A WRKY transcription factor regulating postharvest browning of pineapple cores and its application

Abstract

This invention provides a WRKY transcription factor that regulates postharvest browning of pineapple cores and its application. This invention's research found that blocking, reducing, silencing, or inhibiting the browning of pineapple cores... AcWRKY71 Gene expression can reduce the postharvest browning rate and inhibit the browning process in pineapples, and reduce the expression of key browning enzyme genes in pineapples. AcPPO , AcPAL and AcLOX This invention improves the sensory quality and nutrient retention of postharvest pineapples by expressing certain characteristics. It provides a new target for the development of pineapple germplasm innovation for browning resistance and green preservation technology, and has broad application prospects in pineapple breeding and postharvest preservation.

Description

Technical Field

[0001] This invention relates to the technical fields of plant genetic engineering and agricultural biology, specifically to a WRKY transcription factor that regulates postharvest browning of pineapple cores and its applications. Background Technology

[0002] Pineapple, a widely cultivated tropical fruit globally, is rich in vitamins, dietary fiber, and various minerals, boasting high nutritional value and strong market demand, thus holding a significant position in the tropical fruit industry. However, pineapples are highly susceptible to browning after harvest, with core browning being the most destructive post-harvest physiological disorder. This directly determines the fruit's edible quality and commercial appearance, and is a prominent challenge in pineapple post-harvest preservation. Specifically, it manifests as brown patches appearing in the core and surrounding flesh, a deteriorated and brittle texture, and a loss of flavor. This problem not only severely reduces the commercial value of pineapple fruit and significantly shortens its shelf life but also becomes a key bottleneck restricting the large-scale, high-quality development of the pineapple industry.

[0003] Current research has clearly shown that postharvest browning of pineapple cores is mainly enzymatic browning, a process synergistically regulated by multiple key enzymes: polyphenol oxidase (PPO) and peroxidase (POD) can specifically catalyze the oxidative polymerization of phenolic substances in the fruit, forming brown products; while phenylalanine ammonia-lyase (PAL) provides necessary precursors for the synthesis of phenolic substances. The three work together to form a regulatory network, jointly dominating the occurrence and development of browning in pineapple cores.

[0004] To address the issue of browning in the fruit core of pineapples after harvest, various control methods have been developed in existing technologies, but all have significant drawbacks, making it difficult to achieve efficient, safe, and large-scale application. Among these, chemical preservatives (such as sulfites and citric acid) are one of the more widely used methods, but their long-term use can leave residues in the fruit, posing potential food safety hazards and causing pollution to the ecological environment. Physical preservation technologies (such as low-temperature storage and controlled atmosphere storage) can delay the browning process in the fruit core to some extent, but they require large equipment investment and have high operating costs, making them unsuitable for large-scale production and promotion, and unable to meet the actual needs of the industry.

[0005] The development of genetic engineering technology has provided a new technical approach for breeding pineapple varieties resistant to core browning. However, most of the currently identified pineapple browning-related genes are downstream functional enzyme genes, with limited efficiency in regulating the core browning process, making it difficult to achieve precise and efficient regulation of pineapple core browning. Currently, apart from AcbHLH144 and AcJUB1 transcription factors, no other transcription factors directly involved in pineapple browning regulation have been reported. Therefore, identifying key transcription factors regulating the pineapple core browning pathway has become an urgent need for precise improvement of pineapple core browning and is also a core technical problem in the current research field of pineapple browning resistance.

[0006] WRKY transcription factors are a family of transcriptional regulators unique to plants, widely involved in various physiological processes such as plant stress response and secondary metabolism regulation, playing a crucial role in plant growth, development, and stress resistance regulation. Studies have confirmed that some members of this family play key regulatory roles in browning and color regulation in fruits and vegetables: in bananas, the transcriptional regulatory module composed of MaWRKY11, MaWRKY18, MaWRKY40, MaWRKY50, and MaWRKY60 can regulate the ascorbic acid oxidase gene. MaAAO1 The expression of lignin can influence low-temperature-induced browning of banana peels; in pears, the PbWRKY24 transcription factor can directly bind to and activate lignin synthesis genes. PbPRX4 The promoter promotes the formation of reddish-brown fruit peel.

[0007] Furthermore, WRKY71, as an important subtype of the WRKY transcription factor family, has been reported to participate in secondary metabolism and fruit ripening regulation in various plants. For example, it regulates anthocyanin synthesis in apples, strawberries, and hawthorns, and participates in the ethylene signaling pathway in tomatoes, thus affecting fruit ripening. However, there are no reports of its involvement in the regulation of fruit core browning. More importantly, no WRKY transcription factors related to core browning regulation in pineapples have been identified yet. Whether they participate in pineapple core browning regulation, their specific regulatory mechanisms, and their application potential are all unknown, leaving a gap in molecular regulation research on pineapple core browning.

