A method for long-term control of the blue leaf beetle using RNAi mediated by foliar colonizing microorganisms.

Abstract

This application discloses a method for long-term control of the blue leaf beetle using RNAi mediated by foliar colonizing microorganisms. This application utilizes microorganisms capable of long-term and effective colonization on willow leaves, genetically engineered to efficiently express double-stranded RNA. Spraying the engineered bacteria onto willow leaves maintains long-term insecticidal activity against the blue leaf beetle. This application also discloses a method for preparing the engineered bacteria, including knocking out the RNase III gene in the microbial genome, integrating the T7 polymerase expression cassette, and transforming it with a double-stranded RNA expression plasmid targeting key genes of the blue leaf beetle. Experiments show that after a single inoculation with the engineered bacteria, willow leaves still caused complete mortality of the blue leaf beetles at weeks 3 and 6, and significantly inhibited their feeding and weight gain. This application overcomes the shortcomings of existing non-PIP technologies, such as short duration of action and the need for multiple applications, and has the advantages of long-term effectiveness, stability, and environmental friendliness, making it suitable for large-scale application in forestry production.

Description

Technical Field

[0001] This application relates to the field of biological control technology, specifically to a method for long-term control of the blue leaf beetle using RNAi mediated by foliar colonizing microorganisms. Background Technology

[0002] The willow leaf beetle (Plagiodera versicolora) is a major specialized predatory pest of willow trees in my country. Both larvae and adults feed on leaves, causing notches and perforations. In severe cases, it can devour all the leaves from a tree, hindering growth and destroying its ornamental value. Frequent outbreaks pose a serious threat to forestry production and urban greening in my country. For a long time, the control of the willow leaf beetle has relied primarily on chemical pesticides. However, the long-term irrational use of chemical control has led to a series of ecological problems, including increased pesticide resistance, pesticide residue pollution, and damage to non-target organisms.

[0003] In the field of plant protection, RNA interference (RNAi) has emerged as a novel, green, and pollution-free method for pest control, demonstrating significant application potential. This technology primarily targets specific key genes involved in the growth, development, or important behaviors of pests, using double-stranded RNA (dsRNA) to inhibit or silence the expression of these key genes. By influencing pest development and reproduction, it achieves precise pest control. Currently, RNAi pest control methods are mainly divided into non-plant-derived non-PIP (non-plant-incorporated protectant) induced spraying and plant-derived PIP (plant-incorporated protectant) utilizing plant transgenic technology. However, non-PIP technology faces bottlenecks such as poor environmental stability of dsRNA formulations, short duration of effectiveness, and the need for multiple applications.

[0004] Therefore, there is an urgent need to develop a long-lasting, stable, and environmentally adaptable RNAi pest control method to overcome the shortcomings of existing non-PIP technology and achieve long-lasting control of the blue leaf beetle through RNAi mediated by foliar colonization microorganisms. Summary of the Invention

[0005] To address the limitations of existing non-PIP technologies, such as poor environmental stability, short duration of action, and the need for multiple applications of dsRNA formulations, this application provides a method for long-term control of the willow leaf beetle using RNAi mediated by foliar colonizing microorganisms. This application utilizes microorganisms capable of long-term and effective colonization on willow leaves, genetically engineered to efficiently express dsRNA. Spraying the engineered bacteria onto willow leaves maintains long-term insecticidal activity against the willow leaf beetle, a pest of willow trees, achieving long-term protection for willows. Experiments show that foliar inoculation with engineered bacteria expressing dsRNA targeting the willow leaf beetle's actin gene resulted in the complete death of the willow leaf beetle at weeks 3 and 6, and significantly inhibited its feeding and weight gain. This demonstrates that the method of this application overcomes the shortcomings of existing non-PIP technologies, which have short duration of action, and possesses the advantages of long-term effectiveness, stability, and environmental friendliness.

[0006] To achieve the above objectives, this application provides the following technical solution:

[0007] In a first aspect, this application provides a method for preparing engineered bacteria for controlling the blue leaf beetle, comprising the following steps:

[0008] (1) Provide microorganisms that can effectively colonize the surface of willow leaves for a long period of time, said microorganisms being cold-resistant Pseudomonas, whose colonization time on the surface of willow leaves is at least 8 weeks;

[0009] (2) Using the homologous recombination method, a knockout plasmid containing the upstream and downstream homologous arms of the RNase III gene and the selection marker gene was constructed, and the microorganism was transformed to knock out the RNase III gene in its genome to obtain an engineered bacterium with RNase III gene deletion.

[0010] (3) Using Tn7 transposition technology, an integration plasmid containing a T7 polymerase expression cassette and a selection marker gene was constructed and integrated into the genome of the engineered bacteria obtained in step (2). Subsequently, the selection marker gene was removed using the FLP / FRT recombination system to obtain an engineered bacterium capable of efficiently expressing double-stranded RNA (dsRNA).

