Application of the watermelon ClFCI gene in controlling the color depth of watermelon flesh
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-30
- Publication Date
- 2026-08-14
AI Technical Summary
但控制栽培西瓜瓤色深浅的关键基因仍不明确
[0009] This invention reveals for the first time the key genes controlling the depth of watermelon flesh color, and discovers the molecular basis for the continuous deepening of flesh color in cultivated varieties through artificial selection. Targeting the presence of the tandem repeat region of the ClFCI gene promoter in watermelon varieties, this invention designs a convenient PCR marker that can rapidly detect potential flesh color phenotypes in hybrids of light and dark flesh color at the seedling stage. This gene marker, when used in assisted breeding, can improve watermelon fruit quality. This invention elucidates the molecular mechanism of watermelon flesh color deepening and also provides target genes for creating high-quality watermelon varieties with higher carotenoid content.
Smart Images

Figure CN122564028A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and specifically relates to the application of the ClFCI gene, a gene controlling the color intensity of watermelon flesh, and its promoter region tandem repeat sequence in identifying the color intensity of watermelon flesh. Background Technology
[0002] Watermelon (Citrullus lanatus) is one of the world's top ten fruits and an important economic crop widely cultivated both domestically and internationally. my country is the world's largest producer and consumer of watermelons. Watermelon flesh comes in a variety of colors, which can be broadly categorized into five types across different watermelon germplasm resources: red, pink, orange-red, yellow, and white. The main reason for these flesh colors lies in the varying content and types of pigments.
[0003] During the breeding of cultivated watermelon varieties, the flesh color has undergone an improvement process from light to dark. However, the key genes controlling the depth of flesh color in cultivated watermelons remain unclear. Compared to watermelons with different flesh colors (red, orange, yellow, white), watermelon resources more commonly include varieties with the same flesh color but different shades. The differences in the content of various carotenoids among varieties with different flesh colors are very significant. For example, the AU-Sweet Scarlet watermelon variety, which is red or dark red, has a lycopene content higher than 50 mg / 1000g fresh weight, while the pink-fleshed Angeleno Black Seeded watermelon variety has a lycopene content of 30 mg / 1000g fresh weight. It is evident that the nutritional value of watermelons with different flesh colors varies considerably, and it is difficult to obtain offspring with flesh colors deeper than their parents in breeding work. Therefore, it is urgent to understand the intrinsic molecular mechanisms controlling the differences in the accumulation of carotenoids in watermelon flesh and to identify the key watermelon flesh color intensity (FCI) gene, so as to provide a solid foundation for further watermelon molecular improvement. Summary of the Invention
[0004] The inventors of this invention obtained the watermelon flesh color intensity control gene (Flesh color intensity ClFCI gene) by finely mapping the segregating populations of watermelon inbred lines (dark red / light red; dark yellow / light yellow) with different flesh color intensities. They also found that tandem repeats of the promoter region of this gene in dark-fleshed varieties increased the expression of the gene, leading to a deeper flesh color.
[0005] This invention provides the application of the watermelon ClFCI gene in controlling the color depth of watermelon flesh.
[0006] The present invention also provides a method for deepening the color of watermelon flesh, the method comprising overexpressing the ClFCI gene in watermelon plants.
[0007] The present invention also provides a tandem repeat sequence related to the control of watermelon flesh color intensity. The tandem repeat sequence is located in the promoter region of the watermelon ClFCI gene and has a length of 1258 bp. The sequence composition is shown in Sequence 1 in the sequence listing.
[0008] The present invention also provides a method for identifying the color depth of watermelon flesh, the method comprising detecting the number of tandem repeat sequences in the promoter region of the ClFCI gene of the watermelon to be tested; wherein, the tandem repeat sequence has a length of 1258 bp, and the sequence composition is as shown in Sequence 1 in the sequence listing; when one tandem repeat sequence is detected, the watermelon flesh to be tested is light-colored; when two tandem repeat sequences are detected, the watermelon flesh to be tested is medium-colored or dark-colored; when three or more tandem repeat sequences are detected, the watermelon flesh to be tested is dark-colored.
