A method to improve the electroconversion efficiency of Bacillus methylmercury

CN122564002APending Publication Date: 2026-08-14INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-14
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

缺乏基因组的改造工具导致研究人员无法进行基因敲除、过表达等常规遗传操作

Benefits of technology

本发明丰富了高温甲醇芽孢杆菌的遗传编辑/修饰工具。具体包括:高效的电转方法,基因组的敲除、敲入和点突变的编辑方法,以及启动子文库。基于化学试剂的添加初步提高了甲醇芽孢杆菌的电转效率,简化了电转的工作流程。基于sfgfp筛选的同源重组编辑方法快速实现多个基因的编辑,通过敲除胞外多糖相关基因glgC,进一步提高感受态效率,感受态转化效率高达3.5 × 105CFU/μg DNA。基于高效感受态构建启动子突变库并进行筛选,验证得到50个、强度跨度约为600倍的组成型启动子文库;同时开发了更严谨的木糖诱导启动子;这些遗传操作工具有望促进甲醇芽孢杆菌的基础研究和应用发展。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention provides a method to improve the electroporation efficiency of *Bacillus methanolicus*. This invention enriches the genetic editing / modification tools for *Bacillus methanolicus*, including: efficient electroporation methods, genome knockout, knock-in, and point mutation editing methods, and promoter libraries. The addition of chemical reagents initially improves the electroporation efficiency of *Bacillus methanolicus* and simplifies the electroporation workflow. sfgfp The selected homologous recombination editing method can rapidly edit multiple genes by knocking out extracellular polysaccharide-related genes. glgC This further improves the competent state efficiency, achieving a competent state conversion efficiency as high as 3.5 × 10⁻⁶. 5 CFU / μg DNA. Promoter mutant libraries were constructed based on highly efficient competent cells, and 50 constitutive promoter libraries with an intensity range of approximately 600-fold were screened. Simultaneously, a more rigorous xylose-inducible promoter library was developed. These genetic manipulation tools are expected to promote the basic research and applied development of Bacillus methanolis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a method for improving the electroconversion efficiency of Bacillus methylformans. Background Technology

[0002] Methanol is an important carbon and energy feedstock in the chemical industry. Abundant raw material resources such as natural gas, coal, and biomass can be used to produce methanol from intermediate syngas. Considering methanol's low price and good availability, converting methanol into fuels and chemicals through chemical or biomanufacturing currently offers significant economic, environmental, and social advantages. Cellular factories capable of utilizing methanol are considered the core of methanol-based biomanufacturing. Among these, the heat-resistant, methanol-nutritive Gram-positive bacterium *Bacillus methanolicus* is a key component. B. methanolicus As a novel chassis cell, it has attracted increasing attention from researchers (Wang J, 2023, Green Chemical Engineering, 4(2): 199–211). However, Bacillus methanolicus has significant limitations in genetic manipulation, with low electroconversion efficiency and a lack of gene editing tools, which greatly hinders its development as a chassis cell.

[0003] Transforming exogenous DNA into bacterial cells is the first step in gene manipulation, but for Bacillus methanolii, the transformation method is a major bottleneck in genetic manipulation. Electroporation is a simple and reproducible process that instantly transfers exogenous nucleic acids into various bacteria via electrical discharge. However, electroporation efficiency is affected by a variety of factors, such as bacterial growth conditions and electroporation conditions. Therefore, it is necessary to explore key combinations of operational parameters to improve the electroporation efficiency of microorganisms. Another challenge in using Bacillus methanolii is the lack of gene editing tools. Although the CRISPRi repression tool based on dCas9 exists (Schultenkamper K, 2019, Applied Microbiology and Biotechnology, 103(14):5879–5889), the lack of genome editing methods, including homologous recombination, limits the ability to perform gene knockout, overexpression, and other genetic modifications on Bacillus methanolii.

[0004] Although it has been confirmed that *Bacillus methanolica* can transform plasmids via protoplasts, the protoplast transformation method is complex and inefficient. The electroporation technique developed by Jakobsen M et al. (Jakobsen Ø M, 2006, *Journal of bacteriology*, 188(8):3063–3072.) in 2006 is currently a commonly used method for transforming *Bacillus methanolica* plasmids. However, this electroporation technique is time-consuming and has low transformation efficiency compared to electroporation techniques for other strains. The low electroporation efficiency of *Bacillus methanolica* has also affected the research on the *sfgfp* mutant by Frenzel E et al. (Frenzel E, 2018, *Biotechnology for Biofuels*, 11: 8). Researchers have attempted to... P. thermoglucosidasius DSM2542 B. smithii DSM4216 B. coagulans DSM1, G.thermodenitificans T12 and B. methanolicus Several thermophilic bacteria were studied for their effects on the sfgfp mutant, but due to the low efficiency of transformation, multiple transformation attempts failed to yield relevant transformants for Bacillus methanolis. According to a study by Cue D et al., Bacillus methanolis carries the restriction nuclease BmeTI, which recognizes the DNA sequence 5'-TGATCA-3', and DNA modified with specific methylation (TGm6ATCA) is considered to be more readily transformed into protoplasts in Bacillus methanolis MGA3 (Cue D, 1996, Applied and Environmental Microbiology, 62(3): 1107–1111).

[0005] Besides low electroporation efficiency, another limitation is the lack of gene editing tools. Currently, only the CRISPRi repression tool, developed by Schultenkämper K et al. in 2019, is available. CRISPRi is used in research to target genes. mtlD hour, mtlDRNA levels decreased to approximately 50% (Schultenkamper K, 2019, Applied Microbiology and Biotechnology, 103(14): 5879–5889). No gene editing tools have been reported for Bacillus methanolicus. The lack of genome modification tools prevents researchers from performing routine genetic operations such as gene knockout and overexpression. Furthermore, the only promoters currently reported in the literature are the mdh constitutive promoters of the genome (Jakobsen Ø M, 2006, Journal of bacteriology, 188(8): 3063–3072.), and promoters derived from… B. megaterium xylose-induced P xylA Promoters and the autologous mannitol-inducible promoter P mltR A lack of promoters (Irla M, 2016, Frontiers in Microbiology, 7: 1481) also affects the precise regulation of gene expression intensity. Summary of the Invention

[0006] The purpose of this invention is to provide a method for improving the electroconversion efficiency of Bacillus methylmercurate.