[0011] (4) Transform the double-stranded RNA expression plasmid containing the key gene of the leaf beetle into the engineered bacteria obtained in step (3) to obtain engineered bacteria expressing the target dsRNA.

[0012] In some embodiments, in step (3), the nucleotide sequence of the T7 polymerase expression cassette is as shown in SEQ ID NO:1.

[0013] In some preferred embodiments, in step (4), the double-stranded RNA targeting the key gene of the leaf beetle is a double-stranded RNA (dsActin) targeting the actin gene of the leaf beetle, and its target sequence is shown in SEQ ID NO:2.

[0014] In some embodiments, in step (2), the nucleotide sequence of the upstream homologous arm of the RNase III gene is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream homologous arm of the RNase III gene is shown in SEQ ID NO:4.

[0015] In some embodiments, the preparation method further includes the step of removing the selection marker gene using an FLP / FRT recombination system after knocking out the RNase III gene and / or integrating the T7 polymerase expression cassette.

[0016] Secondly, this application provides an engineered bacterium obtained by the preparation method described in the first aspect.

[0017] Thirdly, this application provides a fungal agent for controlling the blue leaf beetle, which comprises the engineered bacteria described in the second aspect.

[0018] Fourthly, this application provides a method for controlling the blue leaf beetle using the engineered bacteria described in the second aspect or the microbial agent described in the third aspect, comprising the following steps:

[0019] (1) The engineered bacteria were inoculated onto the surface of willow leaves;

[0020] (2) The engineered bacteria colonize the leaves of willow leaves and continuously express dsRNA targeting key genes of the willow leaf beetle;

[0021] (3) After the willow leaf beetle feeds on the willow leaf, the dsRNA triggers RNA interference, leading to the death of the willow leaf beetle.

[0022] In some embodiments, in step (1), the culture concentration endpoint of the engineered bacteria is OD. 600 =1.

[0023] In some preferred embodiments, in step (1), the inoculation step specifically involves: waiting for the engineered bacteria to reach OD200. 600 =1, collect bacterial cells by centrifugation, resuspend and wash with sterile water, concentrate to 10 times concentration, spray onto willow leaves by leaf injury method, inoculation amount is 1 mL / leaf, bag and keep moist for 24 h.

[0024] In some embodiments, the engineered bacteria colonize the willow leaves for at least 8 weeks, and no further inoculation is required after inoculation, maintaining insecticidal activity against the willow leaf beetle for at least 6 weeks.

[0025] Compared with the prior art, this application has at least the following advantages:

[0026] 1. The engineered bacteria provided in this application can colonize the surface of willow leaves for a long period of time (at least 8 weeks). After one foliar inoculation, the willow leaves can still cause 100% death of the willow leaf beetle in the 3rd and 6th weeks, overcoming the defects of the prior art that dsRNA is easy to degrade, has a short duration of effect, and requires multiple applications.

[0027] 2. This application screened and modified microorganisms with long-term leaf surface colonization ability. Testing showed that the leaf surface colony density still reached 10⁸ CFU / L eight weeks after inoculation. 5 CFU / g grade ensures continuous in situ production of dsRNA, achieving "one-time vaccination, long-term protection".

[0028] 3. This application reduces dsRNA degradation by knocking out the RNase III gene and improves transcription efficiency by integrating the T7 polymerase expression cassette. Northern hybridization confirmed that the engineered bacteria can efficiently express the target dsRNA, laying the foundation for efficient RNAi.

[0029] 4. The control method provided in this application showed that during the period when the willow leaf beetle fed on inoculated willow leaves, it exhibited significant refusal to eat, a marked decrease in body weight, and a substantial downregulation of the expression level of the target actin gene, and subsequently all of them died. This confirms that the method proposed in this application specifically silences the key gene of the pest through an RNAi mechanism, which has the advantages of being green and pollution-free. This control method only requires a single foliar spray, does not require complex equipment, and is suitable for large-scale promotion in forestry production. Attached Figure Description

[0030] Figure 1 This is a schematic diagram of the P. pEQ3 construction process provided in the embodiments of this application.

[0031] Figure 2 The colonization detection map of P. pEQ3 provided in the embodiments of this application, wherein Figure 2 A is a statistical graph showing the time variation of bacterial colonization density per unit weight on leaves; 2B is a graph of leaf colony culture plates at different time points; 2C is a fluorescence microscopic observation of leaf colonies (showing green fluorescence).

[0032] Figure 3 This is a schematic diagram of the P. pEQ1 construction process provided for an embodiment of this application.

[0033] Figure 4 The image shows the detection of dsActin Northern hybridization after induction of P. pEQ1(dsActin) engineered bacteria, which is provided in the embodiments of this application.

[0034] Figure 5The images provided in this application are bioassays of the blue leaf beetle after 3 weeks of feeding and inoculation with the engineered strain P. pEQ1(dsActin) on willow leaves. 5A is a curve showing the survival rate of the blue leaf beetle larvae over time, 5B is a picture of the blue leaf beetle larvae feeding on the leaves on the third day, 5C is a chart showing the weight of the blue leaf beetle larvae on the third day, and 5D is a chart showing the relative expression level of the actin gene in the blue leaf beetle larvae on the third day.