[0009] This invention reveals for the first time the key genes controlling the depth of watermelon flesh color, and discovers the molecular basis for the continuous deepening of flesh color in cultivated varieties through artificial selection. Targeting the presence of the tandem repeat region of the ClFCI gene promoter in watermelon varieties, this invention designs a convenient PCR marker that can rapidly detect potential flesh color phenotypes in hybrids of light and dark flesh color at the seedling stage. This gene marker, when used in assisted breeding, can improve watermelon fruit quality. This invention elucidates the molecular mechanism of watermelon flesh color deepening and also provides target genes for creating high-quality watermelon varieties with higher carotenoid content. Attached Figure Description
[0010] Figure 1 Cross-sectional images of representative fruits from parents and offspring populations used to locate the ClFCI gene in watermelons.
[0011] Figure 2 Fine mapping of the ClFCI gene in watermelon.
[0012] Figure 3 This is a PCR detection diagram of the ClFCI promoter length in different watermelon materials randomly tested.
[0013] Figure 4 Cross-sectional views of four representative watermelon fruits.
[0014] Figure 5 This is a schematic diagram of the promoter structures of four types of ClFCI genes present in different watermelon materials.
[0015] Figure 6 This is a graph showing the relative expression levels of the ClFCI gene in different organs of the JLM.
[0016] Figure 7 This is a graph showing the relative expression levels of the ClFCI gene in fruits of different flesh colors.
[0017] Figure 8This is a phenotypic diagram of the pulp color of the progeny in the ClFCI overexpression transgenic experiment. Detailed Implementation
[0018] To make the technical solution, objectives, and advantages of the present invention clearer, the present invention will be further described in detail below through specific embodiments. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0019] The first aspect of this invention provides the application of the watermelon ClFCI gene in controlling the color depth of watermelon flesh.
[0020] Among them, the watermelon ClFCI gene can be called the watermelon flesh color control gene. Its registered name in the Cucurbitaceae genome database is Cla97C06G121890 (full length 13908bp), which can be found at http: / / cucurbitgenomics.org / v2 / feature / gene / Cla97C06G121890.
[0021] A second aspect of the present invention provides a method for deepening the color of watermelon flesh, comprising overexpressing the ClFCI gene in watermelon plants.
[0022] According to a second aspect of the present invention, the operation of overexpressing the ClFCI gene in watermelon plants includes constructing an overexpression vector of ClFCI using the pYBA1302 vector, and then transferring the overexpression vector into watermelon plants.
[0023] The third aspect of the present invention provides a tandem repeat sequence related to the control of watermelon flesh color intensity. The tandem repeat sequence is located in the promoter region of the watermelon flesh color intensity control gene (i.e., the ClFCI gene), has a length of 1258 bp, and its sequence composition is shown in Sequence 1 of the sequence listing.
[0024] The fourth aspect of this invention provides the application of the tandem repeat sequence in the promoter region of the watermelon flesh color control gene ClFCI, provided in the third aspect of this invention, in identifying the color depth of watermelon flesh.
[0025] The fifth aspect of the present invention provides a method for identifying the color depth of watermelon flesh, the method comprising detecting the number of tandem repeat sequences in the promoter region of the ClFCI gene of the watermelon to be tested; wherein the tandem repeat sequence has a length of 1258 bp and its sequence composition is shown in Sequence 1 in the sequence listing.
[0026] According to a fifth aspect of the present invention, when one of the tandem repeat sequences is detected, the flesh color of the watermelon to be tested is light; when two of the tandem repeat sequences are detected, the flesh color of the watermelon to be tested is medium or dark; and when three or more of the tandem repeat sequences are detected, the flesh color of the watermelon to be tested is dark.
[0027] The inventors of this invention discovered structural differences in the promoter region of the watermelon ClFCI gene between parents with dark and light flesh colors through resequencing and PCR analysis. This difference is due to the fact that a 1258 bp sequence (from -1848 bp to -3105 bp before the ATG in the ClFCI gene promoter of light-fleshed watermelons (JX-2, Cream S) is tandemly repeated three times in dark-fleshed varieties (Ming 58, JLM). Subsequent testing of watermelon materials with different flesh colors revealed that this sequence was repeated 1-4 times in different varieties, and the number of repetitions was correlated with the depth of flesh color.
[0028] For example, watermelon variety 97103 (red-fleshed watermelon with light-colored flesh) and watermelon variety Cream of Saskatchewan (Cream S, light-yellow-fleshed watermelon with light-colored flesh) have one tandem repeat sequence in the promoter region of their ClFCI gene; specifically, the sequence from -1 bp to -3146 bp before the ATG of the ClFCI gene promoter of watermelon variety 97103 has the nucleotide sequence composition shown in Sequence 2 of the sequence listing, and it can be found that it has one tandem repeat sequence.
