A method for establishing a genetic transformation and regeneration system for purslane

Abstract

This invention discloses a method for establishing a genetic transformation and regeneration system for purslane, belonging to the field of plant genetic engineering technology. The method includes aseptic treatment of purslane seeds, inoculation into MS solid medium for seedling culture to obtain transformation recipient material, excision of cotyledons from the seedlings as explants, inoculation into a pre-culture medium for pre-culture, preparation of Agrobacterium-mediated transformation solution containing the target vector, and activation with the addition of acetic acid (AS), immersion of the pre-cultured explants in the Agrobacterium-mediated transformation solution for infection, followed by transfer to a co-culture medium for co-culture, washing and sterilization of the co-cultured explants, and selection culture using gradient concentrations of hygromycin until regenerated plants are obtained. Molecular-level identification of the regenerated plants is then performed. This invention improves the transformation efficiency of purslane through pre-culture, AS induction, and gradient selection, inhibits browning, and achieves stable gene integration, solving the problem of poor reproducibility in genetic transformation.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to a method for establishing a genetic transformation and regeneration system for purslane. Background Technology

[0002] Purslane belongs to the genus Portulaca in the family Portulacaceae. It is an annual herb with extremely high medicinal and edible value, and is rich in... Fatty acids, flavonoids, polysaccharides, and various vitamins exhibit significant pharmacological activities in antioxidation, anti-inflammation, and cardiovascular protection. They are also important model plants for studying plant stress resistance and C4 photosynthetic metabolism. Genetic transformation and regeneration systems refer to the technical system of obtaining transgenic plants through the integration of exogenous DNA and the regeneration of recipient cells. This is a core method for functional gene identification and crop variety improvement. Agrobacterium-mediated transformation is the most commonly used method for plant genetic transformation, but its success rate highly depends on an efficient regeneration system and precise optimization of transformation parameters.

[0003] Purslane tissues are extremely sensitive to exogenous biological and chemical stresses. During Agrobacterium infection and screening with high concentrations of antibiotics, explants are prone to severe stress responses, leading to severe tissue browning and oxidative damage, which in turn causes a large number of explants to die, resulting in low regeneration efficiency. At the same time, the natural transformation frequency of purslane is low, often due to insufficient activation of the Agrobacterium Vir gene, resulting in insufficient T-DNA integration efficiency. Existing transformation methods lack a systematic gradient screening strategy, and directly applying high pressure screening makes it difficult for resistant shoots to differentiate, or produces a large number of chimeras due to incomplete screening. Summary of the Invention

[0004] The purpose of this invention is to propose a method for establishing a purslane genetic transformation and regeneration system in order to solve the problems of easy browning and oxidative damage of purslane tissue and the insufficient integration efficiency of existing genetic transformation and regeneration systems.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A method for establishing a genetic transformation and regeneration system for purslane includes sterilizing purslane seeds, inoculating them onto MS solid medium for seedling culture, and obtaining transformation recipient materials.

[0007] The cotyledons of the seedlings were cut off as explants and inoculated into a pre-culture medium for pre-culture.

[0008] A fungicide-containing Agrobacterium infection solution was prepared and activated by adding acetylsuccinone (AS);

[0009] The pre-cultured explants were immersed in Agrobacterium infection solution for infection, and then transferred to co-culture medium for co-culture.

[0010] The explants after co-culture were washed and sterilized, and then screened and cultured with gradient concentrations of hygromycin until regenerated plants were obtained.

[0011] Molecular-level identification was performed on the regenerated plants.

[0012] As a further description of the above technical solution:

[0013] The specific parameters for seedling culture are: cultured for 7-10 days at 25°C under a 16-hour light / 8-hour dark condition;

[0014] The aseptic treatment includes: disinfecting with 75% alcohol for 30 seconds, then soaking in 84 disinfectant for 15 minutes, and rinsing with sterile water 3-5 times.

[0015] As a further description of the above technical solution:

[0016] The specific steps of the pre-culture are as follows: cut the cotyledon explant in half to increase the wound area, inoculate it with the upper surface facing up into the pre-culture medium, and culture it in the dark at 25°C for 4-5 days.

