Application of CsMADS9 gene in regulating tea tree fruit yield

Abstract

This invention belongs to the field of agricultural biotechnology, specifically relating to a tea tree. CsMADS9 Application of genes in negatively regulating plant fruit yield. Tea plant. CsMADS9 The application of genes in negatively regulating plant fruit yield. CsMADS9 The nucleotide sequence of the gene is shown in SEQ ID NO.1. CsMADS9 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.2. This invention utilizes a protein isolated from tea plant tissue. CsMADS9 The gene, through overexpression RT-qPCR detection, revealed that it can regulate the decrease in plant fruit yield. This invention provides a valuable gene resource for breeding tea varieties with different fruit-bearing levels.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically involving CsMADS9 Application of genes in regulating the number of tea fruits. Background Technology

[0002] tea tree( Camellia sinensis Tea is an important economic crop, widely cultivated in over 60 countries worldwide. Major tea-producing countries such as China, Japan, and India have vigorously pursued genetic improvement of tea plants. The tea plant is a woody crop, harvested for its tender leaves and shoots. Vigorous growth of tea leaves is a prerequisite for high yields in tea gardens. However, the reproductive growth period of the tea plant is relatively long, taking approximately one year from flower organ development to seed maturity. During this period, the flower organs and seeds consume a large amount of nutrients, leading to a decrease in fresh leaf yield and consequently reducing the economic income of tea farmers. However, tea seeds also offer advantages: plants grown from seeds are more resistant to pests and diseases and are more robust than those produced asexually. In addition to hybrid vigor, secondary metabolites in tea seeds can reduce the risk of cancer, heart disease, and other chronic diseases. Therefore, the number of seeds produced is an important biological trait in tea cultivation and economics. Therefore, studying the issue of tea tree fruit setting is crucial for optimizing tea tree propagation and breeding, balancing the dual benefits of the tea industry, and improving tea quality in major tea-producing areas. In regions with high potential for tea seed oil and tea seed by-product development, high-fruit-setting varieties can be bred to expand the industrial chain.

[0003] In their paper “Tanzarella, OA, Porceddu, E., 2011. Molecular aspects of flower development in grasses. Sex. Plant Reprod”, Ciaffi, M., Paolacci, AR, Tanzarella, OA, Porceddu, E. proposed that MADS-box transcription factors play an important role in the regulation of reproductive development. MADS-box The sep subfamily of genes and other MADS-box The expression level of genes in floral organs such as sepals, petals, stamens, and carpels determines the development of flowers and fruits. MADS-box Transcription factor duplication leads to the formation of two branches in Arabidopsis: AGAMOUS LIKE9 (AGL9) and AGL2 / 3 / 4, named SEPALLATA3 (SEP3) and SEP1 / 4 / 2, respectively. In soybean, SEP3 overexpression promotes earlier flowering and transformation of stamens and sepals into petals. Overexpression of SEP3 in rice and tobacco promotes earlier flowering in Arabidopsis but has no significant effect on flower shape. However, SEP3 deficiency is observed in tea plants. MADS- box transcription factors CsMADS9 Research on the related functions of regulating the number of tea fruits. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the purpose of this invention is to design and provide... CsMADS9 Technical solutions for the application of genes in regulating the number of tea fruits.

[0005] The present invention is specifically implemented using the following technical solutions: In a first aspect, the present invention provides CsMADS9 Application of genes in regulating plant fruit yield.

[0006] Furthermore, the aforementioned CsMADS9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] Furthermore, the aforementioned CsMADS9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0008] Furthermore, regulating the number of fruits produced by plants specifically involves reducing the number of pods and seeds, thereby decreasing the total number of fruits produced.

[0009] Furthermore, the plants include the woody plant tea tree and the herbaceous plant Arabidopsis thaliana.

[0010] Furthermore, this includes the following methods: 1) making the plant contain CsMADS9 Genes; or 2) causing plants to overexpress. CsMADS9 Gene.