[0029] The watermelon variety Xin Hongbao (XHB, red-fleshed watermelon, with normal red flesh color, being the middle flesh color) has two tandem repeat sequences in the promoter region of its ClFCI gene; specifically, the sequence from -1 bp to -4404 bp before the ATG of the Xin Hongbao ClFCI gene promoter has the nucleotide sequence composition shown in Sequence 3 of the sequence listing, and it can be found that it has two tandem repeat sequences.
[0030] The watermelon varieties Ming58 (deep red flesh, dark flesh color) and JLM (bright yellow flesh, dark flesh color) have three tandem repeat sequences in the ClFCI gene promoter region. Specifically, the sequence from -1 bp to -5662 bp before the ATG of the ClFCI gene promoter in watermelon varieties Ming58 and JLM has the nucleotide sequence composition shown in Sequence 4 of the sequence listing, and three tandem repeat sequences can be found.
[0031] The ClFCI gene promoter region of the watermelon variety GS89 (Black Bengjin, or GS89-HBJ, orange flesh, dark flesh color) has four tandem repeat sequences as described above. The sequence from -1 bp to -6920 bp before the ATG of the ClFCI gene promoter has the nucleotide sequence composition shown in Sequence 5 of the sequence listing, and four tandem repeat sequences as described above can be found.
[0032] According to a fifth aspect of the present invention, the method for identifying the color depth of watermelon flesh includes PCR amplification using the genomic DNA of the watermelon to be tested as a template and employing the following primers:
[0033] Upstream primer: 5'-CAAGGATAATTTTAAAATAATG-3' (sequence 6);
[0034] Downstream primer: 5'-ATATACTAATATAATTTGTAGGG-3' (sequence 7);
[0035] If the amplified fragment contains one tandem repeat sequence as shown in Sequence 1, the watermelon flesh color to be tested will be light; if the amplified fragment contains two tandem repeat sequences as shown in Sequence 1, the watermelon flesh color to be tested will be medium or dark; if the amplified fragment contains three or more tandem repeat sequences as shown in Sequence 1, the watermelon flesh color to be tested will be dark.
[0036] For example, for watermelon varieties 97103 and Cream of Saskatchewan, a 1343bp fragment can be amplified. Sequencing revealed that this fragment contains a tandem repeat sequence of length 1258bp, as shown in Sequence 1. The sequence composition of this 1343bp fragment is shown as 1-1343 in Sequence 2 of the sequence listing.
[0037] For the watermelon variety Xin Hongbao (XHB), a 2601bp fragment can be amplified. Sequencing revealed that this fragment contains two tandem repeat sequences of 1258bp length, as shown in Sequence 1. The sequence composition of this 2601bp fragment is shown as 1-2601 in Sequence 3 of the sequence listing.
[0038] For watermelon varieties Ming58 and JLM, a 3859bp fragment can be amplified. Sequencing revealed that this fragment contains three tandem repeat sequences of 1258bp length, as shown in Sequence 1. The sequence composition of this 3859bp fragment is shown as 1-3859 in Sequence 4 of the sequence listing.
[0039] For the watermelon variety GS89, a 5117bp fragment can be amplified. Sequencing revealed that this fragment contains four tandem repeat sequences of 1258bp length, as shown in Sequence 1. The sequence composition of this 5117bp fragment is shown as 1-5117 in Sequence 5 of the sequence listing.
[0040] According to a fifth aspect of the present invention, the method for identifying the color depth of watermelon flesh includes PCR amplification using the genomic DNA of the watermelon to be tested as a template and employing the following primers:
[0041] Upstream sequence: 5'-CAAGGATAATTTTAAAATAATG-3' (Sequence 6);
[0042] Downstream sequence: 5'-GTAAAGATGGGTTGGGTTGTTTAC-3' (Sequence 8);
[0043] If the amplified fragment contains one tandem repeat sequence as shown in Sequence 1, the watermelon flesh color to be tested will be light; if the amplified fragment contains two tandem repeat sequences as shown in Sequence 1, the watermelon flesh color to be tested will be medium or dark; if the amplified fragment contains three or more tandem repeat sequences as shown in Sequence 1, the watermelon flesh color to be tested will be dark.