[0017] As a further description of the above technical solution:

[0018] The preparation of the Agrobacterium infection solution includes: culturing Agrobacterium at 28°C and 220 rpm until the OD600 reaches 0.6, centrifuging at 5000g for 10 minutes, resuspending the bacterial cells in a resuspension solution containing 200 μM / LAS, and adjusting the OD600 to 0.6-0.8.

[0019] As a further description of the above technical solution:

[0020] The parameters for infection and co-culture are as follows: infection time is 20 minutes, with gentle shaking during the process;

[0021] The co-culture medium contained 100 μM / LAS and was incubated in the dark at 25°C for 3 days.

[0022] As a further description of the above technical solution:

[0023] The gradient concentration hygromycin screening culture includes: the first stage using a medium containing 1.5 mg / L hygromycin for 2 weeks;

[0024] In the second stage, the samples were transferred to differentiation medium containing 2.0 mg / L hygromycin for enhanced screening.

[0025] As a further description of the above technical solution:

[0026] During the screening and culture process, 200 mg / L termethin was used for sterilization.

[0027] As a further description of the above technical solution:

[0028] The crop is tomato, and the molecular-level identification includes GUS staining identification and PCR molecular detection.

[0029] The GUS staining identification involved reacting resistant callus tissue at 37°C for 12 hours, followed by decolorization with alcohol and observation of blue spots.

[0030] As a further description of the above technical solution:

[0031] The PCR molecular detection used HPT gene-specific primers, and the primer sequences are as follows:

[0032] HPT-F:GGTCGCCGGAGGCTATGGATGC;

[0033] HPT-R:GCTTCTGCGGGCGATTTGTGT;

[0034] The amplified product is 598 bp in length.

[0035] As a further description of the above technical solution:

[0036] The callus induction rate was no less than 80%, the resistant bud regeneration rate was no less than 12%, and a specific amplified band could be observed at 598 bp by PCR detection, proving that the exogenous gene had been successfully integrated.

[0037] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0038] This invention, through an optimized scheme, improves the transformation and regeneration efficiency of purslane, achieving a callus induction rate of 86.4%, a resistant bud regeneration rate of 12.5%, and a GUS positivity rate of 10.5%. The 4-5 day pre-culture stage effectively alleviates the browning and oxidative damage easily occurring in purslane tissue. Combined with 200... and 100 Acetylsyringone (AS) precisely activated the transformation activity of Agrobacterium. Using a hygromycin gradient screening strategy ranging from 1.5 mg / L to 2.0 mg / L, the purity of regenerated plants was improved while reducing the risk of chimerism. A clear band was observed at 598 bp through PCR molecular identification, confirming the successful and stable integration of the exogenous gene in samples 18#, 31#, and 32#, thus solving the problem of poor reproducibility in the genetic transformation of purslane. Attached Figure Description

[0039] Figure 1 This is a flowchart of a method for establishing a purslane genetic transformation and regeneration system proposed in this invention;

[0040] Figure 2 The image shows the GUS staining results of a method for establishing a purslane genetic transformation and regeneration system proposed in this invention.

[0041] Figure 3 The image shows the results of HPT detection for the hygromycin resistance gene in a method for establishing a genetic transformation and regeneration system for purslane proposed in this invention. Detailed Implementation

[0042] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0043] Please see Figure 1 The present invention provides a technical solution: a method for establishing a genetic transformation and regeneration system of purslane, comprising sterilizing purslane seeds, inoculating them on MS solid medium for seedling culture, and obtaining transformation recipient materials;

[0044] Cotyledons of seedlings were cut off as explants and inoculated into a pre-culture medium for pre-culture.

[0045] A fungicide-containing Agrobacterium infection solution was prepared and activated by adding acetylsuccinone (AS);

[0046] The pre-cultured explants were immersed in Agrobacterium infection solution for infection, and then transferred to co-culture medium for co-culture.

[0047] The explants after co-culture were washed and sterilized, and then screened and cultured with gradient concentrations of hygromycin until regenerated plants were obtained.

[0048] Molecular-level identification of regenerated plants.

[0049] The specific parameters for seedling cultivation are: 25°C, 16h light / 8h dark conditions for 7-10 days;

[0050] The sterilization process includes: disinfecting with 75% alcohol for 30 seconds, then soaking in 84 disinfectant for 15 minutes, and rinsing with sterile water 3-5 times.

