGTCACATTCCTGCCGAAATGTTTTAGAGCTAGAAATAGC; CR94-R: ATTATTGGTCTCGAAACAAGCTATAGGAGAATTAACCAATCTCTTAGTCGACTCTAC.

[0036] 2. Carrier Construction Tomato genomic cDNA was obtained according to the method in "Example 1, Step 4" and used as a template for PCR amplification using specific primers.

[0037] The above PCR reaction system is as follows: PrimeSTAR Max Premix (2×) 10.0μL 10 μM F primer 1.0μL 10 μM R primer 1.0μL Template 1.0μL Total 20.0 μL The reaction conditions are as follows:

[0038] After detecting the PCR product by 1% agarose gel electrophoresis, the target band was identified in a gel electrophoresis apparatus, excised, and added to a centrifuge tube. The excised gel block was weighed and purified according to the Novizan product purification instructions (DC301-01). The purified product and the M2CRISPR empty vector (containing the Cas9 expression cassette, with kanamycin as the bacterial antibiotic and hygromycin as the plant antibiotic) were digested with BsaI restriction endonuclease at 37°C for 1 h. After the digested fragments and vector were recovered from the agarose gel, they were ligated with DNA ligase at 16°C for 30 min. The ligation product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing kanamycin, and incubated overnight at 37°C.

[0039] Single colonies were selected for sequencing verification, using the following sequencing primers: CR-F: TGTCCCAGGATTAGAATG Clones with correct backbone and target sequences, as confirmed by DNAStar MegAlign software, were successfully constructed as recombinant CRISPR / Cas9 editing vectors and named CR-94. Positive clone plasmids were extracted and stored at -20°C for later use.

[0040] Example 3: Agrobacterium-mediated genetic transformation of tomato and screening of mutants 1. Preparation of CR-94 Agrobacterium engineered strain Thaw Agrobacterium GV3101 competent cells stored at -80℃ on ice. Add 0.1 μg CR-94 plasmid to every 100 μL of competent cells and gently mix. Incubate sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and on ice for 5 min. Add 700 μL of antibiotic-free LB broth and incubate at 28℃ with shaking at 200 rpm for 2–3 h. Collect bacteria by centrifugation at 6000 rpm for 1 min, resuspend the cells in 100 μL of supernatant, and spread on LB agar plates containing 50 μg / mL kanamycin. Incubate upside down at 28℃ for 2–3 days. Randomly select single colonies for colony PCR identification. Store correctly identified Agrobacterium clones for later use.

[0041] Inoculate correctly identified Agrobacterium bacteria onto LB agar plates containing antibiotics and incubate at 28°C for 2 days. Pick fresh single colonies and incubate in 600 μL of liquid medium at 28°C and 220 rpm for 15–20 h. Inoculate 5 shaken bacterial suspensions into 50 mL of medium and incubate at 28°C and 220 rpm until the OD600 is approximately 0.6. Centrifuge at 5000 rpm for 10 min, resuspend the bacterial cells in 10 mL of infection solution, measure the OD600, and adjust to 0.4–0.6 with the infection solution. Add 20 μL of 74 mM acetylsyl syringone (AS) to 40 mL of the resuspended bacterial suspension and mix well.

[0042] 2. Genetic transformation of tomatoes Aseptic seedlings of the tomato variety 'Zaofen No. 2' were used as materials.

[0043] (1) Seed treatment and explant preparation: Tomato seeds were placed in 50 mL sterile centrifuge tubes, 30 mL of 50% 84 disinfectant was added, the tubes were sealed and inverted for 15-20 min, the disinfectant was discarded in a laminar flow hood, and the seeds were rinsed 5 times with sterile water. After sterilization, the seeds were placed on germination medium (MS medium + 30 g / L sucrose + 8 g / L agar) and cultured in a 24℃ light incubator for 7-10 days (photoperiod 16 / 8-h light / dark). When the cotyledons were fully expanded and dark green, the base 1-2 mm and the tip 1-2 mm of the cotyledons were removed with a sterile scalpel, the remaining parts were cut in half, and the dorsal axis was placed on the germination medium and cultured at 24℃ for 2-3 days.