[0044] Using the primer combination of sequences 6 and 8 described above, the promoter region of the ClFCI gene can be amplified. The number of tandem repeat sequences shown in Sequence 1 can then be determined by the size of the amplified product. For example, a 3146 bp fragment (sequence composition as shown in Sequence 2 of the sequence listing) contains one tandem repeat sequence shown in Sequence 1, a 4404 bp fragment (sequence composition as shown in Sequence 3 of the sequence listing) contains two tandem repeat sequences shown in Sequence 1, a 5662 bp fragment (sequence composition as shown in Sequence 4 of the sequence listing) contains three tandem repeat sequences shown in Sequence 1, and a 6920 bp fragment (sequence composition as shown in Sequence 5 of the sequence listing) contains four tandem repeat sequences shown in Sequence 1.
[0045] Unless otherwise specified, all reagents and materials used in the following examples are products that can be obtained from commercial channels; unless otherwise specified, all testing and detection methods used in the following examples are conventional testing and detection methods in the field and can be obtained from textbooks, reference books or academic journals.
[0046] In this invention, the "depth" and "lightness" of watermelon flesh color are detected and defined in the following manner:
[0047] The color of watermelon flesh was measured using a Konica Minolta CR-410 colorimeter. The measurement results consist of five data points: "L" represents the object's brightness (0-100, ranging from black to white); "a" represents the object's red-green hue (positive values indicate red, negative values indicate green); "b" represents the object's yellow-blue hue (positive values indicate yellow, negative values indicate blue); "C" represents color saturation; and "h" represents the hue angle. This invention primarily aims to distinguish different shades of the same flesh color (most watermelon flesh colors can be categorized as red and yellow). Therefore, the measured "C" value is used to measure the depth of watermelon flesh color. The "C" reading represents color saturation. The criteria for judging the depth of watermelon flesh color are: "C" > 30 is defined as "dark" watermelon flesh color; "C" values between 25 and 30 (25 ≤ "C" ≤ 30) are defined as "medium" watermelon flesh color; and "C" < 25 is defined as "light" watermelon flesh color.
[0048] In the following examples, the test materials used (representative fruit cross-section diagrams are shown in the figure) Figure 1 (as shown)
[0049] Separation populations of light and dark red flesh: the male parent is JX-2 (light red flesh watermelon, "C" value is 21, flesh color is light), the female parent is Ming 58 (dark red flesh watermelon, "C" value is 33, flesh color is dark); and the F1 and F2 generations obtained by crossing the two;
[0050] Segregation populations of light and dark yellow flesh: The paternal parent was Cream of Saskatchewan (abbreviated as Cream S, light yellow flesh watermelon, "C" value is 16, flesh color is light), and the maternal parent was JLM (bright yellow flesh watermelon, "C" value is 34, flesh color is dark); as well as the F1 and F2 generations of crosses between the two.
[0051] All test materials used in this invention are germplasm resources preserved in the Watermelon Germplasm Resource Bank of the Vegetable Research Institute, Beijing Academy of Agricultural and Forestry Sciences. Anyone may freely obtain the relevant materials from this bank to achieve the purpose of this invention. The contact address is: Vegetable Research Institute, Beijing Academy of Agricultural and Forestry Sciences, Xijiao Banjing, Haidian District, Beijing, 100097, China; Contact person: Zhang Jie; Telephone: 01051503039.
[0052] Genomic DNA extraction of the above-mentioned test materials: The method of Murry et al. (1980) was followed (Murray M, Thompson W F. Rapid isolation of high molecular weight plant DNA [J]. NuclAcid Res, 1980, 8: 668-673.).
[0053] Total RNA was extracted from the above-mentioned test materials using the EASYspin Plus Plant RNA Kit provided by Beijing Adley Biotechnology Co., Ltd. Following the kit's instructions, total RNA was extracted from the roots, stems, leaves, flowers, and fruits of the tested plants. The concentration of total RNA extracted from the test materials was determined by OD260 using a UV spectrophotometer (Shimadzu UV-1201, Japan), and the extraction quality was assessed by 1.2% agarose gel electrophoresis. The first strand of cDNA was synthesized using the Reverse Transcriptase M-MLV (RNase H¯) reverse transcription kit purchased from TAKARA.
[0054] Example 1
[0055] This embodiment illustrates the genomic location and cloning of the ClFCI gene, which controls the color intensity of watermelon flesh, as well as the discovery of tandem repeat sequences in the promoter region and their relationship with the color intensity of watermelon flesh.