[0035] Figure 6 The following are bioassays of the blue leaf beetle after 6 weeks of feeding and inoculation with the engineered strain P. pEQ1(dsActin) on willow leaves, as provided in the embodiments of this application. Among them, 6A is a curve showing the survival rate of blue leaf beetle larvae over time, 6B is a picture of blue leaf beetle larvae feeding on leaves on the third day, 6C is a statistical chart of the weight of blue leaf beetle larvae on the third day, and 6D is a statistical chart of the relative expression level of the actin gene of blue leaf beetle larvae on the third day. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0037] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0038] In this application, unless the context clearly indicates otherwise, the terms “including,” “comprising,” “containing,” “having,” etc., shall be understood as open-ended and mean “including but not limited to.”

[0039] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may be adjusted according to the desired performance. At a minimum, each numerical parameter should be interpreted based on the reported significant figures and by applying common rounding techniques.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains. Before a detailed description of this application, the following explanations of terminology are provided to better understand this application.

[0041] 1. Leaf colonization: refers to the ability of microorganisms to survive, reproduce, and maintain a certain population density on the surface of plant leaves for a long period of time. In this application, the colonization time is at least 8 weeks, and the colony density is not less than 10. 5 CFU / g.

[0042] 2. RNase III: This refers to ribonuclease III, which can cleave double-stranded RNA (dsRNA). Knocking out the gene encoding this enzyme can reduce the degradation of self-expressed dsRNA by engineered bacteria.

[0043] 3. FLP / FRT recombination system: refers to a site-specific recombination system mediated by FLP recombinase recognizing FRT sequences, used to remove selection marker genes.

[0044] 4. Electroporation conversion method: The electroporation conversion described in this patent all use Bio-Rad MicroPulser, 0.2 cm electroporation cup, and voltage of 1.8-2kV.

[0045] The following are specific examples:

[0046] Example 1: Construction and leaf colonization detection of engineered bacteria with dual screening markers

[0047] This embodiment is used to verify that Pseudomonas psychrotolerans can effectively colonize the surface of willow leaves for a long period of time, and to construct engineered bacteria with dual screening markers to facilitate colonization detection.

[0048] 1.1 Main Materials and Reagents

[0049] Pseudomonas psychrotolerans PSE38: This strain, kindly provided by Professors Fengjuan and Jiang Zhang of Hubei University, was deposited on April 14, 2026, at the China Center for Type Culture Collection (CCTCCNO: M 2026682), located at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The genome sequence of this strain has been submitted to NCBI (accession number: SRR22139852).

[0050] Plasmids: Various plasmids were purchased from companies or constructed in laboratories. Among them, pUC18T-mini-Tn7T-Gm and pTNS2 plasmids were purchased from BioVector (NTCC).

[0051] Antibiotics such as kanamycin and gentamicin were purchased from Solarbio.

[0052] Primers: The primers used in this example and subsequent examples were all synthesized by Beijing Qingke Biotechnology. Their names, specific sequences and uses are shown in Table 1 below:

[0053] Table 1 Primer Information

[0054]

[0055] 1.2 Construction of pUC18T-mini-Tn7-Ka-sfGFP plasmid

[0056] The specific steps for constructing a Tn7 transposon plasmid containing the kanamycin resistance gene and the superfolded green fluorescent protein (sfGFP) gene are as follows:

[0057] (1) Using pUC18T-mini-Tn7T-Gm plasmid as a template, reverse PCR amplification was performed using primers Tn7-KF and Tn7-KR in Table 1. The PCR amplification system (50 μL) consisted of: 2 μL each of upstream and downstream primers, 1 μL of template plasmid, 5 μL of ddH2O, and 40 μL of PCR Mix (purchased from Beijing Qingke Biotechnology). The PCR amplification program was as follows: 95 ℃ pre-denaturation for 2 min; 95 ℃ denaturation for 30 s, 55 ℃ annealing for 30 s, 72 ℃ extension for 3 min, for 30 cycles; 72 ℃ full extension for 6 min; and the reverse amplified fragment of pUC18T-mini-Tn7T-Gm plasmid was obtained.

[0058] (2) The kanamycin resistance gene (Kana / NeoR) sequence fragment (SEQ ID NO:17) was co-transformed with the above-mentioned back-amplified fragment into E. coli DH5α competent cells. Positive clones were screened on plates containing 10 μg / mL kanamycin, and plasmids were extracted to obtain the pUC18T-mini-Tn7T-Kan plasmid. The specific sequence of the kanamycin resistance gene sequence fragment is as follows:

[0059] Kana / NeoR (SEQ ID NO:17):

[0060] ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTCCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGGATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA.