[0007] To achieve the objective of this invention, in a first aspect, this invention provides a method for improving the electroconversion efficiency of Bacillus methylmercurate, wherein the method is selected from at least one of ① to ⑤: ① In the preparation of Bacillus methanolis ( Bacillus methanolicus Add cell wall weakening agents glycine and threonine to competent cells; ② The constructed recombinant plasmid (such as the homologous recombinant plasmid) is first transformed into *Bacillus thermoglucosidase* (Bacillus). Parageobacillus thermoglucosidasius In the process, plasmids were extracted and then transformed into Bacillus methanolii; ③ The starting vector used to construct the homologous recombination plasmid is the thermosensitive replicon RepB, ​​and the homologous recombination plasmid contains the sfGFP reporter gene; ④ Knock out the gene of Bacillus methanolis glgC Among them, genes glgC The reference sequence number in NCBI is BMMGA3_13730; ⑤ The expression of the target gene is driven by a constitutive promoter or a xylose-inducible promoter; the sequence of the constitutive promoter is shown in any one of SEQ ID NO:1-51, and the sequence of the xylose-inducible promoter is shown in any one of SEQ ID NO:52-102.

[0008] Preferably, the method is a combination of ①, ②, ③, ④ and ⑤.

[0009] Furthermore, step ① includes the following steps: a) After activation, Bacillus methanolicus was inoculated into SOBsuc medium and cultured at 40-60℃ until OD500 reached. 600 When the concentration is 1.0-3.0, add glycine (preferably 2%) to the culture medium at a final concentration of 0.2-3% (preferably 1.5%) and threonine (D-threonine, L-threonine, or DL-threonine) at a final concentration of 0.2-3% (preferably 1.5%), continue culturing for 0.5-2 hours, and then centrifuge to collect the bacterial cells. The SOBsuc medium was prepared as follows: 20 g / L tryptone, 5 g / L yeast extract, 0.186 g / L potassium chloride, 0.5 g / L sodium chloride and 0.95 g / L magnesium chloride, adjusted to pH 7.0, and 8.4 g / L sucrose was added after sterilization. b) Resuspend the bacterial cell pellet in SMGT buffer and collect the bacterial cells by centrifugation; The SMGT buffer solution comprises: 0.5 M sorbitol, 0.5 M mannitol, 0.5 M trehalose, and 10% v / v glycerol. c) Repeat step b) 1-6 times (preferably 3 times), and finally resuspend the bacterial cells in SMGT buffer to obtain competent cells.

[0010] Furthermore, the method for constructing the homologous recombination plasmid described in ③ includes: Using primers pBMe01-V1-F and pBMe01-V1-R, the pUB-sfgfp plasmid (provided by Wang Weishan's laboratory at the Institute of Microbiology, Chinese Academy of Sciences) was extracted. Microbial Biotechnology DNA fragment I containing sfgfp and colE ori was amplified from pZL02 plasmid (provided by Wang Weishan's laboratory at the Institute of Microbiology, Chinese Academy of Sciences) using primers pBMe01-V2-F and pBMe01-V2-R (Yang, Z.). Synth Syst Biotechnol In 2024, 9 (4), 658-666, DNA fragment II containing the RepB replicon and kanamycin resistance gene was amplified; after purification, DNA fragments I and II were recombined in vitro using recombinase to obtain homologous recombinant plasmids. The sequences of the primers pBMe01-V1-F and pBMe01-V1-R are as follows: pBMe01-V1-F: TGTGCTGCAAGGCGATTAA pBMe01-V1-R:CCATTTTGAACGATGACCTC The sequences of the primers pBMe01-V2-F and pBMe01-V2-R are as follows: pBMe01-V2-F:GAGGTCATCGTTCAAAATGGTATGCGTTTTGACACATCCACTAT pBMe01-V2-R:TTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG.

[0011] Furthermore, in step ④, homologous recombination was used to knock out the gene of Bacillus methanolii. glgC .

[0012] Preferably, the homologous recombination plasmid constructed in step ③ is used for gene sequencing. glgC Knockout.

[0013] Furthermore, after plasmid transformation, the transformed strain was cultured at 60°C to promote homologous recombination.

[0014] Preferably, the sequence of the xylose-inducible promoter described in ⑤ is shown in SEQ ID NO:102.

[0015] In this invention, the preferred conditions for electroconversion are: the concentration of competent cells OD 600 =10-60 (preferably 30), electric shock conditions are 1.5-3 kV / cm (preferably 2.5 kV / cm), 200 Ω, 0.1 cm electric rotary cup.

[0016] Furthermore, the electrotransformed competent cells were cultured in TGP resuscitation medium at 40-60 °C and 180-250 rpm (preferably 50 °C and 200 rpm) for 0.5-20 hours (preferably 2-3 hours), and then directly plated to select transformants.

[0017] The TGP resuscitation solution contains the following components: 1.7 g / L peptone, 0.4 g / L glycerol, 0.3 g / L soybean peptone, 0.25 g / L glucose, 0.25 g / L K2HPO4, 0.5 g / L sodium chloride, and 0.4 g / L sodium pyruvate.

[0018] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention enriches the genetic editing / modification tools for *Bacillus methanolicus*. Specifically, it includes: efficient electroporation methods, genome knockout, knock-in, and point mutation editing methods, and promoter libraries. The addition of chemical reagents has initially improved the electroporation efficiency of *Bacillus methanolicus* and simplified the electroporation workflow. sfgfpThe selected homologous recombination editing method can rapidly edit multiple genes by knocking out extracellular polysaccharide-related genes. glgC This further improves the competent state efficiency, achieving a competent state conversion efficiency of up to 3.5 × 10⁻⁶. 5 CFU / μg DNA. A promoter mutant library was constructed and screened based on highly competent cells, yielding a constitutive promoter library of 50 molecules with a strength range of approximately 600-fold. Simultaneously, a more robust xylose-inducible promoter was developed. These genetic manipulation tools are expected to promote basic research and applied development in Bacillus methanolis. Attached Figure Description

[0019] Figure 1 In a preferred embodiment of the present invention B. methanolicus Optimization of MGA3 electroconversion: (a) Comparison of competent cell preparation and electroconversion methods. (b) Effects of threonine (Thr) and glycine (Gly) concentrations and addition time on conversion efficiency. (c) Effect of competent cell concentration on electroconversion efficiency. (d) Effect of electroporation field strength on efficiency. (e) Effect of resuscitation medium on efficiency.

[0020] Figure 2 In a preferred embodiment of the present invention, *Bacillus thermoglucosidase* is used as an intermediate host to improve MGA3 transformation efficiency. (a) Schematic diagram of electroporation. Plasmids from *Escherichia coli* are... B. methanolicus Degradation by restriction endonucleases, and from P. thermoglucosidasius The plasmids were modified and evaded degradation. (b) Escherichia coli and P. thermoglucosidasius Transformation efficiency of plasmids at different sizes (5 kb, 9 kb, 12 kb). .

[0021] Figure 3 In a preferred embodiment of the present invention mutS A schematic diagram of a gene knockout plasmid.

