LoMC9 gene and its application in delaying anther dehiscence in lilies
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-09
- Publication Date
- 2026-08-14
AI Technical Summary
Metacaspase作为植物中调控PCD的关键酶之一,在细胞PCD进程中发挥重要作用,但其在花药发育特别是花药开裂中的功能尚未见报道
[0056]本发明针对百合花粉污染严重、花药开裂机制不明的问题,挖掘了一种能够调控花药开裂的关键metacaspase基因LoMC9。通过沉默该基因可显著延迟花药开裂,为培育花药开裂延迟、花粉释放减少的百合新品种提供了基因资源。本发明为通过基因调控技术解决百合花粉污染问题提供了重要理论依据和优异基因储备,具有重要的产业应用价值。
Smart Images

Figure CN122564020A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a LoMC9 gene and its application in delaying anther dehiscence in lilies. Background Technology
[0002] Lilies (Lilium spp.) are perennial bulbous flowers belonging to the genus Lilium in the family Liliaceae. They are one of the world's five major cut flowers, beloved by consumers for their unique shape and auspicious symbolism. However, lilies produce a large amount of pollen, have large anthers, and the pollen is highly adhesive. When the anthers dehisce, a large amount of pollen easily falls onto the petals, causing petal contamination and reducing the flower's ornamental value. The problem of 'pollen contamination' has affected the development of the lily industry and people's lives, and urgently needs to be addressed. Therefore, in-depth research into the molecular regulatory mechanisms of lily anther dehiscence will not only contribute to the molecular breeding of pollen-free or dehiscence-free lilies, but also provide a theoretical basis for understanding this important biological process of anther development and dehiscence.
[0003] Previous studies have shown that abnormal programmed cell death (PCD) is a significant cause of male sterility in plants. Metacaspase, as one of the key enzymes regulating PCD in plants, plays an important role in the PCD process, but its function in anther development, especially anther dehiscence, has not been reported. Therefore, identifying and characterizing key metacaspase genes that regulate anther dehiscence in lilies is of significant scientific and practical value for solving the problem of lily pollen pollution. Summary of the Invention
[0004] The purpose of this invention is to provide a LoMC9 gene and its application in delaying anther dehiscence in lilies.
[0005] The objective of this invention can be achieved through the following technical solutions:
[0006] In a first aspect, the present invention seeks protection for at least one use of the LoMC9 gene in the following a1) and a2):
[0007] a1) Application in delaying anther dehiscence or reducing pollen release in lilies;
[0008] a2) Application in the cultivation of new lily germplasm free from pollen contamination or delayed anther dehiscence.
[0009] Secondly, the present invention seeks protection for the use of the protein encoded by the LoMC9 gene in at least one of the following a1) and a2):
[0010] a1) Application in delaying anther dehiscence or reducing pollen release in lilies;
[0011] a2) Application in the cultivation of new lily germplasm free from pollen contamination or delayed anther dehiscence.
[0012] Thirdly, the present invention seeks protection for the use of biological materials that inhibit LoMC9 gene expression in at least one of the following a1) and a2):
[0013] a1) Application in delaying anther dehiscence or reducing pollen release in lilies;
[0014] a2) Application in the cultivation of new lily germplasm free from pollen contamination or with delayed anther dehiscence;
[0015] The biomaterial is at least one of the following: d1) - d10):
[0016] d1) DNA molecules used to suppress LoMC9 gene expression;
[0017] d2) An expression cassette containing the DNA molecule described in d1);
[0018] d3) A recombinant vector containing the DNA molecule described in d1) or the expression cassette described in d2);
[0019] d4) Recombinant microorganisms containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3);
[0020] d5) A transgenic plant cell line containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3);
[0021] d6) Transgenic plant tissue containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3);
[0022] d7) A transgenic plant organ containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3);
[0023] d8) A transgenic plant containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3);
[0024] d9) Regenerative cells, tissue cultures, or protoplasts produced from cells or tissue cultures of the transgenic plants described in d8);
[0025] d10) Propagation material of the transgenic plants as described in d8).
[0026] Furthermore, the above application is as follows: by inhibiting the expression of the LoMC9 gene in lilies or reducing the activity and / or content of the protein encoded by the LoMC9 gene in lilies, the anther dehiscence is delayed or pollen release is reduced, thereby cultivating new lily germplasm free from pollen contamination or with delayed anther dehiscence.
[0027] Fourthly, the present invention claims protection for a method for delaying anther dehiscence or reducing pollen release in lilies, by inhibiting the expression of the LoMC9 gene in lilies or reducing the activity and / or content of the protein encoded by the LoMC9 gene in lilies, thereby delaying anther dehiscence or reducing pollen release.