[0011] Furthermore, method 2) employs an Agrobacterium-mediated method to process tea plants containing... CsMADS9 Gene recombinant vectors are transferred into plant genomes, and selected... CsMADS9 Transgenic plants with overexpression.

[0012] Furthermore, the carrier is pBWA(V)HS- CsMADS9 .

[0013] Secondly, the present invention provides a method for reducing the number of seeds produced by a plant, comprising the following means: 1) causing the plant to contain CsMADS9 Genes; or 2) causing plants to overexpress. CsMADS9 Genes, the ones mentioned CsMADS9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0014] The present invention has the following beneficial effects: (1) The present invention is obtained from tea plant tissue. CsMADS9The gene, through overexpression RT-qPCR detection, can be used to determine that it can regulate the decrease in the number of seeds produced in plants.

[0015] (2) This invention provides a favorable genetic resource for breeding tea tree varieties with different fruit setting levels. Attached Figure Description

[0016] Figure 1 for CsMADS9 pBWA(V)HS- was constructed CsMADS9 A schematic diagram of the overexpression vector.

[0017] Figure 2 a represents wild-type and transgenic Arabidopsis thaliana that have grown for approximately 30 days. Figure 2 b is CsMADS9 Relative expression levels in wild-type Arabidopsis and transgenic Arabidopsis; WT: wild-type Arabidopsis; OE1 and OE2 are two Arabidopsis overexpression lines, and the asterisk indicates that the transgenic lines and wild-type control have significant levels.

[0018] Figure 3 a shows the growth of wild-type Arabidopsis pilosula 10 days after bolting. Figure 3 b shows the growth of the transgenic Arabidopsis thaliana 10 days after bolting. Figure 3 c represents the pod phenotype of wild-type and transgenic Arabidopsis thaliana; Figure 3 d represents the length of the pod for each individual. Figure 3 e represents the number of pods per Arabidopsis plant. Figure 3 f represents mature pods and seeds of wild-type and transgenic Arabidopsis thaliana. Figure 3 g represents the number of seeds per pod in wild-type and transgenic Arabidopsis thaliana (asterisks indicate significant differences between the transgenic lines and the wild-type control).

[0019] Figure 4 a represents different tea tree varieties CsMADS9 Expression of different stages of floral organ development (FB: bud stage; WB: white bud stage; FA: flowering stage) Figure 4 b represents the number of fruits produced by the two tea varieties in different years (SZ_2019: observation results in Shengzhou in 2019, SZ_2020: observation results in Shengzhou in 2020, HZ_2019: observation results in Hangzhou in 2019, HZ_2020: observation results in Hangzhou in 2020). Detailed Implementation

[0020] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.

[0021] Example 1: CsMADS9 Obtaining gene sequences Tea trees were obtained by downloading from the Tea Plant Genomic Variations Database (TeaGVD). CsMADS9 The gene coding sequence of (CSS0037962) is shown in SEQ ID NO.1 and the amino acid coding sequence is shown in SEQ ID NO.2. CsMADS9 The gene sequence is 750 bp in length, consisting of a protein of 249 amino acid residues, with a molecular weight of approximately 28.04 and a theoretical isoelectric point of 8.90. The obtained... CsMADS9 The encoding cDNA sequence was artificially synthesized by Qingke Biotechnology Co., Ltd., and subsequently obtained CsMADS9 The cDNA sequence of the target gene.

[0022] Example 2: Establishment of a genetic transformation system for transgenic Arabidopsis thaliana (1) Construction of overexpression vector Based on the overexpression pBWA(V)HS vector sequence, single digestion with Eco31I (Bsal) was performed. The reaction system was as follows: pBWA(V)HS vector: 4 μL; 10× Buffer: 2 μL; Eco31I (Bsal): 1 μL; ddH2O: 13 μL. The digestion reaction was carried out at 37℃ for 1 h, and the product was checked for cleavage. Subsequently, the accurate DNA fragment was homologously recombinated with the linearized vector: the specific reaction system was: homologous recombinase: 10 μL; CsMADS9 Gene DNA fragment: 5 μL; enzyme digestion product: 5 μL; reaction at 37℃ for 30 h.