[0022] Figure 4 This invention provides a preferred embodiment of a method for editing the MGA3 gene of Bacillus methanolis using sfGFP reverse selection markers. (a) Schematic diagram of single crossover recombination (SCR) of the temperature-sensitive plasmid pBMe01 at 60°C. Integration occurs via upstream or downstream homologous regions. (b) PCR verification of SCR confirms integration via the upstream homologous region. (c) Double crossover recombination (DCR) selection workflow. SCR strains are screened on kanamycin plates at 50°C, and DCR is promoted in kanamycin-free liquid medium at 60°C, followed by non-fluorescent colony identification. (d) Left: Schematic diagram of mutS gene knockout. Wild-type (WT) strains are shown. mutSThe gene was detected, while the ΔmutS strain showed a deletion of the mutS gene. Right figure: M: DNA mark, Con: wild-type negative control, 1-4: knockout double crossover verification.

[0023] Figure 5 In a preferred embodiment of the present invention glgC Knockout validation. M: DNA marker, C: wild-type negative control, 1-8: knockout double crossover validation.

[0024] Figure 6 In a preferred embodiment of the present invention B. methanolicus wild type and glgC Transmission electron microscope image of the knockout strain.

[0025] Figure 7 Knockout in a preferred embodiment of the present invention glg Comparison of receptive state efficiency.

[0026] Figure 8 This is the design of a promoter mutation library in a preferred embodiment of the present invention.

[0027] Figure 9 This invention relates to the construction of a promoter mutation library in Escherichia coli in a preferred embodiment of the present invention.

[0028] Figure 10 This invention relates to a preferred embodiment of promoter strength detection and promoter mutation sequence based on plate screening.

[0029] Figure 11 This invention relates to a preferred embodiment of promoter strength detection and promoter mutation sequence screening based on flow cytometry.

[0030] Figure 12 In a preferred embodiment of the present invention, a rigorous xylose-induced promoter is obtained based on the modification of a constitutive strong promoter.

[0031] Figure 13 This invention relates to a preferred embodiment of RibC(G199D) point mutation gene editing.

[0032] Figure 14 In a preferred embodiment of the present invention purE Sequencing results of promoter insertion and substitution. Detailed Implementation

[0033] To address the low electroporation efficiency and lack of gene editing tools in Bacillus methanolii, this invention develops a series of fundamental genetic tools to overcome these challenges. These include improving electroporation efficiency, developing homologous recombination gene editing methods, and constructing and screening promoter libraries to obtain promoters of varying strengths for regulating the expression levels of target genes. This series of tool developments addresses the bottleneck issue of the lack of editing tools for this chassis cell.

[0034] This invention provides a highly efficient method for preparing and electroporating competent cells of *Bacillus methanolicus*. Furthermore, it utilizes these highly competent cells to construct a promoter library, screens for constitutive promoters of varying strengths, and modifies rigorously inducible promoters. Finally, it develops a fluorescent protein-assisted homologous recombination gene editing method. This invention is the first to develop a gene editing tool in *Bacillus methanolicus* capable of knockout, point mutation, and knock-in of target genes. This will greatly promote basic research on the gene function and genetic characteristics of *Bacillus methanolicus* and the industrialization of this bacterium as an engineered organism.

[0035] The present invention adopts the following technical solution: 1. Targeting B. methanolicus The problems of low electro-conversion efficiency and cumbersome procedures were addressed through comparative analysis and optimization of experimental steps, resulting in a significant improvement. B. methanolicus The conversion efficiency and competent cell preparation efficiency were then optimized by adding a cell wall weakening agent. B. methanolicus The optimal addition amount and time were found through orthogonal experimental design to improve the competent state efficiency, which significantly improved the electroconversion efficiency.

[0036] 2. The thermoglucosidase-producing Bacillus subtilis was discovered and confirmed through experiments. P. thermoglucosidasius Transformation strategies using intermediate hosts can further improve the transformation efficiency of large plasmids.

[0037] 3. Homologous recombination technology was successfully developed using temperature-sensitive replicons and sfGFP, enabling gene knockout, point mutation, and knock-in, thus providing a basis for... B. methanolicus It provides effective tools and methods for genetic engineering and genetic manipulation.

[0038] 4. Using homologous recombination technology, key genes affecting competent cell efficiency were successfully knocked out. glgC This further enhanced B. methanolicus The efficiency of the receptive state.

[0039] 5. A library containing promoter elements ranging from weak to strong, with an intensity span of approximately 600 times, was constructed, providing a wealth of tools for subsequent gene expression and regulation. Simultaneously, a more robust xylose-inducible promoter was developed, exhibiting a 57% reduction in leakage expression and a 114% increase in maximum induction intensity compared to previously reported xylose-inducible promoters derived from Bacillus megaterium. The construction and screening of constitutive promoter mutant libraries, along with the development of robust inducible promoters, provide a rich set of promoter elements for fine-tuning gene expression regulation, offering valuable resources for future research.

[0040] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0041] Bacillus methanolis used in the following examples B. methanolicus The strain is MGA3 (ATCC 53907).

[0042] Example 1: Optimizing electrotransfer methods to improve competent state efficiency Electroconversion is a widely used, simple, and efficient method for genetic manipulation. Although Øyvind M. Jakobsen et al. (Jakobsen Ø M, 2006, Journal of bacteriology, 188(8): 3063–3072.) had previously developed a method suitable for... Bacillus methanolicus Electroconversion methods exist, but they have significant limitations, such as low yields of competent cells (due to the low OD yield). 600 The previous methods involved harvesting cells at 0.25 μL, yielding only about 2 competent cell samples per batch, and a long recovery time after electroporation (exceeding 20 hours due to low conversion efficiency). To overcome these issues, we developed an optimized approach that increases the yield of competent cells (more than 20 cells per batch) by harvesting at the optimal growth stage and shortens the recovery time after electroporation to approximately 2 hours. This improved method enables a faster and more efficient experimental workflow. Figure 2 a).

[0043] 1. Improve competent cell efficiency by adding cell wall weakening agents. As an indispensable element in bacterial composition, peptidoglycan occupies a core position in the cell wall, and its amino acid chains mainly involve alanine, glutamic acid, and lysine. However, due to the high structural similarity between glycine and threonine and alanine, the addition of glycine and threonine to the culture medium may interfere with the formation of peptide bridges in peptidoglycan, thereby affecting the compactness of the Gram-positive bacterial cell wall. This interference can, to some extent, enhance the electroconversion capacity of Gram-positive bacteria. Therefore, this invention first tested the addition amounts of glycine and threonine. Since excessive addition time may affect cell viability, the addition time was also optimized.