[0028] Fifthly, the present invention claims protection for a method for cultivating new lily germplasm free from pollen contamination or delayed anther dehiscence, by inhibiting the expression of the LoMC9 gene in lilies or reducing the activity and / or content of the protein encoded by the LoMC9 gene in lilies, thereby cultivating new lily germplasm free from pollen contamination or delayed anther dehiscence.
[0029] Sixthly, the present invention seeks protection for a LoMC9 gene.
[0030] In a seventh aspect, the present invention seeks protection for the protein encoded by the aforementioned LoMC9 gene.
[0031] Eighthly, the present invention claims protection for biological materials used to suppress the aforementioned LoMC9 gene expression, said biological material being at least one of the following d1)-d5):
[0032] d1) DNA molecules used to suppress LoMC9 gene expression;
[0033] d2) An expression cassette containing the DNA molecule described in d1);
[0034] d3) A recombinant vector containing the DNA molecule described in d1) or the expression cassette described in d2);
[0035] d4) Recombinant microorganisms containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3);
[0036] d5) A transgenic plant cell line containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3).
[0037] In this invention, the application is achieved by means of inhibiting LoMC9 gene expression. These means include VIGS virus-induced gene silencing, RNA interference, gene editing, or antisense RNA. In a specific embodiment of this invention, VIGS virus-induced gene silencing technology is preferred. The LoMC9 gene silencing fragment is cloned into the pTRV2 vector and infected into lily plants via Agrobacterium-mediated infection. Based on this technology, the DNA molecule used to inhibit LoMC9 gene expression is the LoMC9 gene silencing fragment.
[0038] In the technical solution of this invention, the LoMC9 gene is a DNA molecule as shown in b1) or b2) below:
[0039] b1) A DNA molecule having the nucleotide sequence shown in SEQ ID NO:1;
[0040] b2) A DNA molecule that has more than 70% homology with the DNA molecule described in b1) and encodes a protein with the same function; preferably, a DNA molecule that has more than 80% homology with the DNA molecule described in b1) and encodes a protein with the same function; more preferably, a DNA molecule that has more than 90% homology with the DNA molecule described in b1) and encodes a protein with the same function.
[0041] In the technical solution of this invention, the protein encoded by the LoMC9 gene is the protein shown in c1), c2), c3), or c4) as follows:
[0042] c1) A protein having the amino acid sequence shown in SEQ ID NO:2;
[0043] c2) A fusion protein with the same function obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein described in c1);
[0044] c3) Proteins related to anther dehiscence or anther development obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID NO:2.
[0045] c4) is a protein that shares more than 80% identity with the protein shown in c1), c2), or c3) and is associated with anther dehiscence or anther development.
[0046] In the technical solution of this invention, the primer pair used to amplify the LoMC9 gene includes upstream primer F and downstream primer R:
[0047] Upstream primer F: ATGGAGGGAAAGAAGAGGTT (SEQ ID NO:3);
[0048] Downstream primer R: TTATGTGAGCTTCTCATGCTTA (SEQ ID NO:4).
[0049] In a specific embodiment of the present invention, the process of studying the LoMC9 gene and its application in delaying anther dehiscence in lilies is as follows: (1) Cloning and sequence analysis of the LoMC9 gene; (2) Expression pattern analysis of the LoMC9 gene; (3) Subcellular localization analysis of LoMC9; (4) LoMC9 protease activity analysis; (5) Effect of VIGS silencing of LoMC9 on anther dehiscence.
[0050] The cloning and sequence analysis of the LoMC9 gene in step (1) is as follows: RNA is extracted from lily anthers, reverse transcribed into cDNA, and the open reading frame (ORF) of LoMC9 is cloned using high-fidelity PCR amplification technology with cDNA as a template. Conserved domain analysis is performed on the correctly cloned sequence. Multiple amino acid sequence alignment: After translating the cloned LoMC9 sequence into an amino acid sequence, it is compared with the NCBI database to obtain amino acid sequences of homologous genes from different species. The software MEGA-X and GeneDoc are used to compare and analyze the LoMC9 amino acid sequence with homologous protein sequences from other species. Phylogenetic tree construction: A neighbor-joint phylogenetic tree is constructed using MEGA-X software.
[0051] The process of analyzing the expression pattern of the LoMC9 gene in step (2) is as follows: Select 'Siberian' lilies with the same seedling age and growth status, and collect root, stem, leaf, anther, filament, petal, style, stigma, ovary and bulb tissues, as well as anther split area tissues at different developmental stages (S5-S9). Extract RNA and reverse transcribe it into cDNA and then perform RT-qPCR experiment on LoMC9. Select lily 18S rRNA as internal reference gene.