[0044] (2) Infection and co-culture: The pre-cultured cotyledonary explants were placed in the prepared Agrobacterium suspension and gently shaken at 50 rpm for 30 min for infection. The infection solution was formulated as follows: MS medium + 30 g / L sucrose + 100 μM acetylsylgenone. After infection, the cotyledons were transferred to sterile filter paper to blot off the surface bacterial solution, and placed on co-culture medium (MS medium + 30 g / L sucrose + 8 g / L agar + 1.5 mg / L zeatin) with the dorsal axis facing upwards, and incubated in the dark at 24℃ for 2 days.

[0045] (3) Screening and Culture: After co-culturing for 2 days, cotyledons were collected in centrifuge tubes and rinsed for 5 min with 40 mL of sterile water containing 200 mg / L termetidine. After drying the surface moisture, the explants were transferred from the dorsal axis upwards to the induction medium (MS medium + 30 g / L sucrose + 8 g / L agar + 1.5 mg / L zeatin + 100 mg / L kanamycin + 200 mg / L termetidine), 10-15 cotyledons per plate. After sealing, the plates were cultured at 24℃ under a 16 / 8-h photoperiod, with the induction medium replaced with fresh medium every 2 weeks. Bud primordia began to appear after about 2 weeks.

[0046] (4) Differentiation culture: Explants containing bud primordia were transferred into budding medium (MS medium + 30 g / L sucrose + 8 g / L agar + 1.0 mg / L zeatin + 50 mg / L kanamycin + 200 mg / L termethin) and cultured at 24℃ under a 16 / 8-h photoperiod.

[0047] (5) Rooting culture: After 4-8 weeks of differentiation culture, the callus tissue at the base of the bud is cut off, and the bud about 2 cm long is transferred into the rooting medium (MS medium + 30 g / L sucrose + 8 g / L agar + 50 mg / L kanamycin + 200 mg / L termethin) and cultured at 24℃ to induce rooting.

[0048] (6) Transplanting: After the root system is strong, carefully remove the plant from the culture medium, wash the agar off the roots with sterile water, and transplant it into peat balls and place it in a greenhouse tray. Cover with a transparent dome to maintain high humidity for the first 3 days, and then manage normally after acclimatization.

[0049] 3. Molecular identification of transgenic plants and screening of homozygous mutants (1) Transgenic positive detection: Genomic DNA was extracted from the leaves of regenerated plants and PCR was performed using Cas9-specific primers. Plants that amplified the target band were considered transgenic positive plants. Primer sequences: Cas9-F: TGGAGGAGGATAAGAAGCACG; Cas9-R:CAATGAGATTCCCGACAGG.

[0050] (2) Genotyping and screening of homozygous mutants: Using genomic DNA from positive plants as templates, PCR amplification was performed using specific primers designed on both sides of the target site. The amplified products were then sequenced. Sequence alignment software was used to analyze the sequencing results of the target region. The sequencing results showed that two positive plants with mutations in the SlLRR-RLK94 gene were identified, and after propagation, they were numbered CR94-10-1 and CR94-11-5. Figure 2As shown, CR94-10-1 has a 5-base deletion at target site 1, and CR94-11-5 has an 8-base deletion at target site 1, both resulting in frameshift mutations and premature termination of protein translation. The above T0 generation mutants were self-crossed, and in the T1 or T2 generations, lines with homozygous mutations at the target sequence and without the Cas9 protein expression cassette were selected by sequencing for subsequent phenotypic analysis.

[0051] Example 4: Salt sensitivity identification of SlLRR-RLK94 knockout mutant The selected T2 generation homozygous mutant lines CR94-10-1 and CR94-11-5 were subjected to salt stress treatment experiments with wild-type (WT) controls to evaluate their salt sensitivity.

[0052] Plump and uniform WT and mutant seeds were soaked in pure water for 24 hours, then evenly placed on moist filter paper and germinated in a 28℃ incubator. After 5 days, they were transferred to soil and cultured at 28℃ with 16 hours of light / 8 hours of darkness. When the tomato seedlings reached the 4-5 leaf stage, salt stress treatment was applied. The tomato seedlings were placed in hydroponic boxes. The treatment group was cultured with 1 / 4 Hoagland nutrient solution containing 150 mM NaCl, while the control group was cultured with 1 / 4 Hoagland nutrient solution without NaCl. The nutrient solution was changed every 5 days. After 10 days of treatment, the growth status of the plants, the degree of leaf wilting and yellowing were observed and photographed.