[0044] The strain was cultured in SOBsuc liquid medium (20 g / L tryptone, 5 g / L yeast extract, 0.186 g / L potassium chloride, 0.5 g / L sodium chloride, 0.95 g / L magnesium chloride, pH adjusted to 7.0, sterilized and then supplemented with 8.4 g / L sucrose) and cultured at OD... 600 When the concentration of glycine and threonine is 1.8-2.0, the bacteria are harvested to prepare competent cells. To test the amount and timing of glycine and threonine addition, an orthogonal array L9(3) was used. 3 The experimental conditions were designed with three factors and three levels. Except for the test factor, the other conditions were set as follows: electric shock intensity 1.8 kV / cm, resuscitation fluid TSB.

[0045] Experimental results are as follows Figure 1 As shown in b, both excessively long and short addition times affect competent cell efficiency, with the highest efficiency observed at an addition time of 1 hour. In the 9 experimental groups tested, the optimal addition amounts of glycine and threonine were 2% and 1.5%, respectively, with an addition duration of 1 hour. At this time, the competent cell efficiency reached 3 × 10⁻⁶. 2 CFU / μg DNA, meaning that transforming 1 μg of plasmid yields approximately 300 single clones. The electroporation method was optimized. The literature reports a method of culturing in antibiotic-free resuscitation medium for 16 hours after electroporation, followed by transfer to antibiotic-resistant medium for 6 hours of growth, and finally plate-plating to select single clones. In this experiment, this was simplified to electroporation followed by 2 hours of incubation in antibiotic-free resuscitation medium before direct plate-plating, significantly reducing operation time.

[0046] 2. Improve competent cell efficiency by optimizing competent cell concentration, electroporation field strength, and resuscitation solution. Besides cell wall weakening agents, several other common factors affect competent cell efficiency, including competent cell concentration, electroporation field strength, and resuscitation fluid composition. Therefore, we will test these other factors sequentially. First, we will test the concentration of competent cells using optical density (OD). 600 As a parameter. The results showed that when the concentration of competent cells increased to OD 600When the value is 30, the conversion frequency increases to 7 × 10⁻⁶. 2 CFU / μg DNA. Both higher and lower concentrations reduced the efficiency of competent cells. Figure 1 c). Furthermore, a shock intensity of 2.5 kV / cm produces the highest conversion efficiency, which is 4 × 10⁻⁶. 3 CFU / μg DNA, but the transformation efficiency decreases at higher voltages ( Figure 1 d).

[0047] When testing the components of the resuscitation solution, it was found that using TGP resuscitation solution (1.7 g / L peptone, 0.4 g / L glycerol, 0.3 g / L soybean peptone, 0.25 g / L glucose, 0.25 g / L K₂HPO₄, 0.5 g / L sodium chloride, 0.4 g / L sodium pyruvate) significantly increased the conversion efficiency, reaching 1.2 × 10⁻⁶. 4 CFU / μg DNA ( Figure 1 e). Based on the test results, OD 600 = 30, 2.5kV / cm and TGP are the optimal cell concentration, electric field strength and resuscitation medium for competent cells, respectively.

[0048] 3. Optimized method for preparing and transforming highly competent Bacillus methylformans cells First, *Bacillus methanolica* was passaged on TSA antibiotic-free plates. After three consecutive generations of single-clone passages, the cells were brought to optimal condition. Then, 3-4 well-grown single clones were transferred to shake tubes containing 5 mL of LB medium (LB medium supplemented with 0.59 mM MgSO4·7H2O, 0.91 mM CaCl2·2H2O, and 0.04 mM FeSO4·7H2O, respectively) and incubated at 50 °C for 12 hours. Then, all 5 mL of the culture medium was transferred to a 250 mL Erlenmeyer flask containing 50 mL of SOBsuc medium and incubated at 50 °C for 4-6 hours. OD was then measured. 600 When the culture temperature reaches approximately 1.8, add 0.75 g of threonine and 1 g of glycine to the culture medium. Continue culturing for another hour, maintaining a low temperature and operating on ice throughout the entire process. Collect the bacteria by centrifuging at 6000 g for 5 min using a pre-chilled centrifuge at 4 °C. Discard the supernatant, and gently resuspend the bacterial pellet in 5 mL of SMGT buffer (0.5 M sorbitol, 0.5 M mannitol, 0.5 M trehalose, 10% v / v glycerol) stored at 4 °C. Centrifuge at 8000 g for 15 min to collect the bacteria and resuspend again. Repeat this process three times. Finally, resuspend in 600 μL of SMGT buffer, aliquot into 60 μL vials, and store at -80 °C.

[0049] Before transformation, first thaw the competent cells slowly on ice. Then, add 1-200 ng of the target plasmid depending on its size, gently pipette to mix, and then add the mixture to a pre-chilled 0.1 cm electroporation cuvette, taking care to avoid generating air bubbles. Set the electroporator to 2.5 kV / cm, 200 Ω, and immediately after one electroporation, add 1 mL of preheated TGP medium. Transfer the mixture to a 10 mL centrifuge tube and incubate at 50 °C, 200 rpm for 2-3 hours. Centrifuge to resuspend the bacterial culture and spread it entirely onto plates containing the appropriate antibiotic. Incubate at 52 °C for 16-24 hours.

[0050] Experimental results show that the optimized electroconversion method significantly saves time and cost, enabling rapid preparation and transformation of competent cells. Based on a 10-fold reduction in electroconversion recovery time (from 20 hours to 2 hours), approximately 10... 4 Higher electroconversion efficiency of CFU / μg DNA.

[0051] Example 2: Using Bacillus pyrogallolase as an intermediate host to improve transformation efficiency B. methanolicus The low transformation efficiency may be partly attributed to the restriction modification system (RM), which mainly comprises two classes of corresponding enzymes: restriction endonucleases (REases) and DNA methyltransferases (MTases). This system is part of the bacterial defense mechanism. Restriction endonucleases defend against the threat of foreign genetic material by recognizing and precisely cleaving specific sequences on invading foreign DNA; simultaneously, DNA methyltransferases are responsible for adding methylation modifications at the same sequences on the host genome to prevent restriction enzymes from accidentally cleaving their own DNA. While this protective mechanism is essential for the bacteria themselves, it may reduce the transformation efficiency of foreign DNA during genetic manipulation in the laboratory.

[0052] Therefore, in order to further improve the efficiency of competent states, we first... B. methanolicus The system uses a restricted modification mechanism for prediction. A query was performed using the REBASE website, and the results were found in... B. methanolicus A type II DNA methyltransferase (BMMGA3_07270) was obtained from the strain's genome, and another type II DNA methyltransferase (BMMGA3_RS16370) and a corresponding type II restriction endonuclease recognizing the same sequence were predicted on the strain's large plasmid pBM69. Therefore, it is hypothesized that knocking out the restriction endonuclease expression genes within the strain may help improve competent cell efficiency. However, due to current limitations... B. methanolicus Since gene knockout tools are unavailable, we attempted to analyze samples from other thermophilic bacteria that are closely related. P. thermoglucosidasiusDoes the strain contain homologous proteins of DNA methyltransferase?