[0052] The subcellular localization analysis of LoMC9 in step (3) is as follows: the LoMC9 open reading frame with the terminator removed is cloned into the pCAMBIA1300-GFP vector and transformed into Agrobacterium competent cells GV3101. Then, Agrobacterium solution containing pCAMBIA1300-GFP and pCAMBIA1300-LoMC9-GFP is mixed with bacterial solution containing nuclear localization signal RFP-NLS and membrane localization signal RFP-Mem, respectively, and injected into Tobacco Benzoenta leaf. After 48 hours, the expression of GFP signal is observed using a laser confocal microscope to determine the subcellular localization of LoMC9 protein.
[0053] The LoMC9 protease activity analysis in step (4) is as follows: The LoMC9 coding sequence is cloned into the pET-32a vector, transformed into E. coli BL21, induced expression, and purified the His-LoMC9 fusion protein. The enzyme activity of LoMC9 is detected using the fluorescent substrate Z-Val-Val-Arg-AMC, with inactivated protein as a negative control and water as a blank control.
[0054] The process of VIGS silencing LoMC9 on anther dehiscence in step (5) is as follows: A partial coding sequence (silenced fragment) of the LoMC9 gene is cloned into the pTRV2 vector, transformed into Agrobacterium GV3101, and 'Siberian' lily plants are infected with a mixed bacterial solution of pTRV1 and pTRV2-LoMC9, with the pTRV1+pTRV2 empty vector as a control. Subsequently, the anther dehiscence phenotype is recorded, the time required for complete anther dehiscence is calculated, and the cell rupture in the anther dehiscence area is observed using paraffin sectioning.
[0055] The beneficial effects of this invention are:
[0056] This invention addresses the problems of severe pollen contamination and unclear anther dehiscence mechanisms in lilies by identifying a key metacaspase gene, LoMC9, capable of regulating anther dehiscence. Silencing this gene significantly delays anther dehiscence, providing a genetic resource for breeding new lily varieties with delayed anther dehiscence and reduced pollen release. This invention provides important theoretical basis and excellent gene reserves for solving lily pollen contamination problems through gene regulation technology, and has significant industrial application value. Attached Figure Description
[0057] Figure 1 For phylogenetic analysis and protein domain analysis of LoMC9;
[0058] A: Comparison of the amino acid sequences of LoMC9 protein with metacaspase proteins from other species, showing the p20 and p10 subunits and linker junctions; B: Phylogenetic tree of LoMC9 with metacaspase proteins from other species, with LoMC9 marked by red dots; Zea mays: maize; Oryza sativa: rice; Arabidopsis thaliana: Arabidopsis thaliana; Magnolia sinica: Magnolia sinica; Populus trichocarpa: Populus trichocarpa; Musa acuminata: Musa acuminata; Phoenix dactylifera: date palm; Elaeis guineensis: oil palm; Dioscorea cayenensis: Dioscorea cayenensis; Lilium spp: lily; Iris pallida: Iris pallida; Asparagus officinalis: Asparagus officinalis.
[0059] Figure 2 To analyze the expression of LoMC9 in different tissues and anther clefts of lilies at different developmental stages;
[0060] A: The expression level of LoMC9 in different tissues such as roots, stems, leaves, anthers, filaments, stigmas, styles, ovaries, petals, and bulbs; B: The expression level of LoMC9 in the S5-S9 stage of the anther split region, where S5-S9 indicates a bud length of 5-9 cm.
[0061] Figure 3 Subcellular localization analysis of LoMC9;
[0062] In this study, the pCAMBIA1300-GFP vector served as a blank control, RFP-NLS represented the red fluorescent marker in the cell nucleus, and RFP-Mem represented the red fluorescent marker in the cell membrane (scale bar = 50 μm).
[0063] Figure 4 For the analysis of LoMC9 protease activity;
[0064] In this context, LoMC9* represents the inactivated protein and serves as a negative control, while H2O serves as a blank control.
[0065] Figure 5 The effect of VIGS silencing LoMC9 on anther dehiscence in lilies;
[0066] Among them, A: delayed anther dehiscence phenotype after silencing LoMC9, scale bar = 3cm; B: silencing efficiency detection; C: statistics of anther complete dehiscence time; D: paraffin section observation of anther dehiscence area in SS7 and SS8 stages, SS7 and SS8 indicate that the length of the flower bud of the silent positive seedling is 7cm and 8cm respectively, scale bar = 100μm. Detailed Implementation
[0067] The present invention will be further described in detail below with reference to specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained commercially unless otherwise specified.