[0008] In conclusion, postharvest browning of pineapple cores is a critical technical issue hindering the high-quality development of the pineapple industry. Screening and identifying WRKY transcription factors related to pineapple core browning, and elucidating their regulatory functions and mechanisms of action, will not only enrich the molecular theoretical system of pineapple core browning regulation, but also provide important theoretical basis and technical targets for developing efficient and safe pineapple core browning control technologies and breeding new pineapple varieties resistant to core browning. This has significant theoretical research value and remarkable practical application prospects. Summary of the Invention

[0009] To overcome the aforementioned defects and shortcomings in the existing technology, this invention provides a WRKY transcription factor that regulates postharvest browning of pineapple cores and its application.

[0010] The first object of the present invention is to provide AcWRKY71 Gene, AcWRKY71 Gene expression and / or AcWRKY71 Inhibitors of gene-encoded proteins are used to suppress postharvest browning of pineapple cores, or in the preparation of products that inhibit postharvest browning of pineapple cores.

[0011] A second objective of this invention is to provide the use of biomaterials in inhibiting browning of the pineapple core after harvest, or in the preparation of products that inhibit browning of the pineapple core after harvest.

[0012] The third objective of this invention is to provide a method for inhibiting browning of the core of pineapples after harvest.

[0013] The fourth objective of this invention is to provide a method for preparing browning-resistant pineapple germplasm.

[0014] The fifth objective of this invention is to provide a product that inhibits browning of the core of pineapple after harvest.

[0015] This invention claims protection for the following: AcWRKY71 Gene, AcWRKY71 Gene expression and / or AcWRKY71 Inhibitors of gene-encoded proteins are used to suppress postharvest browning of pineapple cores, or in the preparation of products that inhibit postharvest browning of pineapple cores.

[0016] Preferably, the AcWRKY71 A gene is any of the following nucleic acid molecules: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO: 3; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO:4.

[0017] As one feasible approach, the inhibitor includes AcWRKY71 Gene knockout mutants, siRNA, or shRNA.

[0018] Preferably, the gene encoding the key enzyme for inhibiting browning of pineapple core after harvest is used to inhibit browning of pineapple. AcPPO , AcPAL and / or AcLOX The expression.

[0019] The application of biomaterials in inhibiting browning of pineapple cores after harvest, or in the preparation of products that inhibit browning of pineapple cores after harvest, wherein the biomaterial is any one of the following: (i) Blocking, reducing, silencing or inhibiting the activity of pineapple AcWRKY71 Nucleic acid molecules involved in gene expression; (ii) An expression cassette containing the nucleic acid molecule described in (i); (iii) A recombinant vector containing the nucleic acid molecule described in (i) or the expression cassette described in (ii); (iv) A recombinant microorganism containing the nucleic acid molecule described in (i), the expression cassette described in (ii), or the recombinant vector described in (iii); (v) A recombinant cell line containing the nucleic acid molecule described in (i) or the expression cassette described in (ii).

[0020] Preferably, the AcWRKY71 A gene is any of the following nucleic acid molecules: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO: 3; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO:4.

[0021] A method for inhibiting browning of the core in pineapple after harvest, the method comprising blocking, reducing, silencing or inhibiting browning of the core in pineapple. AcWRKY71 Gene expression.

[0022] A method for preparing browning-resistant pineapple germplasm, blocking, reducing, silencing or inhibiting browning in pineapples. AcWRKY71 Gene expression was used to obtain transgenic pineapple plants, which are resistant to browning pineapple germplasm.

[0023] As one feasible approach, the silent pineapple AcWRKY71 The gene expression method employs a TRV virus-mediated silencing system, which includes a TRV1 vector and contains... AcWRKY71 Recombinant TRV2 vectors containing gene-specific fragments; The AcWRKY71 The nucleotide sequence of the gene-specific fragment is shown in SEQ ID NO: 16.

[0024] Preferably, the AcWRKY71 A gene is any of the following nucleic acid molecules: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO: 3; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO:4.

[0025] A product that inhibits browning of pineapple cores after harvest, comprising blocking, reducing, silencing, or inhibiting... AcWRKY71 Reagents for gene expression.

[0026] Preferably, the AcWRKY71 A gene is any of the following nucleic acid molecules: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO: 3; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO:4.

[0027] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a WRKY transcription factor that regulates postharvest browning of pineapple cores and its application. This invention's research found that blocking, reducing, silencing, or inhibiting the browning of pineapple cores... AcWRKY71 Gene expression can reduce the postharvest browning rate and inhibit the browning process in pineapples, and reduce the expression of key browning enzyme genes in pineapples. AcPPO , AcPAL and AcLOX This invention improves the sensory quality and nutrient retention of postharvest pineapples by expressing certain characteristics. It provides a new target for the development of pineapple germplasm innovation for browning resistance and green preservation technology, and has broad application prospects in pineapple breeding and postharvest preservation. Attached Figure Description

[0028] Figure 1 for AcWRKY71 Gene cloning and identification; A: AcWRKY71 Electrophoresis diagram of PCR amplification products of gene CDS sequence, B: Schematic diagram of WRKY domain and zinc finger structure of AcWRKY71 protein, C: Based on AcWRKY71 The constructed phylogenetic tree.