[0053] The results are as follows Figure 3 As shown, under 0 mM NaCl conditions, the WT and CR94-10-1 and CR94-11-5 mutant lines showed good growth with no significant difference. However, after 10 days of treatment with 150 mM NaCl, compared with WT, the CR94-10-1 and CR94-11-5 mutant lines exhibited more severe growth inhibition, leaf yellowing, increased ion leakage, decreased chlorophyll content, and significantly shortened root length, indicating a significant reduction in their salt tolerance.

[0054] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

[0055] Sequence List: The coding region sequence of the SlLRR-RLK94 gene is SEQ ID NO.1. The amino acid sequence of the protein encoded by the SlLRR-RLK94 gene is SEQ ID NO.2. The nucleotide sequences of the target sites for sgRNA, Target 1 and Target 2, are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively. SEQ ID NO.3: GGTCACATTCCTGCCGAAATAGG SEQ ID NO. 4: AGTTAATTCTCCTATAGCTTTGG.

Claims

1. An application of the SlLRR-RLK94 gene in regulating salt tolerance in tomatoes, characterized in that, The coding region sequence of the SlLRR-RLK94 gene is shown in SEQ ID NO.1, and it positively regulates salt tolerance in tomatoes.

2. The application according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the SlLRR-RLK94 gene is shown in SEQ ID NO.

2.

3. The application of the SlLRR-RLK94 gene in the creation of salt-sensitive tomato materials, characterized in that, The coding region sequence of the SlLRR-RLK94 gene is shown in SEQ ID NO.

1. By knocking out the SlLRR-RLK94 gene, the salt tolerance of the plant is reduced, and salt-sensitive tomato material sensitive to salt stress is obtained.

4. The application according to claim 3, characterized in that, The knockout was performed by targeting and knocking out the SlLRR-RLK94 gene using the CRISPR / Cas9 gene editing system.

5. The application according to claim 4, characterized in that, The nucleotide sequences of the sgRNA target sites for knocking out the SlLRR-RLK94 gene, Target 1 and Target 2, are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

6. A method for creating salt-sensitive tomatoes, characterized in that, The SlLRR-RLK94 gene in tomato was knocked out using the CRISPR / Cas9 gene editing system. The coding region sequence of the SlLRR-RLK94 gene is shown in SEQ ID NO.

1. This caused the protein encoded by the gene to lose its function or its expression level to decrease, thereby reducing the salt tolerance of the tomato plant and obtaining salt-sensitive tomato material.

7. The method according to claim 6, characterized in that, Includes the following steps: S1. Construct a plant CRISPR / Cas9 gene editing vector containing an sgRNA targeting the SlLRR-RLK94 gene and a Cas9 protein expression cassette. The nucleotide sequences of the target sites of the sgRNA, Target 1 and Target 2, are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. S2. The constructed recombinant vector was introduced into tomato explants using Agrobacterium-mediated genetic transformation. S3. Transgenic regenerated plants were obtained through tissue culture, resistance screening, induced differentiation, and rooting culture. S4. Molecular identification of regenerated plants was performed to screen for positive plants with base insertion or deletion mutations in the target region of the SlLRR-RLK94 gene. S5. Positive plants were self-pollinated and screened to obtain homozygous mutant lines without exogenous vector sequences. These lines are salt-sensitive tomato materials with reduced salt tolerance.

8. The method according to claim 7, characterized in that, The method for constructing the CRISPR / Cas9 gene editing vector includes the following steps: S1. Using the mRNA of wild-type tomato early powder 2 as a template, reverse transcription was performed. The resulting reverse transcription product, tomato genomic cDNA template, was then used for PCR amplification with specific primers. The specific primers are as follows: CR94-F: ATATATGGTCTCGATTGGTCACATTCCTGCCGAAATGTTTTAGAGCTAGAAATAGC CR94-R: ATTATTGGTCTCGAAACAAGCTATAGGAGAATTAACCAATCTCTTAGTCGACTCTAC S2. The PCR product obtained in step S1 is digested with enzymes and then ligated into the M2CRISPR vector. S3. Transform the ligation product CR-94 obtained in step S2 into competent E. coli cells and culture them in LB solid medium containing kanamycin. After picking positive single clones, shake the cells to extract plasmids. PCR verification is performed using the specific primers, and the cells are then sequenced. If the sequencing result is correct, it is a successful CRISPR / Cas9 gene editing vector.

9. The application of a salt-sensitive tomato material created by the method of claim 6, characterized in that: Used as an indicator plant to indicate whether the salt content in the environment exceeds the standard, or as a salt-sensitive model material in the study of plant salt tolerance mechanism.

Images