[0061] (3) Using the pUC18T-mini-Tn7T-Kan plasmid as a template, reverse PCR amplification was carried out using the primers Tn7-G-F and Tn7-G-R in Table 1. The amplification system and procedure were the same as above. The reverse amplification fragment of the pUC18T-mini-Tn7T-Kan plasmid was obtained.

[0062] (4) The sfGFP sequence fragment (SEQ ID NO:18) and the above-mentioned back-amplified fragment were co-transformed into E. coli DH5α competent cells, positive clones were screened, and plasmids were extracted to obtain the pUC18T-mini-Tn7-Ka-sfGFP plasmid. The specific sequence of the sfGFP sequence fragment is as follows:

[0063] sfGFP (SEQ ID NO:18):

[0064] .

[0065] 1.3 Construction of engineered bacteria with dual-selection markers (P. pEQ3)

[0066] The kanamycin resistance gene and sfGFP were integrated into the genome of strain PSE38 using Tn7 transposition technology. The construction process is as follows: Figure 1 As shown, specifically:

[0067] Electroporation competent cells were prepared from strain PSE38. The pUC18T-mini-Tn7-Ka-sfGFP plasmid was mixed with the helper plasmid pTNS2 and simultaneously transformed into strain PSE38 via electroporation. After transformation, the cells were plated on plates containing 10 μg / mL kanamycin, and positive clones were selected. The resulting engineered strain was named *P. pEQ3*, which integrates the kanamycin resistance gene and the superfolded green fluorescent protein (sfGFP) gene into its genome, and expresses aminoglycoside phosphotransferase (kanamycin resistance) and sfGFP (green fluorescence).

[0068] 1.4 Leaf colonization detection

[0069] (1) Preparation of bacterial culture: P. pEQ3 strain was cultured overnight at 28 ℃ until OD. 600 =1, collect bacterial cells by centrifugation, wash 3 times with sterile water, and concentrate by centrifugation to a 10-fold concentration for later use.

[0070] (2) Willow planting and inoculation: Select healthy willow cuttings that are about 30 days old, ensuring they are similar in height and have uniform leaf size. Inoculate using the leaf-injury method: Spray the above-mentioned concentrated bacterial solution onto the willow leaves at a rate of 1 mL / leaf, and cover with a bag to maintain moisture for 24 hours. Water and fertilize regularly to ensure normal willow growth.

[0071] (3) Colony density determination: Willow leaves were collected periodically on days 0, 7, 14, 21, 28, 35, 42, 49, and 56 after inoculation, with at least 3 samples per group (4 willow leaves per sample). After weighing, the leaves were thoroughly ground in a sterile mortar and diluted with sterile water according to the leaf weight ratio to prepare a grinding solution. The solution was then spread on agar plates containing 10 μg / mL kanamycin and incubated overnight. Each sample was spread on at least three plates. The number of single colonies was counted, and the number of colonies per unit weight of leaf (CFU / g) was calculated. A statistical graph of the change in bacterial colony density per unit weight of leaf over time was plotted. At the same time, the colonies were observed under a fluorescence microscope to see if they emitted green fluorescence (sfGFP).

[0072] Colonization testing such as Figure 2 As shown in the figure. The results indicate that the P. pEQ3 strain can colonize the surface of willow leaves for a long period of time. Figure 2A is a statistical graph showing the change in bacterial colony density per unit weight on leaves over time. Although the colony count decreased over time, approximately 3.09 × 10⁻⁶ colonies were still present on the willow leaf surface at week 8. 5 CFU / g. Figure 2 B shows leaf surface colony culture plates at different time points. As time progresses, the number of colonies on the plates gradually decreases but remains detectable. Figure 2 Image C shows a fluorescence microscopy observation of the bacterial colonies on the leaf surface. Under the microscope, the colonies emit green fluorescence, confirming the normal expression of the sfGFP gene carried by the engineered bacteria. These results indicate that the engineered bacteria can effectively colonize willow leaves for a long period, at least 8 weeks, and can be easily detected using dual selection markers of kanamycin resistance and fluorescence.

[0073] Example 2: Construction of an engineered bacterium (P. pEQ1) that efficiently expresses dsRNA

[0074] This embodiment constructs an engineered bacterium capable of efficiently expressing double-stranded RNA by knocking out the RNase III gene and integrating the T7 polymerase expression cassette.

[0075] 2.1 Main Materials and Reagents

[0076] Plasmids: pK18mobsacB was purchased from Newp Biotech; pFLP2 was purchased from Newp Biotech; pUC18T-mini-Tn7T-Gm and pTNS2 plasmids were purchased from BioVector (NTCC); pUC18T and pMM5 plasmids are described in Xie et al., Pest Manag Sci, 2025, DOI: 10.1002 / ps.8699; the rest are the same as in Example 1.

[0077] Primers: First B1, First T2, Last B2, Last T1, the specific sequences are shown in Table 1.