[0029] Figure 2 During the browning process of pineapple core after harvesting, AcWRKY71 and the expression levels of browning enzyme-related genes; A: Phenotypic diagram of core browning in pineapples during postharvest storage, B-E respectively AcWRKY71 , AcPPO , AcPAL , AcLOX The expression levels of the gene at 0, 3, 6 and 9 days post-harvest of pineapple were significantly different (p<0.05).

[0030] Figure 3 The images show the browning phenotypes of pineapple fruits; A: browning phenotype analysis of whole pineapple fruits on day 5 after injection of Agrobacterium-mediated browning solution; B: browning phenotypes of transgenic pineapple fruits after immersion in Agrobacterium-mediated browning solution in cut pieces at different postharvest times; pEAQ represents the overexpression empty vector control, pEAQ- AcWRKY71 express AcWRKY71 Overexpression treatment, TRV2 represents the TRV1+TRV2 silenced empty vector control, TRV2 -AcWRKY71 express AcWRKY71 The silent treatment.

[0031] Figure 4 Results of physiological characterization of browning in pineapple fruit; A, G: overexpression or silencing. AcWRKY71 Browning index of pineapple fruit genes, B, H: overexpression or silencing. AcWRKY71 Soluble quinone content in pineapple fruit, C, I: overexpression or silencing of genes. AcWRKY71Total phenolic content of pineapple fruit, D-F, J-L: overexpression or silencing of genes. AcWRKY71 The PPO, PAL, and LOX enzyme activities of the gene in pineapple fruit; pEAQ represents the overexpression empty vector control, pEAQ- AcWRKY71 express AcWRKY71 Overexpression treatment, TRV2 represents the TRV1+TRV2 silenced empty vector control, TRV2 -AcWRKY71 express AcWRKY71 The silence treatment; different letters indicate significant differences (p<0.05).

[0032] Figure 5 for AcWRKY71 Transcriptional regulation mechanisms of downstream target genes; A: AcWRKY71 and AcPPO , AcPAL , AcLOX Results of yeast one-hybrid assay with promoter binding, B: AcWRKY71 Transcription activation AcPPO , AcPAL , AcLOX The results of the dual-luciferase assay were as follows: *p<0.05, ***p<0.0001, ****p<0.00001. Detailed Implementation

[0033] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0034] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0035] Example 1 AcWRKY71 Cloning and identification of genes I. Experimental Methods 1. RNA extraction Using 80% ripe, undamaged "Bali" pineapple fruit as material, total RNA was extracted using a universal plant RNA extraction kit (polysaccharide / polyphenol) (brand: Beijing Huayueyang Biotechnology, catalog number: 0416-50), strictly following the kit instructions. Take 50 mg of pineapple pulp powder ground in liquid nitrogen and place it in a centrifuge tube containing 1 mL of lysis buffer. Vortex to mix. Then add 300 μL of protein removal buffer and 200 μL of chloroform, vortex for 30 s, and incubate at room temperature for 2 min. Centrifuge at 12000×g for 5 min at room temperature, and carefully aspirate the upper aqueous phase, avoiding contact with the middle layer. Mix the resulting aqueous phase with an equal volume of wash buffer, transfer it to an adsorption column, centrifuge at 12000×g for 1 min, and then perform on-membrane DNase I digestion (37℃ for 5 min) to remove genomic DNA. Subsequently, wash the adsorption column twice with wash buffer, and finally add 50 μL of elution buffer, incubate at room temperature for 5 min, centrifuge, and collect RNA.

[0036] 2. Obtaining cDNA through reverse transcription Using PrimeScript TM The RT Reagent Kit (brand: TaKaRa, catalog number: RR037) reverse transcribes the RNA obtained in step 1 to obtain cDNA. The specific steps are as follows: Prepare the reaction solution according to the system in Table 1, and incubate at 42℃ for 2 min; Table 1 Reaction System

[0037] After the reaction was completed, 1.0 μL of PrimeScript RT Enzyme Mix Ⅰ, 1.0 μL of RT Primer Mix, 4.0 μL of 5×PrimeScript Buffer, and 4.0 μL of RNase-Free ddH2O were added to the above 10 μL reaction solution. The mixture was incubated at 37℃ for 15 min, inactivated at 85℃ for 5 s, and the product was stored at -20℃.