[0053] By utilizing the KEGG database P. thermoglucosidasius The genome was aligned with amino acid sequences, and the sequence was successfully... B. methanolicus BMMGA3_RS16370 and P. thermoglucosidasius The homologous protein BCV53_09510 was matched, with an E value of 9e-22; meanwhile, BMMGA3_07270 also found a corresponding homologous protein BCV53_09515, with an E value of 5e-05. This comparison result indicates that... P. thermoglucosidasius There exists in B. methanolicus Similar restrictive modification systems indicate that they were borrowed or utilized. P. thermoglucosidasius The restricted modification system may be able to improve experimental performance. B. methanolicus The high plasmid conversion efficiency provides more possibilities for its engineering modification and application.

[0054] In order to explore P. thermoglucosidasius To investigate whether restriction modification systems help improve plasmid transformation efficiency, this section designs a series of experiments to evaluate their effect on the transformation efficiency of plasmids of different sizes. The first step of the experiment involves plasmid transformation and extraction. P. thermoglucosidasius It is a Gram-positive bacterium with a thicker cell wall than *E. coli*, which may affect the plasmid extraction process. Therefore, the plasmid extraction process was optimized, particularly by increasing the amount of lysozyme used and extending the treatment time to 30 min to improve the cell wall dissolution efficiency. This step ensured the efficient extraction of plasmids from the bacterial cells. After ensuring the plasmid extraction was successful, the plasmids from... P. thermoglucosidasius A series of transformation efficiency tests were conducted on the plasmids, including the aforementioned plasmids of different sizes. Experimental results showed that, compared to plasmids obtained directly from *E. coli*, transformation through... P. thermoglucosidasius Plasmids transformed using intermediate hosts showed a significant improvement in transformation efficiency. Particularly for larger plasmids (approximately 12 kb in size), a stable yield of 5-8 single clones per transformation was observed. This finding provides a potential strategy for improving the transformation efficiency of large plasmids. Figure 2 ).

[0055] Example 3: Establishment of an sfGFP-assisted homologous recombination method 1. Design and construction of edit plasmids exist B. methanolicus Select mutSThe gene (BMMGA3_06540) was used as a test gene for homologous recombination knockout. First, a plasmid containing 3 kb left and right homologous arms was designed and constructed to facilitate efficient homologous recombination. To facilitate screening for recombination events, the plasmid also included a reporter gene expressing sfGFP, and the thermosensitive replicon RepB was selected as the plasmid vector for homologous recombination. Figure 3 This temperature-sensitive replicon is in P. thermoglucosidasius It has been shown to promote homologous recombination single exchange events at 68 °C. Given... B. methanolicus Growth may be significantly affected at temperatures above 60 °C, and studies have shown that RepB replicons have a certain probability of being lost at 60 °C. Therefore, 60 °C was chosen as the culture temperature to promote homologous recombination. In this case, the instability of temperature-sensitive replicons can be utilized to promote homologous recombination.

[0056] The specific plasmid construction method is as follows: The construction process of the backbone plasmid pBMe01 is as follows: First, using primers pBMe01-V1-F / R (TGTGCTGCAAGGCGATTAA / CCATTTTGAACGATGACCTC), the plasmid is constructed from pUB-sfgfp (Yang Zhiheng; Microbial Biotechnology DNA fragments containing the sfgfp and colE ori regions were amplified from pZL02 plasmid (Yang, Z.) using primers pBMe01-V2-F / R (GAGGTCATCGTTCAAAATGGTATGCGTTTTGACACATCCACTAT / TTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG). Synth Syst Biotechnol A DNA fragment containing the RepB replicon and kanamycin resistance gene was amplified in (2024, 9 (4), 658-666.). KOD One was used to amplify the fragment. TM PCR Master Mix was used for amplification, and the amplification reaction program was performed according to the polymerase's instruction manual. The extension time per kb of DNA was set to 1 min. The specific thermal cycling conditions were as follows: initial denaturation phase at 98 °C for 3 min; denaturation temperature at 98 °C for 10 seconds per cycle, annealing temperature at 60 °C for 5 seconds per cycle, extension temperature at 68 °C for 1 min per kb, and the final extension phase at 68 °C for 3 min. After purification, these two DNA fragments were recombined in vitro using NovoRec Plus recombinase to construct the pBMe01 plasmid (sequence shown in SEQ ID NO:103).

[0057] For the construction of genome editing plasmids (to knock out) mutS Taking gene plasmids as an example, firstly, primer pairs mutS-LF / mutS-LR (GGATCTTCACCTAGATCCTTTTAAATTATGGCGAGGAAATATACACGTG / ATTATTTCGATTAATATCCCCCAATATTCTAATCTATCAATTCTTTTTTAC) and mutS-RF / mutS-RR (AGAATATTGGGGGATATTAATCGAAATAATTAAACATATTTCAGCAGGAGG / AAGTTTACTCATATATACGGAAATCATGTGCTTGCGGTAGG) are used to extract... B. methanolicus Amplification in the genome mutS Homologous arms of the gene. The plasmid backbone DNA was amplified using primer pairs pUB31-donor-VF (CCGTATATATGAGTAAACTTGGTCTGACAG) and pUB31-donor-VR (TAAAAGGATCTAGGTGAAGATCCTTTTTG). The amplification reaction was performed using KOD One. TM The PCR Master Mix was used under the same conditions as described above. The size of the PCR products was checked using agarose gel electrophoresis. After confirming the correct band size, the target DNA fragment was purified by gel extraction according to the kit's instructions. The purified DNA fragment was then added to the NovoRec Plus recombinase system for one-step in vitro recombination. The recombination system and reaction conditions were as follows: 1 μL of NovoRec Plus recombinase, 4 μL of reaction buffer, 2 μL of each DNA fragment, and 11 μL of sterile water were added to the reaction system to bring the total volume to 20 μL. The mixture was then incubated at 50 °C for 30 min to complete the recombination. Next, *E. coli* JM109 competent cells were removed from the -80 °C freezer and thawed on ice. The completed in vitro recombination reaction mixture was added to these cells, and the cells were treated according to the *E. coli* transformation method. After single colonies grew, colony PCR and subsequent sequencing analysis were performed using the corresponding validation primers donor-ver-F (GATCTTTTCTACGGGGTCTG) and donor-ver-R (CCATTTTGAACGATGACCTC) to validate the target. mutS The gene knockout plasmid was correctly constructed, and sequencing confirmed that the gene knockout plasmid did not introduce additional sequence mutations.