[0078] 2.2 Construction of the knockout plasmid pK18mobsacB-PSE38-Δrnc

[0079] Based on the sequence fragment of the RNase III gene of strain PSE38 in the NCBI database (accession number: NZ_JAQYZZ010000011.1), the RNase III gene is located in the region from 478185 to 478874 nt. This embodiment designs primers based on this sequence information and constructs a plasmid for knocking out the RNase III gene using homologous recombination. The specific steps are as follows:

[0080] (1) Using pK18mobsacB plasmid as a template, reverse PCR amplification was performed using primers First B1 and First T2. The PCR amplification system (50 μL) consisted of 2 μL each of upstream and downstream primers, 1 μL of template plasmid, 5 μL of ddH2O, and 40 μL of PCR Mix. The amplification program was as follows: 95 °C pre-denaturation for 2 min; 95 °C denaturation for 30 s, 57 °C annealing for 30 s, 72 °C extension for 3 min 50 s, for 30 cycles; and 72 °C extension for 6 min. The reverse amplified fragment of pK18mobsacB plasmid was obtained.

[0081] (2) Using PSE38 genomic DNA as a template, the upstream fragment of the RNase III gene (SEQ ID NO:3) was amplified. This upstream fragment and the back-amplified fragment from step (1) were co-transformed into E. coli DH5α competent cells, positive clones were screened, and plasmids were extracted to obtain the pK18mobsacB-U plasmid. The specific sequence of the upstream fragment of the RNase III gene is as follows:

[0082] Upstream fragment of RNase III gene (SEQ ID NO:3):

[0083] .

[0084] (3) Using pK18mobsacB-U plasmid as a template, reverse PCR amplification was performed using primers Last B2 and Last T1. Amplification program: 95 ℃ pre-denaturation for 2 min; 95 ℃ denaturation for 30 s, 56 ℃ annealing for 30 s, 72 ℃ extension for 4 min, 30 cycles; 72 ℃ full extension for 6 min; to obtain the reverse amplified fragment of pK18mobsacB-U plasmid.

[0085] (4) Using PSE38 genomic DNA as a template, the downstream fragment of the RNase III gene (SEQ ID NO:4) was amplified. This downstream fragment and the back-amplified fragment from step (3) were co-transformed into E. coli DH5α competent cells, positive clones were screened, and plasmids were extracted to obtain the pK18mobsacB-PSE38-Δrnc plasmid. This plasmid contains upstream and downstream homologous arms of the RNase III gene, with a kanamycin resistance gene expression cassette in the middle (flanked by FRT sequences), which is used for homologous recombination double crossover knockout of the RNase III gene. The specific sequence of the downstream fragment of the RNase III gene is as follows:

[0086] Downstream fragment of RNase III gene (SEQ ID NO:4):

[0087] TCAATGAAAAGACGACGGGGCAGGGCGCCAGTCGCCGCATCGCCGAACAGATAGCGGCCTCGGCGGCCTTGATCGCCCTGGGCGTGGAGAATGGTCATGAATGATGAGCTGAAGGCATCGCGCTGCGGCTACGTAGCCATCGTGGGTCGTCCCAACGTCGGCAAGTCCACGCTGCTCAACCATATCCTCGGGCAGAAGCTGGCCATCACCTCGCGCAAGCCGCAGACCACCCGGCACAACATGCTCGGCATCAAGACCGAGGGTGAGGTCCAGACCATCTATGTGGATACCCCCGGTCTGCACAAGGAAAACCAGAAGGCGCTCAACCGCTTCATGAACAAGACGGCCGTCACCGCCCTGCGCGATGTGGACGTCGTGGTGTTCGTGGTCGACCGCACCCGCTGGACCGACGAAGACCAGATGGTGCTGGAACGGGTGCGCTTCGTGAAGTGCCCGGTGCTGCTCGCCGTCAACAAGATGGATCGCCTGGAAGACAAGGCCGACATGCTGCCGCACCTGCAATGGCTGCAGGAGCAGTTGCCGGAAGCCGCGCTCATTCCGATCTCCGCCCAGCACGGCCACAATCTCGACGCCCTCGAGGAGCTGGTCGCCGAGCGCCTGCCGGAAGGCGACCACTTCTTCCCCGAGGACCAGATCACCGACAGATCCAGCCGCTTCCTTGCGGCCGAACTGATCCGGGAAAAGATCATGCGCCAGCTGGGAGCGGAGTTGCCCTATCAGGTCGCGGTCGAGATCGAGGAATTCAAGTACGA.

[0088] 2.3 Construction of RNase III gene knockout engineered bacteria

[0089] As Figure 3As shown, the pK18mobsacB-PSE38-Δrnc plasmid was transformed into strain PSE38 using electroporation. The plating was spread on plates containing 20% ​​sucrose and 10 μg / mL kanamycin, and positive clones exhibiting homologous recombination double crossover were screened. PCR verification confirmed the presence of an engineered strain with the RNase III gene replaced by a kanamycin resistance gene, named PSE38-ΔRNase Ⅲ-Kan.