[0056] I. ClFCI gene localization:
[0057] Based on the resequencing results of four watermelon parents (JX-2, Ming58, Cream S, and JLM), SNP / InDel sites between two pairs of parents were obtained, and specific high-throughput KASP primers were designed for genomic localization of the ClFCI gene.
[0058] The parental DNA pool was amplified using pooled analysis (BSA) to screen for polymorphic markers linked to traits and obtain the initial localization region. The ClFCI gene locus was then located in a 3.2 Mb region (22,400,000 to 24,600,000 bp) on chromosome 6 of the watermelon 97103 v2.5 genome.
[0059] Using watermelon genome resequencing data, polymorphic markers within the aforementioned interval were further designed. Using the genomic DNA of the tested materials as templates, KASP marker detection was performed to construct a genetic map. Through 14 pairs of KASP markers within this interval (the composition of high-throughput KASP detection primers is shown in Table 1), the FCI locus was located between markers 6-24.17 (located at 24.17 Mb on Chr6) and markers 6-24.3 (located at 24.3 Mb on Chr6). The interval contains 15 genes, including Cla97C06G121890. The fine mapping of the constructed watermelon flesh color control gene (i.e., the ClFCI gene) is shown below. Figure 2 As shown.
[0060] Table 1 KASP primer composition
[0061] 6_22.7M GAAGGTGACCAAGTTCATGCTAAGCCATCGAATTCGACACTCAAAAT GAAGGTCGGAGTCAACGGATTAAGCCATCGAATTCGACACTCAAAAA GCTGAATTTTTCTGGGGTTCGTCTGTT 6_22.8M GAAGGTGACCAAGTTCATGCTAATCGTGTGAAACTTACACTCATTTAACA GAAGGTCGGAGTCAACGGATTCGTGTGAAACTTACACTCATTTAACG GCATCACTAACATTTGTCATTTGTCGAATAATTA 6_23.5M GAAGGTGACCAAGTTCATGCTTATTGCATTAGGGATTTCAACCCTTAC GAAGGTCGGAGTCAACGGATTCTATTGCATTAGGGATTTCAACCCTTAT GTGCTACTCCACTCATAACCAATTAGTTTT 6_23.7M TAGTCCTCATTCGTGAATTTTAAATTTTGT GTCCTCATTCGTGAATTTTAAATTTTGC GAATTTCTACCATATAGACTATATAATTATTAATTTTAAAATAT 6_23.9M GAAGGTGACCAAGTTCATGCTTTTATACAAGACTCCATGAATAATCTCAG GAAGGTCGGAGTCAACGGATTATTTATACAAGACTCCATGAATAATCTCAT AGGGTGTGATTTCATTAAATACACCATTAAG 6_24.0M GCAACCCCTCCCAACCATCTT CAACCCCTCCCAACCATCTC CATATCGGTCCCTTTATCAATTCTTTCC 6_24.1M TTAAAGAATACACAAAACTGAATAGTAGCTGTCAGTACTTTTCTTCATTTAGAAACCAAAAGAGACATATAAAGA[G / A]AGGAGGAGCAATGCCAATGACCATAACTAAGAGAACAAAACAAATGAGAGAAAATGCATATCAATCAAATTACCC GAAGGTGACCAAGTTCATGCTGTCATTGGCATTGCTCCTCCTC GAAGGTCGGAGTCAACGGATTGTCATTGGCATTGCTCCTCCTT 6_24.17M AAGGGTTGAGTGTTAAGCTTCTCGGGAGTCACCGTAATTATGTTGTAATTCCAGATAAGTATTTTATTGTAATTG[C / G]TTGACATTATTAATAGTGAAGTTATATTTCCTAGATTGCTGCTCCCTAGACATAGGTGATATTATTGCACCGAAC GAAGGTGACCAAGTTCATGCTGTAATTCCAGATAAGTATTTTATTGTAATTGC GAAGGTCGGAGTCAACGGATTGTAATTCCAGATAAGTATTTTATTGTAATTGG 6_24.30M GAGTTAAACAGAAGCAAAATATTGAAAATGAAAATTAGGTTACCTTGAAAGAAGGGAGGGTAAATGAAGGTGGGG[G / A]GGAAGCCAAGCATTAAAGCTACCAAAGCAACACAACATTATTTTAACCCTACAATTCCTTCATTCAAATGTCGTT GAAGGTGACCAAGTTCATGCTGTAGCTTTAATGCTTGGCTTCCC GAAGGTCGGAGTCAACGGATTGGTAGCTTTAATGCTTGGCTTCCT 6_24.32M AAATTAGAGCCTCAATTTGGCACCTTATAATCTCGAATGCTAGAAACAATCATGATATTAACGAGAGCCACACCT[A / G]ACTAAAATGATTCTTGACACTATAAATAGCCTCATTCAACAACTCCGAATGAGAGAGTAAGTAACTTTCAAAAGA GAAGGTGACCAAGTTCATGCTATGATATTAACGAGAGCCACACCTA