[0051] The specific steps for pre-culture are as follows: cut the cotyledon explant in half to increase the wound area, inoculate it with the upper surface facing up on the pre-culture medium, and culture it in the dark at 25°C for 4-5 days.

[0052] The preparation of Agrobacterium infection solution includes: culturing Agrobacterium at 28°C and 220 rpm until the OD600 reaches 0.6, centrifuging at 5000g for 10 minutes, resuspending the bacterial cells in a resuspension solution containing 200 μM / LAS, and adjusting the OD600 to 0.6-0.8.

[0053] The parameters for infection and co-culture were as follows: infection time was 20 minutes, with gentle shaking during the process;

[0054] The co-culture medium contained 100 μM / LAS and was incubated in the dark at 25°C for 3 days.

[0055] The screening culture with gradient concentrations of hygromycin included: the first stage of screening was carried out for 2 weeks using a medium containing 1.5 mg / L hygromycin;

[0056] In the second stage, the samples were transferred to differentiation medium containing 2.0 mg / L hygromycin for enhanced screening.

[0057] During the screening and culture process, 200 mg / L termethin was used for sterilization treatment.

[0058] The crop was tomato, and molecular-level identification included GUS staining and PCR molecular detection.

[0059] GUS staining identification: Resistant callus tissue was reacted at 37°C for 12 hours, and the blue spots were observed after decolorization with alcohol.

[0060] PCR molecular detection uses HPT gene-specific primers, the primer sequences of which are as follows:

[0061] HPT-F:GGTCGCCGGAGGCTATGGATGC;

[0062] HPT-R:GCTTCTGCGGGCGATTTGTGT;

[0063] The amplified product is 598 bp in length.

[0064] The callus induction rate was no less than 80%, the resistant bud regeneration rate was no less than 12%, and a specific amplified band could be observed at 598 bp by PCR detection, proving that the exogenous gene had been successfully integrated.

[0065] (1) Reagents:

[0066] Recipient materials: purslane seeds, MS basal medium, sucrose, agar powder;

[0067] Plant hormones: 6-benzylaminopurine (6-BA), 1-naphthaleneacetic acid (NAA);

[0068] Screening and sterilization reagents: Hygromycin, Termethin, 84 disinfectant, 75% alcohol;

[0069] Inducing agents and detection: acetylsyringone (AS), DMSO, GUS staining kit, DNA extraction kit, PCR primers (HPT-F / R, GUS-F / R).

[0070] (2) Equipment: Clean bench, autoclave, constant temperature incubator (with light control), constant temperature shaking incubator, high-speed refrigerated centrifuge, PCR amplifier, gel imaging system, microscope.

[0071] (3) Experimental steps:

[0072] Before using the clean bench, wipe the surface with 75% alcohol and irradiate with ultraviolet light for 30 minutes. Set the autoclave to 121°C and sterilize the culture medium and sterile water for 20 minutes.

[0073] MS basal medium: Prepared using MS premixed powder at a concentration of 4.43 g / L, with 30 g / L sucrose added, pH adjusted to 5.8, and 7-8 g / L agar powder added. Autoclave at 121°C for 20 min.

[0074] Hormone stock solution (6-BA, NAA): Dissolve in a small amount of 1 M KOH and then bring to a final volume with sterile water.

[0075] AS stock solution (100mM): Dissolve AS powder in DMSO, filter sterilize using a 0.22μm filter, and store at -20℃ protected from light.

[0076] Antibiotic stock solution: Dissolved in sterile water and filtered for sterilization.

[0077] Seed disinfection and cultivation:

[0078] Place purslane seeds in a 10mL centrifuge tube, add 75% alcohol for 30 seconds to disinfect, then add 84 disinfectant and soak for 15 minutes, shaking continuously to ensure thorough contact. Rinse the seeds 3-5 times with sterile water in a laminar flow hood, then pipette to remove all liquid. Use sterile long forceps to evenly inoculate the seeds onto MS solid medium (containing 30g / L sucrose, 7.5g / L agar, pH 5.8). Place the inoculated medium in a constant temperature incubator at 25°C with a photoperiod of 16h light / 8h dark for 7-10 days to obtain seedlings for callus induction.