[0023] The ligation product was transformed into competent *E. coli* cells (DH5α), plated on kanamycin-resistant agar plates, and incubated at 37°C for 12 h. Positive single colonies were selected and sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing. Positive strains with correct sequencing were preserved, and plasmids were extracted for later use. Using the molecular sequencing results from SnapGene software, the constructed overexpression vector was named: pBWA(V)HS- CsMADS9 The schematic diagram of the carrier is as follows: Figure 1 As shown.

[0024] (2) Construction of Arabidopsis thaliana overexpression lines: pBWA(V)HS- CsMADS9 The overexpression vector was transformed into Agrobacterium tumefaciens (GV3101) and introduced into Arabidopsis thaliana (wild type) using the flower dip method. This continued until the T1 generation seeds were harvested. When the T1 generation transgenic seedlings reached 4 weeks of age, T2 generation positive transgenic plants were screened on 1 / 2 MS medium containing 15 mg / L Basta. The T2 generation positive transgenic plants were further screened on 1 / 2 MS medium containing 15 mg / L Basta to obtain homozygous T3 generation homozygous transgenic lines, named OE1 and OE2, respectively.

[0025] (3) RT-qPCR detection Total RNA from transgenic and wild-type Arabidopsis thaliana was extracted using the EASYspin Plus Complex Plant RNA Extraction Kit (Adley Biotechnology, Beijing, China). cDNA was generated via reverse transcription using the FastQuant RT Kit (Tiangen Biotech, Beijing, China). CsMADS9 Specific primers were designed using Primer-BLAST. qRT-PCR was performed on a Roche LightCycler 480 II real-time PCR system using ChemoHS Specific Plus qPCR Mixture (MonAmp, Suzhou, China). For qPCR, a 10 μL reaction volume contained 5 μL of 2×SYBR Green PCR master reaction mixture, 1 μL of cDNA (40 ng / μL), 0.2 μL of each primer, and 3.6 μL of ddH2O. GAPDH and AtTUB Used as an internal control. The specific reaction procedure was: 95 °C (pre-denaturation): 10 min; 95 °C (denaturation): 15 s; 60 °C (annealing): 30 s, with 40 cycles performed. AtTUB2As an internal reference gene for Arabidopsis thaliana, the nucleotide sequence of primer F1 is as shown in SEQ ID NO.3 (TCGTCCTACTTTGTGGAGTGG) and the nucleotide sequence of primer R1 is as shown in SEQ ID NO.4 (CTCGCCTGAACATCTCTTGG). CsMADS9 The primer sequences are as follows: the nucleotide sequence of primer F2 is SEQ ID NO.5 (TACGGCAGACAACCAGTTCA), and the nucleotide sequence of primer R2 is SEQ ID NO.6 (GCCGCTGTTATTGGATCATT). [The following text appears to be a separate, unrelated sentence:] ...using The relative fold change in gene expression was calculated using the method. The phenotype of the T3 generation homozygous Arabidopsis lines is shown below. Figure 2 , CsMADS9 The relative expression levels of the gene in wild-type Arabidopsis thaliana and OE1 and OE2 are shown in the figure. Figure 2 It can be seen that in OE1 and OE2 plants CsMADS9 The expression level was 25 to 27 times higher than that of the wild type. Figure 2 ).