[0068] Example 1: Cloning and Sequence Analysis of the LoMC9 Gene
[0069] RNA Extraction and Gene Cloning: First, total RNA was extracted from lily anthers using a plant RNA extraction kit (AG21019, Hunan Aikerui Biotechnology Co., Ltd.). Then, an appropriate amount of total RNA was reverse transcribed into cDNA using an Evo M-mLV reverse transcription premix kit (AG11724, Hunan Aikerui Biotechnology Co., Ltd.). High-fidelity PCR amplification was then used to clone the open reading frame (ORF) of LoMC9 found in the lily genome using the cDNA as a template (primer sequences F: ATGGAGGGAAAGAAGAGGTT; R: TTATGTGAGCTTCTCATGCTTA). Conserved domain analysis was then performed on the correctly cloned sequence. Multiple Alignment of Amino Acid Sequences: The cloned LoMC9 sequence was aligned with the NCBI database (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to obtain MC9 amino acid sequences from different species. The software MEGA-X and GeneDoc were used to align the LoMC9 sequence with homologous protein sequences from other species. Phylogenetic tree construction: The eight protein sequences with the highest amino acid homology to LoMC9 were obtained from the NCBI website. Meanwhile, members of the metacaspase family of maize, rice and Arabidopsis were obtained from the MaizeGDB (https: / / www.maizegdb.org / ), Gramene (https: / / oryza.gramene.org / ) and TAIR (https: / / www.arabidopsis.org / ) websites. Neighbor-joint phylogenetic trees were constructed using MEGA-X software.
[0070] Example 2: Analysis of LoMC9 Expression Patterns
[0071] 2.1 Tissue-specific expression analysis
[0072] Three Oriental lily 'Siberia' plants with consistent growth stages were selected, and root, stem, leaf, anther, filament, petal, style, stigma, ovary, and bulb tissues were collected from each. Total RNA was extracted from each tissue according to the method described in Example 1, reverse transcribed into cDNA, and then used for LoMC9 RT-qPCR experiments. Lily 18S rRNA was used as an internal reference gene (primer sequences are shown in Table 1), and real-time quantitative PCR was performed using the SYBR Green Pro Taq HS premixed qPCR kit (AG11735, Hunan Aikerui Biotechnology Co., Ltd.). Three technical replicates were set for each sample, and three biological replicates were set for each tissue. The results were analyzed using SPSS v.17.0 software, and graphs were generated using GraphPad Prism 8.0.1.
[0073] Table 1 Primers for Real-Time Quantitative PCR
[0074] Primer Primer sequence (5′-3′) LoMC9-F TCCTGCCACAGCGGCGGT (SEQ ID NO:5) LoMC9-R CTGGCGCTGGCCTCCTCG (SEQ ID NO:6) 18S rRNA-F AGTTGGTGGAGCGATTTGTCT (SEQ ID NO:7) 18S rRNA-R CCTGTTATTGCCTCAAACTTCC (SEQ ID NO:8)
[0075] 2.2 Expression analysis of anther development stages
[0076] Three plants of *Lilium 'Siberia'* with flower buds measuring 5, 6, 7, 8, and 9 cm in length and exhibiting uniform growth were collected from each plant. Anther split tissue was extracted. RNA was extracted and reverse transcribed into cDNA according to the method described in Example 1. The relative expression level of LoMC9 in the anther split region at different developmental stages was detected using the RT-qPCR method described in 2.1 of Example 2. Three technical replicates were performed for each sample, and three biological replicates were performed for each tissue.
[0077] Example 3: Subcellular localization analysis of LoMC9
[0078] 3.1 Construction of Fusion Expression Vector
[0079] Primers containing homologous sequences and restriction enzyme sites were designed, and PCR amplification was performed using the LoMC9 ORF as a template. The upstream primer introduced the Sal I restriction enzyme site, and the downstream primer introduced the Kpn I restriction enzyme site (primer sequences are shown in Table 2).
[0080] The pCAMBIA1300-GFP vector was double-digested with restriction endonucleases Sal I and Kpn I. The PCR product of LoMC9 was inserted into the digested pCAMBIA1300-GFP vector using homologous recombination, and ligation was performed at 50°C for 1 h. The ligation product was transformed into *E. coli* DH5α, plated on LB agar containing kanamycin (Kan), and positive clones were picked for sequencing verification. The correctly sequenced recombinant plasmid was extracted and named GFP-LoMC9-pCAMBIA1300.