[0079] Explant harvesting and pre-culture:

[0080] Select cotyledons from healthy seedlings with flat leaves. Cut the cotyledons of purslane in half in a large petri dish lined with sterile filter paper to increase the wound area. Inoculate the cotyledons face up in pre-medium (MS + 2 mg / L 6-BA + 0.1 mg / L NAA) and incubate in the dark at 25°C for 4-5 days to allow the cells at the wound to enter an active division state.

[0081] Preparation of Agrobacterium infection solution:

[0082] Select a single colony of Agrobacterium containing the target vector and inoculate it into 5 mL of LB liquid medium (containing the corresponding antibiotic). After incubating at 28°C and 220 rpm for 18 hours with shaking, transfer it to 50 mL of LB liquid medium at a ratio of 1:100 and continue culturing until the OD600 reaches 0.6. Centrifuge at 5000g for 10 minutes using a refrigerated centrifuge, discard the supernatant, and resuspend the bacterial cells in infection solution (MS + 30 g / L sucrose + 200 μM / LAS). Use a UV spectrophotometer to precisely measure and adjust the OD600 to between 0.6 and 0.8.

[0083] Example 1: Pre-culture + AS induction + gradient screening;

[0084] Cotyledonous explants were cultured on pre-med medium (MS + 2 mg / L 6-BA + 0.1 mg / L NAA) at 25°C for 5 days, then immersed in a resuspension containing 200 μM / LAS for 20 min with gentle shaking during the process. After the bacterial suspension was aspirated, the explants were transferred to co-medium (containing 100 μM / LAS) and cultured in the dark at 25°C for 3 days. After washing with 200 mg / L termethin, the explants were first inoculated into 1.5 mg / L hygromycin medium for selection for 2 weeks, and then transferred to 2.0 mg / L hygromycin differentiation medium for enhanced selection.

[0085] Example 2: Pre-culture + gradient screening;

[0086] Cotyledonary explants were cultured on pre-med medium (MS + 2 mg / L 6-BA + 0.1 mg / L NAA) at 25°C for 5 days, then transferred to co-medium (without AS) and cultured in the dark at 25°C for 3 days. After washing with 200 mg / L termethin, they were first inoculated into 1.5 mg / L hygromycin medium for selection for 2 weeks, and then transferred to 2.0 mg / L hygromycin differentiation medium for enhanced selection.

[0087] Example 3: AS-induced + direct high-pressure screening group;

[0088] Cotyledonary explants were directly transferred to co-culture medium (containing 100 μM / LAS), cultured in the dark at 25°C for 3 days, and then directly inoculated into high-pressure differentiation medium containing 2.0 mg / L hygromycin for screening.

[0089] Molecular level identification:

[0090] GUS staining identification: resistant callus tissue was immersed in GUS staining solution and placed in a 37°C constant temperature incubator for 12 hours. 75% alcohol was used to decolorize until the control group was colorless. The experimental group was observed to see if blue spots appeared.

[0091] PCR molecular detection: Genomic DNA was extracted from the leaves of resistant seedlings using the CTAB method. HPT gene-specific primers HPT-F: GGTCGCGGAGGCTATGGATGC and HPT gene-specific primers HPT-R: GCTTCTGCGGGCGATTTGTGT (598bp) were used. The process involved 35 cycles of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 45 s, and a final extension at 72°C for 10 min. The results were then analyzed by 1% agarose gel electrophoresis to observe whether a specific amplified band appeared at 598bp.

[0092] (4) Experimental results and analysis:

[0093] detection indicators Example 1 Example 2 Example 3 Callus induction rate 86.4% 81.5% 31.2% resistant bud regeneration rate 12.5% 2.2% 0.6% GUS staining positivity rate 10.5% 1.4% 0.3% PCR test results #18, #31, and #32 tested strongly positive. No obvious specific bands No strip

[0094] The conversion rate of Example 1 was significantly higher than that of Example 2 (10.5% vs 1.4%), demonstrating that AS can effectively activate the expression of the Agrobacterium Vir gene, which is the core factor for the successful transformation of purslane.

[0095] Example 3, due to the lack of pre-culture buffer and the direct application of high concentrations of antibiotics, caused a severe stress response in the explants, resulting in a significant decrease in callus induction rate and most of them dying from browning. Example 1, through 4-5 days of pre-culture and gradient screening, successfully alleviated oxidative damage.