[0058] 2. Establish a homologous recombination editing method In order to B. methanolicus To ensure successful gene knockout or insertion, homologous recombination is performed using a series of steps. First, a plasmid containing a specific homologous arm is transformed into... B. methanolicus In this process, the design of homologous arms is intended for precise editing of the target gene, enabling gene knockout, point mutation, or insertion through homologous recombination. After plasmid transformation, the transformed strains are cultured on plates containing the corresponding antibiotic resistance marker at 50 °C until single-clonal growth is observed. This step aims to screen for successfully transformed single clones. Subsequently, the single clones are transferred to another plate containing the same antibiotic resistance marker using a four-zone streak method and cultured at 60 °C to promote homologous recombination.

[0059] After incubation at 60 °C, weakened fluorescence signals were observed in some of the grown single clones, suggesting a possible reduction in plasmid copy number or homologous recombination. To confirm this observation, specific PCR primers were designed, located on the outer side of the homologous arm of the target gene and on the corresponding opposite side, specifically capable of detecting single crossover events. Figure 4 a).

[0060] PCR results showed that the expected single crossover event occurred in some monoclonal clones. The decrease in the size of the PCR band helps to determine whether a single crossover occurred on the left or right homologous arm. Figure 4 As shown in b, the PCR results indicate that homologous recombination successfully occurred in a certain proportion of monoclonal clones. These results demonstrate that... B. methanolicus Homologous recombination is feasible in this study. Next, antibiotic-free relaxation culture is used to promote double crossover, thereby achieving precise editing of the target gene.

[0061] First, the confirmed single crossover strain was inoculated into antibiotic-free liquid medium and cultured at 50 °C. This step allows the strain to proliferate without antibiotic selection pressure, creating conditions for the natural occurrence of double crossover events. Once the bacterial culture becomes turbid, indicating that the cell density has reached a certain level, the culture is transferred and the culture temperature is adjusted to 60 °C. At this temperature, the temperature-sensitive replicons that promote homologous recombination are unstable, thus increasing the likelihood of double crossover events and simultaneous plasmid loss. After culturing at 60 °C until turbidity reappears, the bacterial culture is serially diluted and plated on antibiotic-free plates, and cultured at 50 °C. This step is to isolate individual colonies, allowing for more precise identification of single and double crossover events.

[0062] Observing whether colonies fluoresce helps in the initial screening of strains that may have completed a double crossover. Typically, strains that do not fluoresce indicate that the plasmid has been lost, a key indicator of a double crossover event. Subsequently, a subset of the non-fluorescing colonies is selected for antibiotic susceptibility testing to verify whether these strains have lost the resistance genes originally provided by the plasmid. The results showed that the vast majority of non-fluorescing strains also lacked antibiotic resistance, further indicating that a double crossover event may have occurred. Figure 4 c).

[0063] To definitively confirm the success of the double crossover event, a subset of the selected antibiotic-free strains were subjected to PCR verification. This step ensured that the target gene had been precisely knocked out or replaced, and that the foreign plasmid had been completely removed from the strain. The results showed that approximately 80% of these strains successfully completed the double crossover, yielding the target gene. mutS Knockout strains ( Figure 4 d).

[0064] Example 4: Knocking out extracellular polysaccharide-related genes further improves competent cell efficiency. Using editing methods to produce extracellular polysaccharides glgC Gene knockout. Targeted glgC The method for constructing the gene knockout (BMMGA3_13730) edit plasmid is as follows: Using the pBMe01 backbone plasmid as a template, pUB31-donor-VF (CCGTATATATGAGTAAACTTGGTCTGACAG) and pUB31-donor-VR (TAAAAGGATCTAGGTGAAGATCCTTTTTG) were used as forward and reverse primers, respectively, and the backbone DNA was amplified using KOD One DNA polymerase. The amplification reaction procedure followed the instructions accompanying the polymerase, with the extension time per kb of DNA set at 1 min. The specific thermal cycling conditions were as follows: the initial denaturation phase was set at 98 °C for 3 min; each cycle consisted of denaturation at 98 °C for 10 seconds, annealing at 60 °C for 5 seconds, extension at 68 °C for 1 min per kb, and the final extension phase at 68 °C for 3 min.

[0065] by B. methanolicusUsing the genome as a template, primer combinations of glgC-LF (ATCTTCACCTAGATCCTTTTAGGAACCTGAACCGCTAAATCG), glgC-LR (GTAAAATCATAATCGGGAGGGACTTC), glgC-RF (CCTCCCGATTATGATTTTACCTAAGCCTGCTCCCTTTCCC), and glgC-RR (ACCAAGTTTACTCATATATACGGCGGTTCGATTCCGTCCC) were used for amplification. glgC Upstream and downstream homologous arms of the gene. The amplification reaction was performed using KOD One. TM PCR MasterMix was used under the same reaction conditions as before. The same editing method was employed to... glgC The gene was knocked out, and the result was verified by PCR and sequencing. glgC Gene knockout strains ( Figure 5 ).

[0066] Based on previous research and theoretical deductions, it is assumed that... glgC Theoretically, knocking out these cells would affect the production of extracellular polysaccharides, thereby altering bacterial morphology and transformation efficiency. To verify this hypothesis, transmission electron microscopy (TEM) was used to observe cell morphology. TEM imaging results showed typical characteristics of wild-type cells: they were rod-shaped, dispersed, and not adherent to each other, indicating good cell health and normal extracellular polysaccharide production. Figure 6 More specifically, most wild-type cells were surrounded by a translucent layer of extracellular polymers on their surface, indicating the presence of abundant extracellular polysaccharides. Knockout cells... glgC The strain with the gene (i.e., Bme-01) exhibited significantly different morphological characteristics. The most significant difference lies in ∆ glgC The cell surface lacks that characteristic layer of translucent extracellular polymeric material (...) Figure 6 Furthermore, this phenomenon is consistent with the morphological changes observed in strains with knocked-out corresponding homologous protein genes under similar conditions reported in other studies (Huang H, 2021, FEMS Microbiology Letters, 368(9): fnab049), indicating the reliability of this finding. Based on these observations, it is further speculated that knockout strains may affect bacterial electroconversion efficiency by reducing extracellular polysaccharides.

[0067] The receptive state efficiency test results show that the receptive state efficiency of Bme-01 has been improved to 3.5 × 10⁻⁶. 5 CFU / μg DNA ( Figure 7 This result is significantly higher than that of the wild type. B. methanolicus The receptive efficiency is also the highest reported to date. B. methanolicus The highest competent cell efficiency. This significant improvement in competent cell efficiency means that researchers can more easily introduce foreign genes into the genome during gene manipulation and plasmid transformation. B. methanolicus This greatly reduces the obstacles caused by low plasmid transformation efficiency, which is helpful for the development of gene editing tools and the development and application of high-throughput editing methods.