[0090] 2.4 Removal of kanamycin resistance markers

[0091] like Figure 3 As shown, the kanamycin resistance gene was removed using the FLP / FRT recombination system. The pFLP2 plasmid was transformed into the engineered bacteria PSE38-∆RNase Ⅲ-Kan and cultured under no-selection pressure for 2-3 hours, then plated on sucrose-containing plates. The FLP recombinase recognized the FRT sequence, mediating the excision of the kanamycin resistance gene between two FRT sites. Clones that lost kanamycin resistance were screened and named PSE38-∆RNase Ⅲ.

[0092] 2.5 Integration of the T7 polymerase expression cassette

[0093] like Figure 3 As shown, the T7 polymerase expression cassette was integrated into the PSE38-∆RNase III genome using Tn7 transposition technology. The specific steps are as follows:

[0094] (1) Constructing the integrative plasmid pUC18T containing the T7 polymerase expression cassette (SEQ ID NO:1) and the gentamicin resistance gene. pUC18T was constructed according to the description in Xie et al., Pest Manag Sci, 2025 (DOI:10.1002 / ps.8699) (this plasmid was constructed by the applicant and is stored in the laboratory. Detailed construction methods are available in the literature). Using pUC18T-mini-Tn7T-Gm plasmid as the initial template, this plasmid integrates the T7 polymerase expression cassette and contains the essential elements for Tn7 transposition. The specific sequence of the T7 polymerase expression cassette is as follows:

[0095] T7 polymerase expression cassette (SEQ ID NO:1):

[0096]

[0097] (2) The pUC18T plasmid was mixed with the helper plasmid pTNS2 and simultaneously transformed into the PSE38-∆RNase Ⅲ strain by electroporation. The mixture was plated on a plate containing 10 μg / mL gentamicin, and positive clones were screened to obtain the engineered strain PSE38-∆RNase Ⅲ-Gm-T7 RNA polymerase.

[0098] 2.6 Removal of gentamicin resistance markers

[0099] like Figure 3 As shown, the gentamicin resistance gene was removed again using the FLP / FRT recombination system. The pFLP2 plasmid was transformed into the engineered strain PSE38-∆RNase Ⅲ-Gm-T7 RNA polymerase and cultured under non-selective pressure for 2-3 hours. The culture was then plated on sucrose plates, and clones that lost gentamicin resistance were screened to obtain the engineered strain, which was named P. pEQ1.

[0100] Example 3: Construction and Validation of Engineered Bacteria Expressing dsRNA Targeting the Actin Gene of the Blue Leaf Beetle

[0101] In this embodiment, P. pEQ1 was transformed into a dsRNA expression plasmid to obtain an engineered bacterium capable of expressing dsRNA (dsActin) targeting the actin gene of the blue leaf beetle, and its dsRNA expression was verified.

[0102] 3.1 Construction of engineered bacteria expressing dsActin

[0103] (1) Plasmid: pMM5 plasmid (containing an inverted repeat sequence of the senna-like leaf beetle actin gene driven by the T7 promoter, which can be transcribed into dsRNA; its target sequence is shown in SEQ ID NO:2). This plasmid can be found in Xie et al., Pest ManagSci, 2025, DOI: 10.1002 / ps.8699 (this plasmid was constructed by the applicant and is stored in the laboratory. Detailed construction methods are available in the literature). The specific sequence of the target senna-like leaf beetle actin gene is as follows:

[0104] Actin (SEQ ID NO:2):

[0105] CCGTCAGGAAGCTCGTAGCTCTCTCTCAAAGAGGTGGAGGCAGCGGCGGTGGCCATTTCCTGTTCGAAGTCGAGAGCGACATAGCAGAGTTTCTCCTTGATGTCACGTACGATTTCTCTTTCAGCGGTGGTGGTGAAAGAGTAACCTCTCTCGGTGAGGATTTTCATGAGGTAGT CGGTCAAGTCACGACCAGCCAAGTCCAGACGGAGGATGGCGTGGGGAAGGGCGTAACCTTCGTAGATGGGTACGGTGTGGGTGACACCATCTCCAGAGTCCAAGACGATACCGGTGGTACGACCGGAAGCGTACAGGGAGAGTACGGCTTGGATAGCGACGTACATGGCAGGGGT.

[0106] (2) Transformation: The pMM5 plasmid was transformed into P. pEQ1 competent cells using electroporation. The cells were plated on plates containing 10 μg / mL kanamycin (the pMM5 plasmid was labeled with kanamycin resistance), and positive clones were selected. The resulting engineered bacteria was named P. pEQ1(dsActin).

[0107] 3.2 Northern blot detection of dsRNA expression

[0108] (1) Probe preparation: DIG-labeled RNA probes were prepared by in vitro transcription using the DIG RNA Labeling Kit (Roche) with the target Actin sequence (SEQ ID NO:2) as a template, according to the kit instructions.