[0026] Example 3: Phenotypic observation of transgenic Arabidopsis thaliana Seeds from wild-type and transgenic plants were sterilized in 75% ethanol for 8 minutes, rinsed twice with ddH2O, and sown on 1 / 2 MS medium containing 0.8% agar. Vernalization was carried out in the dark at 4°C for 3 days. The plants were then transferred to a 22°C culture room and germinated under a 16-hour / 8-hour light / dark cycle. Ten days after germination, the plants were transplanted into soil and placed in a growth room with the same light cycle, cultured under a 22°C / 20°C temperature cycle, and watered regularly. The number and length of pods were counted at the Arabidopsis fruit maturity stage (approximately 60 days). The results are shown below. Figure 3 The seeds of the transgenic plants were observed using an Olympus stereomicroscope (SZ61), and important morphological changes were photographed. The number of seeds within the pods was also counted. The results are shown below. Figure 3 We observed that the transgenic plants had significantly shorter pods and fewer pods. Although the seeds within the pods developed normally, the transgenic lines contained significantly fewer seeds per pod than the wild-type. Therefore, CsMADS9 In tea plants, it may primarily negatively regulate the number of seeds produced.

[0027] Example 4: The number of fruits produced by different tea varieties and CsMADS9 gene expression level To further explore CsMADS9To investigate the expression patterns in tea plants, flowers from different developmental stages (bud stage, white bud stage, and flowering stage) of the tea varieties 'Longjing 43' and 'Baihaozao' were collected and detected using real-time quantitative polymerase chain reaction (qRT-PCR). CsMADS9 The expression is as follows. Specific experimental methods are detailed in Example 3. Use... GAPDH As an internal reference gene, the nucleotide sequence of primer F3 is SEQ ID NO.7: TTGGCATCGTTGAGGGTCT, and the nucleotide sequence of primer R3 is SEQ ID NO.8: CAGTGGGAACACGGAAAGC. CsMADS9 The primer sequences are as follows: the nucleotide sequence of primer F2 is SEQ ID NO.5: TACGCCAGACAACCAGTTCA, and the nucleotide sequence of primer R2 is SEQ ID NO.6: GCCGCTGTTATTGGATCATT. [The following text appears to be a separate, unrelated sentence:] ...using... The method calculates the relative change level of gene expression. CsMADS9 The expression level increases as the flower develops. Furthermore, CsMADS9 The expression level in 'Longjing 43' was significantly higher than that in 'Baihaozao'. Further analysis of the seed production of 'Longjing 43' and 'Baihaozao' tea trees of the same age planted at the Hangzhou and Shengzhou germplasm resource nurseries of the Tea Research Institute of the Chinese Academy of Agricultural Sciences revealed that the seed production of 'Longjing 43' was consistently lower than that of 'Baihaozao'. Figure 4 (Further explanation) CsMADS9 The expression level of [a substance] showed a negative regulatory relationship with the number of fruits.

Claims

1. CsMADS9 Application of genes in regulating plant fruit yield.

2. The application according to claim 1, characterized in that, The CsMADS9 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The CsMADS9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

4. The application according to any one of claims 1-3, characterized in that, Regulating plant yield specifically involves reducing the number of pods and seeds, thereby decreasing the overall yield.

5. The application according to claim 4, characterized in that, The plants mentioned include the woody plant tea tree and the herbaceous plant Arabidopsis thaliana.

6. The application according to any one of claims 1-3, characterized in that, Including the following methods: 1) To make plants contain CsMADS9 Genes; or 2) causing plants to overexpress. CsMADS9 Gene.

7. The application according to claim 6, characterized in that, Method 2) uses an Agrobacterium-mediated method to process tea plants containing... CsMADS9 Gene recombinant vectors are transferred into plant genomes, and selected... CsMADS9 Transgenic plants with overexpression.

8. The application according to claim 7, characterized in that, The carrier is pBWA(V)HS- CsMADS9 .

9. A method for reducing the number of seeds produced by plants, characterized in that, Including the following methods: 1) To make plants contain CsMADS9 Genes; or 2) causing plants to overexpress. CsMADS9 Genes, the ones mentioned CsMADS9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images