[0068] Example 5: Construction and Screening of Promoter Mutant Libraries Through a series of studies, including optimizing competent cell preparation and electroporation methods, as well as carefully designed gene knockout strategies, it has now been successfully achieved that... B. methanolicus The conversion efficiency was increased to 3.5 × 10⁻⁶. 5 CFU / μg DNA. This lays the foundation for the application of this strain in genetic engineering. However, despite the development of editing methods, B. methanolicus It still faces the problem of a lack of promoter and other genetic element libraries, which limits its further application in synthetic biology.

[0069] To address this challenge, based on existing... B. methanolicus Using a highly efficient competent cell platform, this study further constructed a promoter mutation library. In previous work, by using… Promoter-driven sfGFP reporter genes have been demonstrated to... B. methanolicus Effective gene expression can be achieved in this medium, and obvious fluorescence signals were observed under a confocal laser scanning microscope. Therefore, [the medium was selected]. Starting with promoters, the promoter library is enriched through random mutation. Specifically, two key regions of the promoter are selected: the region between the -35 and -10 regions, and the region between the -10 region and the ribosome binding site (RBS). Figure 8 ) Build a library. These two regions have a certain influence on promoter activity. Therefore, by introducing random mutations into these regions, it is expected that a series of promoter variants with different expression intensities can be generated.

[0070] First, random mutations were introduced into these key regions using designed primers, and plasmid libraries were constructed in *E. coli*. To improve the coverage of the mutant libraries, mutant libraries were constructed separately for each region. This method allows for the rapid construction of a large number of promoter variants, which helps to improve the efficiency of screening for effective promoter variants. Finally, as shown in the figure, a large number of plasmid libraries containing promoter mutations were obtained in *E. coli*. Figure 9To screen promoters, the library plasmid was first transformed into the Bme-01 strain. Single clones grown on plates were selected based on fluorescence intensity, and then plate-transferred to different strengths. These clones were then cultured in test tubes, and the fluorescence intensity of sfGFP was tested. This method successfully obtained promoter variants of varying strengths from the original promoter. The weakest promoter was approximately 100 times weaker than the original promoter. Figure 10 In this study, the normalized fluorescence intensity of the original promoter was used as a reference, and the percentage of detected mutant fluorescence intensity was compared with it. The figure below shows the corresponding promoter mutation sequence obtained from sequencing. The fluorescence detection was performed in three biological replicates, and the mean and standard deviation are shown.

[0071] Since plate-based screening did not yield stronger promoters, flow cytometry was used for fluorescence intensity-based screening in the next step. The results showed that the bacterial culture containing the library plasmid exhibited a wider fluorescence distribution range than the control culture during flow cytometry, indicating a significant difference in promoter intensity. The most fluorescent subsets were selected during the sorting process, with a sorting ratio of approximately 0.1%. After flow cytometry screening, plate culture, and subsequent in vitro culture, the fluorescence intensity of the selected mutants was observed to be superior to that of the original promoter. The expression intensity of the strongest mutant promoter was 2.3 times that of the original promoter. Figure 11 This series of experiments ultimately yielded a library of different promoter elements, ranging from weak to strong with an intensity span of approximately 600 times.

[0072] Given the Modification of the promoter significantly improved its constitutive activity. Figure 11 We speculate Promoters can be used to construct enhanced xylose-inducible promoters. Constitutive activity is achieved by truncating the original xylose-inducible pxylA promoter to disrupt the binding site (xylO) of the XylR repressor protein. Therefore, the most active constitutive promoter obtained through screening is pH27 (…). Figure 12 Introducing the binding sequence of xylR (5′-TTTGTTTGTACACTAGACAAACAAA-3′) into the formula can theoretically restore the inductive activity of the pH27 promoter, thereby forming a stronger xylose-inducible promoter pH27i. Figure 12 a). Experiments verified the xylose inducibility of pH27i and found that its induction strength was significantly higher than that of the original PxylA promoter ( Figure 12 b). However, pH27i exhibits some basal expression leakage under non-inducible conditions ( Figure 12b). To improve the stringency of pH27i expression, a second XylR binding sequence (5′-TTAGTTTGTATACCAAACTAA-3′) was further inserted downstream of the pH27i promoter, see [link to relevant documentation]. Figure 12 a. Modified promoter (The sequence is shown in SEQ ID NO:102) shows a lower basal expression leakage than pH27i. Figure 12 b). Further testing showed that, Maximum inducible activity was achieved at a xylose concentration of 60 mM. Figure 12 c). With B. methanolicus The bacteria widely used in China are derived from Bacillus megaterium (Beta lappa). Bacillus megaterium Compared to the xylose-inducible promoter pxylA-Bmega (sequence shown in SEQ ID NO:104), The basic expression leakage was reduced by 57%, and the induced expression intensity was increased by 114%. Figure 12 d). These results indicate that It is a highly efficient and tightly regulated xylose-inducible promoter suitable for B. methanolicu Precise gene expression regulation in s.

[0073] Example 6: Point mutation and promoter insertion overexpression gene were performed using the developed editing method and strong promoter. To further verify the effectiveness of the editing method developed in this invention, we selected the ribC gene (BMMGA3_06345) (encoding a bifunctional enzyme of riboflavin kinase and flavin adenine dinucleotide synthase) for point mutation. RibC (G199D). The plasmid construction method is as follows: using pUB31-sfgfp-ampdel plasmid as a template, pUB31-donor-VF (CCGTATATATGAGTAAACTTGGTCTGACAG) and pUB31-donor-VR (TAAAAGGATCTAGGTGAAGATCCTTTTTG) were used as forward and reverse primers, respectively, and the backbone DNA was amplified using KOD One DNA polymerase. The amplification reaction procedure followed the instructions accompanying the polymerase, with the extension time per kb of DNA set at 1 min. The specific thermal cycling conditions were as follows: the initial denaturation phase was set at 98 °C for 3 min; each cycle consisted of denaturation at 98 °C for 10 seconds, annealing at 60 °C for 5 seconds, extension at 68 °C for 1 min per kb, and the final extension phase at 68 °C for 3 min.

[0074] by B. methanolicusUsing the genome as a template, primer combinations of ribC-LF (CTTCACCTAGATCCTTTTATTGAACAAATGAAACAAGGGGAAATG), ribC-LR (ACCCAATTGTTCTTCCTCTTTTATCATCATGTACGACTGTTCCCTTTATGG), ribC-RF (TGATGATAAAAGAGGAAGAACAATTGGGTTTCC), and ribC-RR (CAGACCAAGTTTACTCATATATACGGCTTTTCCGTTGAAGATTTCAACGAAGG) were used for amplification. ribC Upstream and downstream homologous arms of the gene. Amplification reactions were performed using KOD One DNA polymerase under the same conditions as before. Using the same editing method described above, single and double crossover strains were obtained sequentially, and point mutant strains of the target gene were verified by PCR and sequencing. Figure 13 ).