[0081] 3.2 Agrobacterium-mediated transient transformation of tobacco leaves
[0082] The empty vector GFP-pCAMBIA1300 (negative control) and the recombinant plasmid GFP-LoMC9-pCAMBIA1300 were transformed into Agrobacterium competent cells GV3101, respectively. Positive single colonies were picked and inoculated into LB liquid medium containing 50 mg / L kanamycin (Kan) and 25 mg / L rifampin (Rif), and cultured at 30°C with shaking at 200 rpm for 12 h. The cultures were collected by centrifugation at 5000 rpm for 5 min, and resuspended in Agrobacterium resuspension buffer (10 mM MgCl2, 10 mM MES, 100 μM acetylsyl syringone, pH 5.6). OD was adjusted. 600 =0.6.
[0083] The resuspended GFP-pCAMBIA1300 and GFP-LoMC9-pCAMBIA1300 bacterial suspensions were mixed with nuclear localization marker suspension (RFP-NLS) and membrane localization marker suspension (RFP-Mem) at a volume ratio of 3:1, and incubated in the dark at room temperature (25±5℃) for 2-3 h. The mixed bacterial suspensions were injected into the lower epidermis of tobacco leaves. After injection, the plants were cultured in the dark for 1 day, followed by cultured in light for 1 day. Fluorescence signals were observed and recorded using a laser confocal microscope (LSM800, Zeiss).
[0084] Example 4: Detection of LoMC9 protease activity
[0085] 4.1 Construction of prokaryotic expression vectors
[0086] The LoMC9 coding sequence was cloned into the pET-32a vector (with BamHI and SacI restriction sites) using homologous recombination to obtain the recombinant plasmid His-LoMC9 with the His tag (primer sequences are shown in Table 2).
[0087] 4.2 Induced expression of fusion protein
[0088] The recombinant plasmid His-LoMC9 was transformed into *E. coli* BL21 competent cells. Positive monoclonal plaques were picked and inoculated into 10 mL of LB broth (containing 50 μg / mL Amp) and cultured overnight at 37°C with shaking. 1 mL of the overnight culture was transferred to 100 mL of LB broth (containing 50 μg / mL Amp) and cultured at 37°C with shaking at 200 rpm until OD (open-cell growth) was reached. 600 =0.5-0.8. Add IPTG to a final concentration of 0.2 mM, and induce expression at 16℃ and 160 rpm for 16-20 h.
[0089] 4.3 Protein purification
[0090] After induction, the bacterial culture was centrifuged at 8000 rpm for 5 min at 4°C to collect the cells, and resuspended in 10 mL of PBS buffer. The cells were then sonicated on ice for 15 min (30% power, 3 sec sonication, 5 sec pause), with 1 mM PMSF added before and after sonication. The supernatant was collected after centrifugation at 12000 rpm for 20 min at 4°C. Affinity purification was performed using a nickel column (Ni-NTA), and the purified product was confirmed by SDS-PAGE electrophoresis, confirming successful expression of the His-LoMC9 fusion protein.
[0091] 4.4 Protease activity detection
[0092] The protease activity of LoMC9 was detected using a fluorescent substrate method. Z-Val-Val-Arg-AMC (Z-VVR-AMC) was used as the specific fluorescent substrate for LoMC9. The reaction buffer composition was: 50 mM HEPES (pH 4.6), 1 mM DTT, 10 mM CaCl2, and 50% glycerol. A negative control (LoMC9 protein inactivated by boiling in a water bath for 10 min) and a blank control (using an equal volume of water instead of protein) were set up. 60 ng of the target protein, reaction buffer, and 100 μM Z-VVR-AMC were added sequentially to a 96-well microplate, mixed well, and incubated at 30°C for 60 min. The fluorescence emission was detected using a Cytation 3 microplate reader at an excitation wavelength of 360 nm and an emission wavelength of 460 nm.
[0093] Example 5 Virus-Induced Gene Silencing (VIGS) Experiment
[0094] 5.1 Construction of VIGS Vector
[0095] A specific fragment of LoMC9 (approximately 300 bp in length) was cloned into the pTRV2 vector (with Xba I and BamHI restriction sites) using homologous recombination to obtain the recombinant plasmid pTRV2-LoMC9 (primer sequences are shown in Table 2).