[0109] (2) Sample preparation: The engineered bacteria P. pEQ1(dsActin) was cultured at 28 ℃ until OD 600 =0.4, add 1 mMIPTG and induce culture for 5 h. Centrifuge to collect bacterial cells, and extract total RNA using an RNA extraction kit (TransZol UP, Beijing TransGen Biotechnology). P. pEQ1 cells not transformed with pMM5 plasmid were used as a negative control.

[0110] (3) Electrophoresis and transfer: Equal amounts of total RNA were separated by formaldehyde denaturing agarose gel electrophoresis and transferred overnight by filter paper capillary transfer to transfer RNA onto a nylon membrane.

[0111] (4) Hybridization: The DIG-labeled probe was denatured at 100 °C for 5 min, placed on ice for 5 min, and then added to the hybridization solution to hybridize with a nylon membrane at a suitable temperature for more than 6 h. The RNA was fixed by UV cross-linking, the membrane was washed to remove unbound probes, and the hybridization signal was obtained by development.

[0112] The results are as follows Figure 4 As shown in the figure, a clear hybridization signal was detected in the P. pEQ1(dsActin) sample, while no signal was detected in the P. pEQ1 sample that was not transformed with pMM5 plasmid. These results indicate that P. pEQ1(dsActin) can successfully express dsActin.

[0113] Example 4: Verification of the effect of engineered bacteria in controlling the blue leaf beetle

[0114] In this embodiment, bioassays were conducted at different time points after foliar inoculation with P. pEQ1 (dsActin) to verify its long-term control effect on the blue leaf beetle.

[0115] 4.1 Inoculation with engineered bacteria

[0116] (1) Preparation of bacterial culture: P. pEQ1(dsActin) was cultured at 28 ℃ until OD 600 =0.4, add 1 mM IPTG to induce culture for 5 h, and continue culture until OD. 600 =1. Collect bacterial cells by centrifugation, resuspend and wash three times with sterile water, and concentrate by centrifugation to a 10-fold concentration for later use.

[0117] (2) Willow inoculation: Select healthy willow cuttings that have grown for 30 days, and spray the concentrated bacterial solution onto the leaves using the leaf-injury method. The inoculation amount is 1 mL / leaf, and the leaves are bagged and kept moist for 24 hours. At the same time, deionized sterile water treatment is used as a negative control. Each group has at least 3 willow trees, which are watered and fertilized regularly.

[0118] 4.2 Bioassays 21 days post-inoculation

[0119] Twenty-one days after inoculation (week 3), willow leaves inoculated with *P. p EQ1* (dsActin) and control leaves were collected. The leaves were uniformly cut to 4 cm long and 1.5 cm wide and placed on moist filter paper in petri dishes (6.5 cm in diameter, 1 cm in height). Ten second-instar larvae of the willow leaf beetle (captured locally in Wuhan and uniformly hatched and cultured) were placed in each petri dish, with three replicates per treatment group (n=30). Fresh leaves (also 21 days after inoculation) were replaced every 24 hours, and larval survival was recorded daily. Survival rates were continuously observed and calculated. Simultaneously, on day 3 of feeding (day 24 after inoculation), the larvae were weighed, and the leaf feeding area was photographed and recorded.

[0120] Furthermore, to confirm whether dsRNA expression induces RNAi in the blue leaf beetle, larvae fed for three days were selected for qRT-PCR to detect the transcription level of the actin gene. Total RNA was extracted from the blue leaf beetle using Trans Zol reagent (Beijing TransGen Biotech). Using the mRNA as a template, cDNA was reverse transcribed into cDNA using Random primers / Oligo(dT)18 primers under the action of RNA-dependent DNA polymerase, i.e., reverse transcriptase. The cDNA was then used as a template for amplification of the target gene using real-time quantitative PCR (qRT-PCR) with specific primers. The reaction mixture for qRT-PCR amplification included 2 μL of cDNA, 0.5 μL of q-PV-ACT-F and q-PV-ACT-R primers (see Table 1), and 10 μL of Hieff qPCR SYBRGreen Master Mix (purchased from Yisheng Biotechnology). The final reaction volume was 10 μL, with the remainder supplemented with water if necessary. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) -ΔΔCT The relative expression level of the target gene on day 3 was calculated. The internal reference gene 18S was amplified by qRT-PCR using primers q-PV-18s-F and q-PV-18s-R (see Table 1).

[0121] The results are as follows Figure 5 As shown, on the 5th day after feeding the leaves with P. pEQ1 (dsActin) for 21 days, all the leaves of the bluebell leaf beetle died (i.e., on the 26th day after feeding). Figure 5 A). At the same time, Figure 5 On leaves of B and 5C, it was also clearly observed that on the third day of feeding (i.e., 24 days after inoculation), the *P. spp.* leaf beetle exhibited significant aversion to food and a significant decrease in body weight compared to the control. Finally, qRT-PCR detection revealed that the *P. spp.* pEQ1(dsActin) target gene was significantly downregulated on the third day of feeding (i.e., 24 days after inoculation), indicating that RNAi (…) occurred in the *P. spp.* leaf beetle. Figure 5 D). In summary, the above results indicate that willow leaves retained their insecticidal activity against the willow leaf beetle 21 days after inoculation with P. p EQ1 (dsActin).