[0075] Experimental results show that point mutations in the target gene can be rapidly achieved using the developed editing tool. The riboflavin production of the mutant strain increased from almost undetectable to approximately 20 mg / L, indicating that the mutation may enhance the catalytic efficiency of riboflavin kinase.

[0076] In addition, we chose purE The promoter sequence of the gene (BMMGA3_01635) is inserted, and the genome... purE The original promoter sequence was deleted while a new strong promoter pH27 sequence was inserted. purE Gene overexpression. The plasmid construction method is as follows: using pUB31-sfgfp-ampdel plasmid as a template, pUB31-donor-VF (CCGTATATATGAGTAAACTTGGTCTGACAG) and pUB31-donor-VR (TAAAAGGATCTAGGTGAAGATCCTTTTTG) were used as forward and reverse primers, respectively, and KOD One DNA polymerase was used for backbone DNA amplification. The amplification reaction procedure followed the instructions accompanying the polymerase, with the extension time per kb of DNA set at 1 min. The specific thermal cycling conditions were as follows: the initial denaturation phase was set at 98 °C for 3 min; each cycle consisted of denaturation at 98 °C for 10 seconds, annealing at 60 °C for 5 seconds, extension at 68 °C for 1 min per kb, and the final extension phase at 68 °C for 3 min.

[0077] by B. methanolicusUsing the genome as a template, the upstream and downstream homologous arms of the purE gene were amplified using primer combinations purE-LF (aaaactcacgttaagggattttggtggtcgagtgactctgcgccg), purE-LR (GTTATCTTCATTATAATGCGGTTAAATTTGTTTGTCTAGTGTAGAActaatcgatttttttggcctc), purE-RF (ACCGCATTATAATGAAGATAACTAGAAGGAGGTTAATTAatggaagttcaggttggggt), and purE-RR (accaagtttactcatatatacggtatcgatcaaagcaagaagcacg). The amplification reaction was performed using KOD One DNA polymerase under the same conditions as before. Using the same editing method described above, single and double exchange strains were obtained sequentially, and the overexpression strains with promoter substitution of the target gene were verified by PCR and sequencing. Figure 14 ).

[0078] Experimental results show that the target gene was successfully achieved using the developed methods and tools. purE The promoter replacement, with a strong promoter, further increased riboflavin production to approximately 42 mg / L.

[0079] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for improving the electroconversion efficiency of Bacillus methylformamide, characterized in that, The method is selected from at least one of ① to ⑤: ① In the preparation of Bacillus methanolis ( Bacillus methanolicus Add cell wall weakening agents glycine and threonine to competent cells; ② The constructed recombinant plasmid was first transformed into *Bacillus thermoglucosidase* (B. thermoglucosidase). Parageobacillus thermoglucosidasius In the process, plasmids were extracted and then transformed into Bacillus methanolii; ③ The starting vector used to construct the homologous recombination plasmid is the thermosensitive replicon RepB, ​​and the homologous recombination plasmid contains the sfGFP reporter gene; ④ Knock out the gene of Bacillus methanolis glgC Among them, genes glgC The reference sequence number in NCBI is BMMGA3_13730; ⑤ The expression of the target gene is driven by a constitutive promoter or a xylose-inducible promoter; the sequence of the constitutive promoter is shown in any one of SEQ ID NO:1-51, and the sequence of the xylose-inducible promoter is shown in any one of SEQ ID NO:52-102.

2. The method according to claim 1, characterized in that, The method is a combination of ①, ②, ③, ④ and ⑤.

3. The method according to claim 1, characterized in that, The first step includes the following steps: a) After activation, Bacillus methanolicus was inoculated into SOBsuc medium and cultured at 40-60℃ until OD500 reached. 600 When the concentration is 1.0-3.0, add glycine and threonine to the culture medium to a final concentration of 0.2-3%, continue culturing for 0.5-2 hours, and then collect the bacterial cells by centrifugation. The SOBsuc medium was prepared as follows: 20 g / L tryptone, 5 g / L yeast extract, 0.186 g / L potassium chloride, 0.5 g / L sodium chloride and 0.95 g / L magnesium chloride, adjusted to pH 7.0, and 8.4 g / L sucrose was added after sterilization. b) Resuspend the bacterial cell pellet in SMGT buffer and collect the bacterial cells by centrifugation; The SMGT buffer solution comprises: 0.5 M sorbitol, 0.5 M mannitol, 0.5 M trehalose, and 10% v / v glycerol. c) Repeat step b) 1-6 times, and finally resuspend the bacterial cells in SMGT buffer to obtain competent cells.

4. The method according to claim 1, characterized in that, The method for constructing homologous recombination plasmids described in section ③ includes: DNA fragment I containing sfgfp and colE ori was amplified from pUB-sfgfp plasmid using primers pBMe01-V1-F and pBMe01-V1-R; simultaneously, DNA fragment II containing RepB replicon and kanamycin resistance gene was amplified from pZL02 plasmid using primers pBMe01-V2-F and pBMe01-V2-R; after purification, DNA fragments I and II were recombined in vitro using recombinase to obtain homologous recombinant plasmids; The sequences of the primers pBMe01-V1-F and pBMe01-V1-R are as follows: pBMe01-V1-F: TGTGCTGCAAGGCGATTAA pBMe01-V1-R:CCATTTTGAACGATGACCTC The sequences of the primers pBMe01-V2-F and pBMe01-V2-R are as follows: pBMe01-V2-F:GAGGTCATCGTTCAAAATGGTATGCGTTTTGACACATCCACTAT pBMe01-V2-R:TTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG.

5. The method according to claim 1, characterized in that, In step ④, the gene of Bacillus methanolis was knocked out using homologous recombination. glgC .

6. The method according to claim 5, characterized in that, Genetic sequencing was performed using the homologous recombination plasmid constructed in section ③. glgC Knockout.

7. The method according to claim 6, characterized in that, After plasmid transformation, the transformed strains were cultured at 55-60℃ to promote homologous recombination.

8. The method according to claim 1, characterized in that, The sequence of the xylose-inducible promoter described in ⑤ is shown in SEQ ID NO:

102.

9. The method according to any one of claims 1-8, characterized in that, The conditions for electroconversion are: the concentration of competent cells is OD. 600 =10-60, electric shock conditions are 1.5-3 kV / cm, 200 Ω, 0.1 cm electric rotary cup.

10. The method according to claim 9, characterized in that, After electroporation, competent cells were cultured in TGP resuscitation medium at 40-60 °C and 180-250 rpm for 0.5-20 hours, and then directly plated to select transformants.