[0038] 3. PCR amplification According to the pineapple genome database (https: / / phytozome-next.jgi.doe.gov / ) AcWRKY71 Specific primers were designed based on the CDS sequence of the gene (F: 5'-ATGTCACAAGAGAGAGGAGAG-3', SEQ ID NO: 1; R: 5'-TGGTTGATTTTGGTGAATGAA-3', SEQ ID NO: 2), and all primers were diluted to a concentration of 10 μmol / L.

[0039] PCR amplification system (25 μL): 1 μL cDNA template, 1 μL upstream primer, 1 μL downstream primer, 12.5 μL 2×Taq PCRMaster Mix, 9.5 μL ddH2O.

[0040] Amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ final extension for 10 min, 4℃ hold.

[0041] The amplified products were detected by 1% agarose gel electrophoresis (w / v), the target band was recovered, ligated into the pMD20-T vector (TaKaRa), transformed into E. coli DH5α competent cells, plated on LB solid medium containing ampicillin (100 μg / mL), and incubated upside down at 37°C for 16 h.

[0042] Single colonies were picked for colony PCR verification. Figure 1 (A) Positive clones were sent for sequencing to obtain... AcWRKY71 The full-length sequence of the gene CDS (SEQ ID NO: 3, 1011 bp) is shown in SEQ ID NO: 4.

[0043] 4. Bioinformatics Analysis The domains were analyzed using the SMART online tool (http: / / smart.embl-heidelberg.de / ) to confirm that they contain typical WRKY domains and zinc finger structures; a phylogenetic tree was constructed using MEGA 11 software with the neighbor-joining method (NJ method).

[0044] II. Experimental Results Phylogenetic analysis using Arabidopsis WRKY family members as a reference confirmed that AcWRKY71 The evolutionary origins of [the species / organization]. For example... Figure 1 As shown in C, AcWRKY71 and AtWRKY71 , AtWRKY8 , AtWRKY28 and AtWRKY75 They cluster together and belong to the same WRKY class II transcription factors.

[0045] Furthermore, the sequence alignment results show that, AcWRKY71 It contains a highly conserved WRKYGQK amino acid sequence (WRKY motif, SEQ ID NO: 5) and a C2H2 type zinc finger motif ( Figure 1 (B in the middle).

[0046] Example 2 AcWRKY71 Gene expression pattern analysis I. Experimental Methods Bali pineapple fruits were selected when they were about 70-80% physiologically mature (60-80% of the small fruits at the bottom of the fruit had turned yellow, while the upper part was still green). After harvesting, they were stored at 25±1℃ and 60%-70% relative humidity. Samples were taken on days 0, 3, 6, and 9, with 3 biological replicates at each time point and 3 fruits per replicate. Fruit pulp tissue was taken, and total RNA was extracted and reverse transcribed into cDNA according to Example 1.

[0047] With pineapple AcEF1α The gene is an internal reference gene, used for detection. AcWRKY71 and AcPPO , AcPAL , AcLOX The gene expression levels and qRT-PCR specific primers are shown in Table 2.

[0048] Table 2 qRT-PCR specific primers

[0049] Refer to PerfectStart ® Green qPCR SuperMix (+Dye I) Kit (Brand: TransGenBiotech, Catalog No.: AQ602) Preparation of qRT-PCR reaction system (20 μL): SYBR Premix Ex Taq TM II 10 μL, 10 μmol / L upstream primer 0.8 μL, 10 μmol / L downstream primer 0.8 μL, cDNA template 2 μL (200 ng / μL), ddH2O 6.4 μL.

[0050] The qRT-PCR reaction program was as follows: 95℃ for 3 min; 95℃ for 5 s, 55℃ for 10 s, 72℃ for 30 s, for 35 cycles. Each sample was tested in triplicate, using 2... -△△Ct The relative expression levels of each gene are calculated using this method.

[0051] II. Experimental Results like Figure 2 As shown in B, AcWRKY71 The expression level remained low from day 0 to 3 postharvest, and significantly increased from day 6 to 9. Its trend correlated with the degree of browning in the pineapple core. Figure 2 A) in the data shows a positive correlation. Meanwhile, the key browning enzyme gene... AcPPO , AcPAL , AcLOX All showed upregulation ( Figure 2 (C to E in the text): where, AcPPO and AcLOX It reached its peak on the 9th day of storage. AcPALThe expression peaks on day 6.

[0052] AcWRKY71 The synergistic upregulation trend with these genes suggests that they may act as upstream regulators, positively regulating the transcriptional expression of key browning enzyme genes.

[0053] Example 3: Overexpression or silencing AcWRKY71 The Influence of Genes on Postharvest Browning of Pineapple Core I. Experimental Methods 1. Construction of the silencing carrier The TRV virus silencing system is used to achieve gene silencing. The TRV virus silencing system consists of a TRV1 helper vector and a TRV2 silencing vector. The TRV1 helper vector provides the functional proteins required for viral replication and movement, while the TRV2 silencing vector carries the target gene fragment. Both need to be transformed into Agrobacterium and mixed to infiltrate plant material in order to achieve gene silencing.