[0096] Table 2 Primers used for plasmid construction
[0097] Primer Primer sequence (5′-3′) pCAMBIA1300-LoMC9-GFP-F AGAAAGCTTCTGCAGGGGCCCGGGGTCGACATGGAGGGAAAGAAGAGGTT (SEQ ID NO:9) pCAMBIA1300-LoMC9 GFP-R CAGCTCCTCGCCCTTGCTCACCATGGTACCTGTGAGCTTCTCATGCTTA (SEQ ID NO:10) His-LoMC9-F AAGGCCATGGCTGATATCGGATCCGAATTCATGGAATCCTGCCACAGCGGCGGT (SEQ ID NO:11) His-LoMC9-R TTATGTGAGCTTCTCATGCTTAATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTGAAGCT (SEQ ID NO:12) pTRV2-LoMC9-F ATTCTGTGAGTAAGGTTACCGAATTCTCTAGATCCTGCCACAGCGGCGGT (SEQ ID NO:13) pTRV2-LoMC9-R CCCGGGCCTCGAGACGCGTGAGCTCGGTACCCTGGCGCTGGCCTCCTCG (SEQ ID NO:14)
[0098] 5.2 Infection of lily plants with Agrobacterium-mediated infection solution
[0099] pTRV1, pTRV2 empty vectors, and pTRV2-LoMC9 were transformed into Agrobacterium competent cells GV3101, respectively. Positive single colonies were picked and inoculated into LB liquid medium containing 50 mg / L kanamycin (Kan) and 25 mg / L rifampin (Rif), and cultured at 30°C with shaking at 200 rpm for 12 h. The cultures were collected by centrifugation at 5000 rpm for 5 min, resuspended in infection buffer (10 mM MgCl2, 10 mM MES, 200 μM acetylsylphenone, pH 5.6), and OD was adjusted. 600=1.0. Agrobacterium bacterial suspensions carrying different plasmids were mixed in equal volumes according to the following combinations: (1) pTRV1 + pTRV2 (negative control); (2) pTRV1 + pTRV2-LoMC9. The mixed bacterial suspensions were left to stand in the dark at room temperature for 2-3 h. Oriental lily 'Siberia' plants with flower buds of 4-5 cm in length and uniform growth status were selected and completely immersed in the mixed bacterial suspension for infection. After 1 day of dark treatment, the plants were transferred to normal light conditions for further culture for 1 day, and then the bacterial suspension was discarded and replaced with water for routine care.
[0100] 5.3 Silent Efficiency Detection
[0101] Anther tissues were collected at the SS7 stage, and total RNA was extracted from the anthers and reverse transcribed into cDNA according to the method in Example 1. The silencing efficiency of LoMC9 was detected by RT-qPCR as described in Example 2.
[0102] 5.4 Statistics on anther dehiscence time
[0103] From the time the flower buds open, observe and record the anther dehiscence of each treatment group daily. Using complete anther dehiscence as the standard, calculate the time required for complete anther dehiscence. Count at least 10 flowers from each treatment group and calculate the mean and standard deviation.
[0104] 5.5 Observation of paraffin sections
[0105] Anther tissues were collected at SS7 and SS8 stages, respectively. The tissues were fixed in FAA fixative for 24 h, dehydrated using a gradient of ethanol (70%, 85%, 95%, and 100% ethanol), cleared with a paraffin clearing agent, and then embedded in paraffin. The paraffin blocks were cut into 8-10 μm thick sections using a rotary microtome. The sections were then mounted on poly-L-lysine-coated slides, dried overnight at 42°C, stained with toluidine blue, and the morphological changes in the anther cleft area were observed under an optical microscope.
[0106] Results Analysis
[0107] 1. Gene cloning and sequence analysis of LoMC9
[0108] To investigate the biological characteristics and functions of LoMC9, we cloned the LoMC9 gene from the anthers of the Oriental lily 'Siberia'. Its open reading frame (ORF) is 939 bp, encoding 312 amino acids. Amino acid sequence analysis showed that LoMC9 contains a conserved p20 catalytic subunit, a p10 small subunit, and an intermediate linker region, belonging to the type II metacaspase family. Phylogenetic analysis revealed that LoMC9 is most closely related to DcMC9 from Dioscorea cayenensis. Figure 1(A and B in the text).
[0109] 2. Analysis of LoMC9 Expression Patterns
[0110] To investigate the expression characteristics of LoMC9 in different tissues of lily, qRT-PCR was used to detect the relative expression levels of LoMC9 in roots, stems, leaves, anthers, filaments, petals, styles, stigmas, ovaries, and bulbs. The results showed that LoMC9 expression was highest in anthers, while expression was extremely low in other tissues, indicating that LoMC9 exhibits anther-specific expression characteristics. Figure 2 (A in the middle).
[0111] Further investigation was conducted to examine the expression pattern of LoMC9 in the anther dehiscence region at different developmental stages. qRT-PCR results showed that LoMC9 expression initially increased and then decreased with bud development: expression levels were low in stages S5-S6, increased significantly in stage S7, peaked in stage S8, and then decreased in stage S9. Stage S8 is a critical period for anther dehiscence, suggesting that LoMC9 may be involved in regulating the anther dehiscence process. Figure 2 (B in the middle).