[0122] 4.3 Bioassays 35 days post-inoculation

[0123] To further investigate the long-term control effect of *P. pEQ1* (dsActin) on the willow leaf beetle, leaves from inoculated willow trees were collected 5 weeks later (i.e., after day 35) and subjected to bioassay as described above. Results are as follows... Figure 6As shown in the leaf bioassay results 21 days after feeding with P. pEQ1 (dsActin), on day 5 (i.e., 40 days after feeding with P. pEQ1 (dsActin), the mortality rate of the blue leaf beetle was 100%. Figure 6 A). Meanwhile, when fed leaves 38 days after inoculation, the leaf beetle exhibited significant anorexia and a marked decrease in body weight compared to the control group. Figure 6 B, 6C). Finally, qRT-PCR detection revealed that on the third day of feeding (i.e., 38 days after inoculation), the P. pEQ1 (dsActin) target gene was significantly downregulated, indicating that RNAi (…) occurred in the leaves of the willow leaf beetle. Figure 6 D).

[0124] The above results indicate that the engineered bacterium *P. p EQ1* (dsActin) constructed using the method described in this application, after a single inoculation onto willow leaves, can maintain highly effective insecticidal activity against the willow leaf beetle for at least 6 weeks, achieving long-term control of the willow leaf beetle via RNAi mediated by foliar colonization microorganisms. This method overcomes the shortcomings of non-PIP technology, such as poor stability of dsRNA, short duration of effectiveness, and the need for multiple applications, and has promising application prospects.

[0125] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A method for preparing engineered bacteria for controlling the blue leaf beetle, characterized in that, Includes the following steps: (1) Provide microorganisms that can effectively colonize the surface of willow leaves for a long period of time, said microorganisms being cold-resistant Pseudomonas, whose colonization time on the surface of willow leaves is at least 8 weeks; (2) Using homologous recombination, a knockout plasmid containing upstream and downstream homologous arms of the RNase III gene and a selection marker gene was constructed, and the microorganism was transformed to knock out the RNase III gene in its genome to obtain an engineered bacterium with RNase III gene deletion. (3) Using Tn7 transposition technology, an integration plasmid containing a T7 polymerase expression cassette and a selection marker gene was constructed and integrated into the genome of the engineered bacteria obtained in step (2). Subsequently, the selection marker gene was removed using the FLP / FRT recombination system to obtain an engineered bacterium that can express dsRNA efficiently. (4) Transform the double-stranded RNA expression plasmid containing the key gene of the leaf beetle into the engineered bacteria obtained in step (3) to obtain engineered bacteria expressing the target dsRNA.

2. The preparation method according to claim 1, characterized in that, In step (3), the nucleotide sequence of the T7 polymerase expression cassette is shown in SEQ ID NO:

1.

3. The preparation method according to claim 1, characterized in that, In step (4), the double-stranded RNA targeting the key gene of the sylvatica leaf beetle is a double-stranded RNA targeting the actin gene of the sylvatica leaf beetle, and its target sequence is shown in SEQ ID NO:

2.

4. The preparation method according to claim 1, characterized in that, In step (2), the nucleotide sequence of the upstream homologous arm of the RNase III gene is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream homologous arm of the RNase III gene is shown in SEQ ID NO:

4.

5. The preparation method according to claim 1, characterized in that, The preparation method further includes the step of removing the screening marker gene using the FLP / FRT recombination system after knocking out the RNaseIII gene and / or integrating the T7 polymerase expression cassette.

6. Engineered bacteria, characterized in that, Obtained by the preparation method according to any one of claims 1-5.

7. A fungicide for controlling the blue leaf beetle, characterized in that, It contains the engineered bacteria as described in claim 6.

8. The method for controlling the blue leaf beetle using the engineered bacteria of claim 6 or the bacterial agent of claim 7, characterized in that, Includes the following steps: (1) The engineered bacteria were inoculated onto the surface of willow leaves; (2) The engineered bacteria colonize the leaves of willow leaves and continuously express dsRNA targeting key genes of the willow leaf beetle; (3) After the willow leaf beetle feeds on the willow leaf, the dsRNA triggers RNA interference, leading to the death of the willow leaf beetle.

9. The method according to claim 8, characterized in that, In step (1), the culture concentration endpoint of the engineered bacteria is OD. 600 =1.

10. The method according to claim 8, characterized in that, In step (1), the specific inoculation steps are as follows: after the engineered bacteria are cultured to OD... 600 =1, collect bacterial cells by centrifugation, resuspend and wash with sterile water, concentrate to 10 times concentration, spray onto willow leaves by leaf injury method, inoculation amount is 1 mL / leaf, bag and keep moist for 24 h.

Images