[0054] according to AcWRKY71 The CDS nucleotide sequence of the gene (SEQ ID NO: 3) was used to amplify the following specific target fragment (SEQ ID NO: 16, 211 bp in length, avoiding conserved regions of the WRKY family): CCTCCGAGGGAGCTCGCACTTCCTGGCGCCGTCGCCGAGCTTTCGGGGCCCAGGAGTTTCTTAACCCTAGCAGCCACCACCACATGAGCACAAACCCTACCATGTACCTGCCAATTAGCCTACCCCCTCCTCTCCAGCAGCTCCAAGTATTCCCTGACTATGGTCTCCTTCAGGACATCATCCCCTCCTTCATTCACCAAAATCAACCATGA (SEQ ID NO: 16); Primers contain BamHI and SmaI restriction sites (F: CTTCGGGACATGCCCGGGCCTCCGAGGGAGCTCGCACT, SEQ ID NO: 17; R: AGGCCTCCATGGGGATCCTCATGGTTGATTTTGGTGAA, SEQ ID NO: 18).

[0055] The TRV2 silencing vector was double-digested with BamHI and SmaI restriction endonucleases. The digestion system (50 μL) consisted of 1 μg vector, 2 μL BamHI, 2 μL SmaI, 5 μL 10×Buffer, and ddH2O to a final volume of 50 μL. The digestion was carried out at 37°C for 3 h, and the digestion products were then recovered by 1% agarose gel electrophoresis (w / v).

[0056] The ligation reaction was performed using a rapid recombination seamless cloning kit (brand: NewSemi Biotechnology, catalog number: M9001): the vector and the target gene fragment (its nucleotide sequence is as shown in SEQ ID NO: 16) were mixed at the optimal molar ratio of 1:3 (the amount added was 20-50 ng), 5 μL of 2×EasyFusion Assembly Master mix was added, and ddH2O was added to make up to 10 μL. The mixture was reacted at 50℃ for 30 min to obtain the ligation product.

[0057] The ligation product was transformed into *E. coli* DH5α competent cells, plated on LB agar containing kanamycin (50 μg / mL), and incubated at 37°C for 12 h. Single colonies were picked for colony PCR verification, and positive clones were confirmed by sequencing to obtain the silencing vector TRV2-. AcWRKY71 .

[0058] 2. Construction of overexpression vectors according to AcWRKY71 The CDS nucleotide sequence of the gene (SEQ ID NO: 3) was used to design primers to amplify the full-length sequence (with AgeI restriction sites, F: CAAATTCGCGACCGGTATGTCACAAGAGAGAGGAGAG, SEQ ID NO: 19; R: TGCTAGTCATACCGGTTGGTTGATTTTGGTGAATGAA, SEQ ID NO: 20). After gel extraction and recovery, the sequence was ligated into the pEAQ-GFP vector, followed by restriction enzyme digestion, positive colony screening, and sequencing verification to confirm the gene's CDS nucleotide sequence (SEQ ID NO: 3). AcWRKY71 The full-length CDS sequence was correctly inserted downstream of the CaMV 35S promoter, resulting in the overexpression vector pEAQ-. AcWRKY71 .

[0059] 3. Genetic transformation Pineapple fruits were transformed using Agrobacterium-mediated transformation with Agrobacterium strain GV3101. The constructed overexpression vector pEAQ- AcWRKY71 Or silence the vector TRV2- AcWRKY71 (Needs to be transformed together with TRV1 helper vector) Transform Agrobacterium competent cells separately using the freeze-thaw method: Thaw 100 μL of Agrobacterium competent cells on ice, add 1 μg of recombinant plasmid, mix well, incubate on ice for 30 min, then freeze the centrifuge tube in liquid nitrogen for 5 min, followed by a 37°C water bath for 5 min, and then an ice bath for 5 min. Under aseptic conditions, add 800 μL of LB liquid medium and incubate at 28°C with shaking at 200 r / min for 2 h. Then, spread the culture onto LB solid medium containing kanamycin (50 μg / mL) and rifampin (25 μg / mL) and incubate upside down at 28°C for 3 days.

[0060] Select a single positive colony and culture it until the bacterial solution turns orange (OD). 600 Take out approximately 1.0 g, centrifuge at 3000 g for 5 min, discard the supernatant, and collect the bacterial cells.

[0061] The bacterial resuspended and OD was adjusted using an inoculation solution (containing 80 mL sterile water, 10 mL 10 mM MgCl2, 10 mL 10 mM MES at pH 5.7, and 150 μL 100 mM AS). 600 The solution was diluted to 0.8 and allowed to stand at 28°C in the dark for 3 hours to obtain the Agrobacterium-infected solution.