[0112] 3. Subcellular localization analysis of LoMC9
[0113] To determine the intracellular localization characteristics of LoMC9, this study conducted a transient transformation subcellular localization experiment on tobacco leaves. The results showed that in tobacco epidermal cells transformed with the GFP-LoMC9 fusion expression vector, green fluorescence coincided with the nuclear localization marker RFP-NLS and the cell membrane localization marker RFP-Mem, and fluorescence signals were also observed in the cytoplasm, indicating that LoMC9 is a nuclear, cell membrane, and cytoplasmic localized protein. Figure 3 ).
[0114] 4. Analysis of protease activity of LoMC9
[0115] To determine whether LoMC9 possesses typical metacaspase activity, the fluorescent substrate Z-VVR-AMC was used for enzyme activity assay. The results showed that the fluorescence value of the LoMC9 protein-treated group was significantly higher than that of the inactivated protein group and the blank control group, indicating that LoMC9 can specifically cleave the VCR substrate and possesses typical metacaspase activity. Figure 4 ).
[0116] 5. Silencing LoMC9 delays anther dehiscence in lilies.
[0117] To clarify whether LoMC9 is involved in the regulation of anther dehiscence in lilies, LoMC9 was silenced using the VIGS system. qRT-PCR results showed that the expression level of LoMC9 in the anthers of silenced plants was significantly inhibited compared to the TRV control. The time to complete anther dehiscence after LoMC9 silence was statistically analyzed, revealing that the average time to complete anther dehiscence after LoMC9 silence was after 50 hours, while the control achieved complete dehiscence within 30 hours, indicating that LoMC9 silence significantly delayed anther dehiscence. Figure 5 (AC in the text). Paraffin section observation revealed that the cracked area of the empty control in the SS7 stage had already opened, while the cracked area of the silenced LoMC9 remained tightly closed, further indicating that silencing LoMC9 delayed the dehiscence of lily anthers (AC in the text). Figure 5 (D in the middle).
[0118] Based on the above experiments, LoMC9 is a highly effective anther dehiscence promoting gene. Therefore, this invention provides a theoretical basis and molecular foundation for improving lily varieties with delayed anther dehiscence and reduced pollen release. It can be used to improve the anther dehiscence characteristics of lilies and solve the problem of pollen pollution, and has important scientific significance and application prospects.
[0119] SEQ ID NO:1
[0120] ATGGAGGGAAAGAAGAGGTTGGCCACACTGGTAGGATGCAATTACCCCAACACAATAAACGAGCTGCATGGCTGCATCAACGACGTCAAGGCCATGCACAACCTCCTCATCTCCCGCTTCAGCTTCTGTTCCGACGATATCACCCTCCTCACTGACGCCCCTGGCTCGACAGAGCTCCCCACCGGCGCCAACATCATGCGAGCCCTCAGCCATATGGTCGCCCAAGCCGATCCTGGGGATGTCCTCTTCTTCCACTACAGCGGTCATGGAACACTCATCCCGGCGGTGAAACCACACCACGGCCGGTCCACTCGAGATGAGGCCATCGTCCCATGCGATTTCAATCTCATTACAGATGTTGACTTCCGGCAATTAGTCGACCGCCTGCCGGCAGGGGTGAGCTTCACAATAATCTCCGACTCCTGCCACAGCGGCGGTCTCATCGACAAAGAAAAGGAACAAATCGGACCTTCAGCCAACCCCCACTCGGCCTCTACCCATCGCAAGCGCACCATCCCTTTCTCCACCGTCCTCAACCATGTCAGCTCGCTCTCAAGCATTGACTCCCCGCACATCGGCGACCACCTCCTCTACCTCTTCGGCGAGGAGGCCAGCGCCAGGTTCTCAGACGGGCTCATATCTCCTCCGACAATTGGACAAGATGACGGGATCTTGCTGAGCGGGTGCCAGACGAATGAGACGTCGGCAGATATGAGCCCGAACGAGAGTGGGGGAACGGCATATGGTGCCTTTAGTAATGCGATACAGGTTGTGATGAAGGAGCATGTGGGGGCTCTTAGCAACAGAGAGCTGGTCGTACTTACGAGAGAGTTGTTGCATGAGAGAGGGTTTACGCAACACCCGTGCTTATACTGCAGTGACGATAATGCTGATATGGAGTTTCTGCTTCAGACGGTTAAGCATGAGAAGCTCACATAA
[0121] SEQ ID NO:2
[0122] MEGKKRLATLVGCNYPNTINELHGCINDVKAMHNLLISRFSFCSDDITLLTDAPGSTELPTGANIMRALSHMVAQADPGDVLFFHYSGHGTLIPAVKPHHGRSTRDEAIVPCDFNLITDVDFRQLVDRLPAGVSFTIISDSCHSGGLIDKEKEQIGPSANPHSASTHRKRTIPFSTVLNHVSSLSSIDSPHIGDHLLYLFGEEASARFSDGLISPPTIGQDDGILLSGCQTNETSADMSPNESGGTAYGAFSNAIQVVMKEHVGALSNRELVVLTRELLHERGFTQHPCLYCSDDNADMEFLLQTVKHEKLT。
Claims
1. The LoMC9 gene with the nucleotide sequence shown in SEQ ID NO:1 is used in at least one of the following a1) and a2): a1) Application in delaying anther dehiscence or reducing pollen release in lilies; a2) Application in the cultivation of new lily germplasm free from pollen contamination or delayed anther dehiscence.