[0096] In Example 1, samples 18#, 31#, and 32# all showed clear bands at 598bp in the PCR electrophoresis image, proving that the exogenous gene had been successfully integrated. This indicates that the purslane genetic transformation and regeneration system established in this invention has a high transformation rate and good reproducibility, and solves the problem of easy browning of purslane tissue.

[0097] In this invention, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance; the term "multiple" refers to two or more unless otherwise explicitly defined. The terms "installation," "connection," "linking," and "fixing," etc., should be interpreted broadly. For example, "connection" can be a fixed connection, a detachable connection, or an integral connection; "linking" can be a direct connection or an indirect connection through an intermediate medium. Those skilled in the art can understand the specific meaning of the above terms in this invention according to the specific circumstances.

[0098] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A method for establishing a purslane genetic transformation and regeneration system, characterized in that, include: Purslane seeds were sterilized and inoculated onto MS solid medium for seedling culture to obtain transformation recipient materials; The cotyledons of the seedlings were cut off as explants and inoculated into a pre-culture medium for pre-culture. A fungicide-containing Agrobacterium infection solution was prepared and activated by adding acetylsuccinone (AS); The pre-cultured explants were immersed in Agrobacterium infection solution for infection, and then transferred to co-culture medium for co-culture. The explants after co-culture were washed and sterilized, and then screened and cultured with gradient concentrations of hygromycin until regenerated plants were obtained. Molecular-level identification was performed on the regenerated plants.

2. The method for establishing a purslane genetic transformation and regeneration system according to claim 1, characterized in that, The specific parameters for seedling culture are: cultured for 7-10 days at 25°C under a 16-hour light / 8-hour dark condition; The aseptic treatment includes: disinfecting with 75% alcohol for 30 seconds, then soaking in 84 disinfectant for 15 minutes, and rinsing with sterile water 3-5 times.

3. The method for establishing a purslane genetic transformation and regeneration system according to claim 1, characterized in that, The specific steps of the pre-culture are as follows: cut the cotyledon explant in half to increase the wound area, inoculate it with the upper surface facing up into the pre-culture medium, and culture it in the dark at 25°C for 4-5 days.

4. The method for establishing a purslane genetic transformation and regeneration system according to claim 1, characterized in that, The preparation of the Agrobacterium infection solution includes: culturing Agrobacterium at 28°C and 220 rpm until the OD600 reaches 0.6, centrifuging at 5000g for 10 minutes, resuspending the bacterial cells in a resuspension solution containing 200 μM / LAS, and adjusting the OD600 to 0.6-0.

8.

5. The method for establishing a purslane genetic transformation and regeneration system according to claim 1, characterized in that, The parameters for infection and co-culture are as follows: infection time is 20 minutes, with gentle shaking during the process; The co-culture medium contained 100 μM / LAS and was incubated in the dark at 25°C for 3 days.

6. The method for establishing a purslane genetic transformation and regeneration system according to claim 1, characterized in that, The gradient concentration hygromycin screening culture includes: the first stage using a medium containing 1.5 mg / L hygromycin for 2 weeks; In the second stage, the samples were transferred to differentiation medium containing 2.0 mg / L hygromycin for enhanced screening.

7. The method for establishing a purslane genetic transformation and regeneration system according to claim 1, characterized in that, During the screening and culture process, 200 mg / L termethin was used for sterilization.

8. The method for establishing a purslane genetic transformation and regeneration system according to claim 1, characterized in that, The crop is tomato, and the molecular-level identification includes GUS staining identification and PCR molecular detection. The GUS staining identification involved reacting resistant callus tissue at 37°C for 12 hours, followed by decolorization with alcohol and observation of blue spots.

9. The method for establishing a purslane genetic transformation and regeneration system according to claim 1, characterized in that, The PCR molecular detection used HPT gene-specific primers, and the primer sequences are as follows: HPT-F:GGTCGCCGGAGGCTATGGATGC; HPT-R:GCTTCTGCGGGCGATTTGTGT; The amplified product is 598 bp in length.

10. A purslane genetic transformation and regeneration system according to claims 1-9, characterized in that, The callus induction rate was no less than 80%, the resistant bud regeneration rate was no less than 12%, and a specific amplified band could be observed at 598 bp by PCR detection, proving that the exogenous gene had been successfully integrated.

Images