[0062] 4. Phenotypic observation (1) Cutting method Select uniformly sized, undamaged "Bali" pineapple fruits, disinfect them by soaking them in a 1% sodium hypochlorite aqueous solution (w / v) for 1 min, and then air-dry them. In a clean bench, use a sterile fruit knife to cut the pulp 1 cm from the core, and cut it into small cubes of 1.5 cm × 1.5 cm × 1.5 cm. Immerse the fruit cubes in the Agrobacterium tumefaciens infusion solution prepared in step 3 for 1 h, then transfer them to a preservation box lined with moistened filter paper and co-culture them at room temperature in the dark for 5 days, observing the browning process.

[0063] (2) Whole fruit injection method Select "Bali" pineapple fruits of the same size as those cut into pieces as described above, disinfect them by soaking in a 1% sodium hypochlorite aqueous solution (w / v) for 1 minute, and then air dry. In a clean bench, use a sterile syringe to draw 0.2 mL of the Agrobacterium tumefaciens inoculum solution (OD200) prepared in step 3. 600 =0.8), slowly inject the bacterial solution onto the equatorial surface of the fruit, penetrating vertically 2 cm into the pulp (avoiding the core) to ensure even diffusion of the bacterial solution within the tissue. After injection, place the whole fruit in darkness and at 80%–90% relative humidity for 5 days of co-cultivation. After co-cultivation, cut the pulp tissue 1 cm from the core to observe the browning.

[0064] II. Experimental Results Phenotypic observations showed that the phenotypes of the cut-fruit and whole-fruit conversion systems were basically consistent. In the cut-fruit conversion system, the degree of browning varied significantly among the groups at different storage time points (1 d, 3 d, 5 d). Figure 3 (B in the text). On day 1, the pulp of all treatment groups showed no obvious browning, and the phenotypes were consistent. On day 3, compared with the overexpression empty vector control group (pEAQ), pEAQ- AcWRKY71 The brown spots were more pronounced in the group; while compared with the silent empty control group (TRV2), TRV2- AcWRKY71 Browning was significantly reduced in the group; On day 5, pEAQ- AcWRKY71 Browning was further aggravated in the TRV2- group compared to the pEAQ group. AcWRKY71 The browning in the group was still significantly less than that in the TRV2 group.

[0065] Similar results were obtained in the whole-fruit transformation system. After co-culturing for 5 days, compared with the pEAQ group or the TRV2 group, overexpression... AcWRKY71 The injected pulp showed obvious browning, while the silent one... AcWRKY71 The degree of browning at the injection site was significantly reduced. Figure 3 (A in the middle).

[0066] The above results indicate that overexpression AcWRKY71 The gene can significantly promote the occurrence and development of browning in the core of pineapple fruit after harvest, and silencing the gene can effectively inhibit the browning process.

[0067] Example 4: Overexpression or silencing AcWRKY71 Influence of genes on postharvest physiological characteristics of pineapple I. Experimental Methods The pulp tissue from the fruit cultured for 5 days using the "whole fruit injection method" in step 4 of Example 3 was used to determine the degree of browning, soluble quinones, polyphenol oxidase (PPO) activity, phenylalanine ammonia-lyase (PAL) activity, lipoxygenase (LOX) activity, and total phenol content. The specific steps are as follows: (1) Degree of browning Take 1 g of pineapple pulp tissue, add 5 mL of 0.1 M phosphate buffer (containing 60% ethanol, v / v, and 2% PVP, w / v, pH 6.8) pre-cooled at 4℃, centrifuge at 15000×g for 15 min at 4℃, collect the supernatant, and measure its absorbance at 420 nm. The results are expressed as OD. 420 ·kg -1 Fresh weight indicates.

[0068] (2) Content of soluble quinones Take 1 g of pineapple pulp tissue, add 5 mL of methanol, centrifuge at 12000×g for 20 min at room temperature, measure the absorbance of the supernatant at 437 nm, and express the result as OD. 437 ·kg -1 Fresh weight indicates.

[0069] (3) Polyphenol oxidase (PPO) activity assay Weigh 0.2 g of pineapple pulp tissue into a centrifuge tube, add 1 mL of extraction buffer (0.2 M pH 6.4 phosphate buffer containing 0.5% polyvinylpyrrolidone, w / v), centrifuge at 4℃ and 13000×g for 30 min, collect the supernatant (i.e., enzyme extract) and place it on ice for later use. The total volume of the reaction system was 3.0 mL, including 2.6 mL of 0.2 M phosphate buffer (pH 6.4), 0.3 mL of 0.5 M catechol solution, and 0.1 mL of enzyme extraction solution. After mixing, the absorbance change at 398 nm wavelength was recorded within 30 s. The amount of enzyme required to increase the absorbance by 1 ppm per minute was defined as 1 PPO activity unit (U).