2. The protein encoded by the LoMC9 gene, whose nucleotide sequence is shown in SEQ ID NO:1, is used in at least one of the following a1) and a2): a1) Application in delaying anther dehiscence or reducing pollen release in lilies; a2) Application in the cultivation of new lily germplasm free from pollen contamination or with delayed anther dehiscence; The protein encoded by the LoMC9 gene is the protein shown in c1) or c2) below: c1) A protein having the amino acid sequence shown in SEQ ID NO:2; c2) A fusion protein with the same function is obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein described in c1).
3. Application of biological materials that inhibit the expression of the LoMC9 gene with the nucleotide sequence shown in SEQ ID NO:1 in at least one of the following a1) and a2): a1) Application in delaying anther dehiscence or reducing pollen release in lilies; a2) Application in the cultivation of new lily germplasm free from pollen contamination or with delayed anther dehiscence; The biomaterial is at least one of the following: d1) - d10): d1) DNA molecules used to suppress LoMC9 gene expression; d2) An expression cassette containing the DNA molecule described in d1); d3) A recombinant vector containing the DNA molecule described in d1) or the expression cassette described in d2); d4) Recombinant microorganisms containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3); d5) A transgenic plant cell line containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3); d6) Transgenic plant tissue containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3); d7) A transgenic plant organ containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3); d8) A transgenic plant containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3); d9) Regenerative cells, tissue cultures, or protoplasts produced from cells or tissue cultures of the transgenic plants described in d8); d10) Propagation material of the transgenic plants as described in d8).
4. The application according to any one of claims 1-3, characterized in that, By inhibiting the expression of the LoMC9 gene in lilies or reducing the activity and / or content of the protein encoded by the LoMC9 gene in lilies, anther dehiscence can be delayed or pollen release can be reduced, thereby cultivating new lily germplasm free from pollen contamination or with delayed anther dehiscence.
5. A method for delaying anther dehiscence or reducing pollen release in lilies, characterized in that, By inhibiting the expression of the LoMC9 gene in lilies with nucleotide sequences as shown in SEQ ID NO:1 or reducing the activity and / or content of the protein encoded by the LoMC9 gene in lilies, anther dehiscence or pollen release can be delayed.
6. The method according to claim 5, characterized in that, The protein encoded by the LoMC9 gene is the protein shown in c1) or c2) below: c1) A protein having the amino acid sequence shown in SEQ ID NO:2; c2) A fusion protein with the same function is obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein described in c1).
7. A method for cultivating new lily germplasm free from pollen contamination or delayed anther dehiscence, characterized in that, By inhibiting the expression of the LoMC9 gene (as shown in SEQ ID NO:1) or reducing the activity and / or content of the protein encoded by the LoMC9 gene in lilies, new lily germplasm free from pollen contamination or delayed anther dehiscence can be cultivated.
8. The LoMC9 gene with a nucleotide sequence as shown in SEQ ID NO:
1.
9. The protein encoded by the LoMC9 gene according to claim 8, characterized in that, The protein encoded by the LoMC9 gene is the protein shown in c1) or c2) below: c1) A protein having the amino acid sequence shown in SEQ ID NO:2; c2) A fusion protein with the same function is obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein described in c1).
10. A biomaterial for inhibiting the expression of the LoMC9 gene as described in claim 8, characterized in that, The biomaterial is at least one of the following: d1) - d5): d1) DNA molecules used to suppress LoMC9 gene expression; d2) An expression cassette containing the DNA molecule described in d1); d3) A recombinant vector containing the DNA molecule described in d1) or the expression cassette described in d2); d4) Recombinant microorganisms containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3); d5) A transgenic plant cell line containing the DNA molecule described in d1), or the expression cassette described in d2), or the recombinant vector described in d3).