[0070] (4) Assay of phenylalanine ammonia-lyase (PAL) activity Take 0.1 g of pineapple pulp tissue, add 1 mL of pre-cooled 0.1 M borate buffer (pH 8.8, containing 5 mM mercaptoethanol and 2 mM EDTA) for extraction, centrifuge at 4℃ and 13000×g for 20 min, and collect the supernatant (i.e., enzyme extract).

[0071] Take 0.1 mL of enzyme extract and 1 mL of 0.02 M L-phenylalanine and incubate at 40 °C for 1 h. Add 0.03 mL of 6 M HCl to terminate the reaction and measure the absorbance at 290 nm. PAL activity is expressed as the rate of change of absorbance, and one enzyme activity unit (U) is defined as an increase of 0.01 absorbance per minute.

[0072] (5) Lipoxygenase (LOX) activity assay Take 5 g of pineapple pulp tissue, add 5 mL of extraction buffer (0.1 mol / L phosphate buffer, pH 6.8, containing 1% Triton X-100, v / v, and 4% polyvinylpyrrolidone PVPP, w / v) pre-cooled at 4℃, homogenize thoroughly, and centrifuge at 12000×g for 30 min at 4℃. Collect the supernatant as crude enzyme extract. The total volume of the reaction system was 3.00 mL, including 2.7 mL of 0.2 mol / L acetate-sodium acetate buffer (pH 6.0), 0.15 mL of 0.1 mol / L sodium linoleate solution, and 0.15 mL of crude enzyme extract. After mixing, the increase in absorbance at 234 nm was measured to assess the oxidation degree of sodium linoleate, with an increase of 0.01 μL of absorbance per minute defined as one LOX activity unit (U).

[0073] (6) Total phenol content The standard curve of gallic acid (y = 0.0875x + 0.0578, R0) was used to measure the gallic acid content. 2 = 0.9971), the result is expressed in g·kg -1 Fresh weight indicates.

[0074] All indicators were set to be replicated three times technically, and the experiment was replicated at least three times biologically.

[0075] II. Experimental Results like Figure 4 As shown, compared with the TRV2 control group, silence AcWRKY71 It significantly inhibited browning of the pineapple core after harvest, specifically by reducing the browning index by 10.8%–11.9%. Figure 4 In G), the content of soluble quinones decreased by 5.6%–8.2%. Figure 4 The enzyme activities of H), PPO, PAL and LOX decreased by 32.3%–40.0%, 22.3%–40.0% and 29.4%–45.9%, respectively. Figure 4 In the J-L range, the accumulation of phenolic substances decreased by 14.1% to 26.0%. Figure 4 (I in the middle).

[0076] Conversely, compared to the pEAQ control group, overexpression AcWRKY71 This significantly promoted browning, increasing the browning index by 15.8%–17.1%. Figure 4 In A), the content of soluble quinones increased by 8.0–13.9%. Figure 4 In B), the accumulation of phenolic substances increased by 24.0%–35.1%. Figure 4 The enzyme activities of PPO, PAL, and LOX also increased by 25.8%–33.3%, 22.1%–34.7%, and 67.1%–76.9%, respectively (C). Figure 4 (D~F in the middle).

[0077] The above results further indicate that, AcWRKY71 Overexpression of the gene significantly promotes browning of the pineapple core after harvest, while silencing the gene inhibits browning.

[0078] Example 5 AcWRKY71Mechanism of gene regulation of postharvest browning of pineapple core I. Yeast One-Hybrid Experiment 1. Experimental Methods Cloning was performed using primers as shown in Table 3. AcWRKY71 CDS sequences and AcPPO , AcPOD and AcPAL The promoter sequence of the gene (approximately 1500 bp in length, containing potential W-box elements).

[0079] Table 3 Primers used for constructing yeast one-hybrid vectors

[0080] AcPPO , AcPOD and AcPAL The promoter sequence of the gene was inserted into the Hind III and XhoI restriction sites of the pAbAi vector to construct the bait vector. The bait vector was transformed into yeast Y1HGold strain and plated on SD / -Ura medium. Positive clones were screened, and the minimum inhibitory concentration (200 ng / mL) was determined by a gradient aureobasidin A (AbA) resistance assay.

[0081] Will AcWRKY71 The full-length CDS sequence (including Nde I and Xho I restriction sites) was inserted into the pGADT7 vector to construct the prey vector (also known as the AD vector). The prey vector and the bait vector were co-transformed into the Y1HGold strain. At the same time, the Y1HGold strain was co-transformed with the empty prey vector and the bait vector as a negative control. The samples were plated on SD / -Leu medium and cultured at 30°C for 3 days.

[0082] Positive clones were picked and inoculated into SD / -Leu medium containing 200 ng / mL AbA and cultured at 30℃ for 3 days. Colony growth was observed, and reporter gene expression was detected by X-α-Gal staining.

[0083] 2. Experimental Results like Figure 5 As shown in Figure A, on a culture medium supplemented with 200 ng / mL or more AbA, pAbAi- AcPPO pAbAi- AcLOX and pAbAi-AcPAL No single colony growth was observed in the yeast strain corresponding to the promoter vector, indicating that 200 ng / mL AbA can effectively inhibit the self-activation of the above vector.

[0084] co-expression AcWRKY71 and AcPPO , AcLOX and AcPAL The yeast strains with the promoters grew well on SD medium supplemented with the corresponding concentration of AbA; however, the negative control strains transfected with empty prey vectors and bait vectors could not grow under the same selection pressure.

[0085] The above results indicate that AcWRKY71 Can bind to target genes AcPPO , AcLOX and AcPAL The promoter.

[0086] II. Dual-luciferase reporter assay 1. Experimental Methods Clone the clones using the primers shown in Table 4. AcPPO , AcPOD and AcPAL The promoter sequence of the gene was obtained and cloned into the pGreen II 0800-LUC vector through Hind III and BamHI restriction sites to construct the corresponding reporter vector; Table 4 Primers used in the construction of dual-luciferase reporter vectors

[0087] pEAQ- constructed in Example 3 AcWRKY71 The overexpression vector was used as the effector vector, and the empty pEAQ-GFP vector (Empty) was used as a negative control. The effector vector and reporter vector were mixed at a 9:1 ratio using the Agrobacterium co-injection method (OD200). 600 All samples were 0.1–0.2 g of the solution and then suspended in the dark for 3 h. Subsequently, leaves of 4–6 week old tobacco plants were injected, with 3 tobacco plants (9 leaves) in each group. After injection, the plants were cultured at 25°C under light conditions for 48 h.

[0088] Use the Dual-Luciferase Assay Kit (Cat#E1910, brand: Promega) and via Spark ® A multifunctional microplate detector was used to detect the luminescence values ​​of two luciferins, LUC and REN, in tobacco leaves, and the transcriptional activity was determined by the ratio of the two luciferins.

[0089] 2. Experimental Results like Figure 5 As shown in B, AcWRKY71 and AcPPO , AcPAL , AcLOX After co-expression with the reporter vector, the LUC / REN ratio increased significantly, indicating that... AcWRKY71 Activable AcPPO , AcPAL , AcLOX Transcription.

[0090] The combined results of the above yeast one-hybrid assay and dual-luciferase reporter assay indicate that, AcWRKY71 By direct combination AcPPO , AcPAL , AcLOX The promoter activates the expression of these genes.

[0091] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. AcWRKY71 Gene, AcWRKY71 Gene expression and / or AcWRKY71 Inhibitors of gene-encoded proteins are used to suppress postharvest browning of pineapple cores, or in the preparation of products that inhibit postharvest browning of pineapple cores.

2. The application according to claim 1, characterized in that, The AcWRKY71 A gene is any of the following nucleic acid molecules: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO: 3; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO:

4.

3. The application according to claim 1, characterized in that, The inhibitors include AcWRKY71 Gene knockout mutants, siRNA, or shRNA.

4. The application of biomaterials in inhibiting browning of the core in pineapple after harvest, or in the preparation of products that inhibit browning of the core in pineapple after harvest, characterized in that, The biomaterial is any one of the following: (i) Blocking, reducing, silencing or inhibiting the activity of pineapple AcWRKY71 Nucleic acid molecules involved in gene expression; (ii) An expression cassette containing the nucleic acid molecule described in (i); (iii) A recombinant vector containing the nucleic acid molecule described in (i) or the expression cassette described in (ii); (iv) A recombinant microorganism containing the nucleic acid molecule described in (i), the expression cassette described in (ii), or the recombinant vector described in (iii); (v) A recombinant cell line containing the nucleic acid molecule described in (i) or the expression cassette described in (ii).

5. The application according to claim 4, characterized in that, The AcWRKY71 A gene is any of the following nucleic acid molecules: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO: 3; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO:

4.

6. A method for inhibiting browning of the core in pineapples after harvest, characterized in that, The method involves blocking, reducing, silencing, or inhibiting the activity of pineapple. AcWRKY71 Gene expression.

7. A method for preparing browning-resistant pineapple germplasm, characterized in that, Blocking, reducing, silencing or inhibiting the effects of pineapple AcWRKY71 Gene expression was used to obtain transgenic pineapple plants, which are resistant to browning pineapple germplasm.

8. The method according to claim 6 or 7, characterized in that, The AcWRKY71 A gene is any of the following nucleic acid molecules: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO: 3; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO:

4.

9. A product for inhibiting browning of the core in pineapples after harvest, characterized in that, Includes blocking, reducing, silencing, or inhibiting. AcWRKY71 Reagents for gene expression.

10. The product according to claim 9, characterized in that, The AcWRKY71 A gene is any of the following nucleic acid molecules: (1) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO: 3; (2) Nucleic acid molecules other than (1) that encode the amino acid sequence shown in SEQ ID NO:4.

Images