GAAGGTCGGAGTCAACGGATTGATATTAACGAGAGCCACACCTG 6_24.5M GAAGGTGACCAAGTTCATGCTCCTCCATCCAAATGGCCTTCTC GAAGGTCGGAGTCAACGGATTACCTCCATCCAAATGGCCTTCTA GTTTTGTATTGGGGATTTGCGGTATAGAAA 6_24.6M GAAGGTGACCAAGTTCATGCTTAAGTTGGCAAGCTTAGGCCGC GAAGGTCGGAGTCAACGGATTTATTAAGTTGGCAAGCTTAGGCCGA ATTTGTTTGAGATTATCCCTTTTATCTACATGGAT 6_24.7M GAAGGTGACCAAGTTCATGCTCCAATCTTTGGTATTTCAACTGCAACA GAAGGTCGGAGTCAACGGATTCAATCTTTGGTATTTCAACTGCAACG CAGAGTTCGAATCTTTGTGAACATACGAAA 6_24.8M GAAGGTGACCAAGTTCATGCTCCTCCTCCAACGCTTTCCAACA GAAGGTCGGAGTCAACGGATTCTCCTCCAACGCTTTCCAACC GTTTTTGACGCATGGCGGTTGGAATT
[0062] II. Cloning of candidate genes, discovery of tandem repeat sequences in promoter regions, and their relationship with the color intensity of watermelon flesh.
[0063] Based on genome annotation results, the sequences of 15 candidate genes for the initial localization region of the gene locus controlling the color intensity of watermelon flesh were analyzed using resequencing data, and the following primers were designed:
[0064] The specific primers (FCI primers) used to amplify the CDS sequence of the ClFCI gene are as follows:
[0065] The upstream sequence is: 5'-ATGGCTCCCAAAGCTGGAAAAAC-3';
[0066] The downstream sequence is: 5'-TCAACTTGAAACCTCAACAATC-3';
[0067] The specific primers (FCI-P) used to amplify the promoter region sequence of the ClFCI gene are as follows:
[0068] The upstream sequence is: 5'-CAAGGATAATTTTAAAATAATG-3' (sequence 6);
[0069] The downstream sequence is: 5'-GTAAAGATGGGTTGGGTTGTTTAC-3' (Sequence 8);
[0070] The following are the SV-specific primers (FCI-SV) used to amplify the promoter region of the ClFCI gene that exhibit differential distribution:
[0071] The upstream sequence is: 5'-CAAGGATAATTTTAAAATAATG-3' (sequence 6);
[0072] The downstream sequence is: 5'-ATATACTAATATAATTTGTAGGG-3 (Sequence 7).
[0073] Using genomic DNA from four watermelon parents (JX-2, Ming58, Cream S, and JLM) as templates, PCR amplification was performed using the aforementioned FCI primers, FCI-P primers, and FCI-SV primers, respectively.
[0074] The PCR amplification reaction system (20 μL) consisted of: 2 μL of 10× TransStart Taq Buffer containing 15 mM MgCl2; 0.8 μL of 2.5 mM dNTPs; 0.9 U TransStart Taq DNA Polymerase; 0.5 μL of 10 mM upstream primer; 0.5 μL of 10 mM downstream primer; 20 ng of template DNA; and ddH2O to bring the total volume to 20 μL.
[0075] The PCR amplification reaction program was as follows: Stage 1: 94℃ pre-denaturation for 5 min; Stage 2: 94℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min 30 s, for a total of 38 cycles; Stage 3: 72℃ extension for 10 min; Stage 5: storage at 4℃.
[0076] The results showed that the fragment amplified using the above FCI primers was 5547 bp in length. Sequencing revealed that it was the CDS of the Cla97C06G121890 gene, consistent with the sequence composition in the Cucurbitaceae Genome Database (http: / / cucurbitgenomics.org / v2 / feature / gene / Cla97C06G121890).
[0077] Using the aforementioned FCI-P primers, a 3146 bp promoter sequence was amplified in the light-colored JX-2 and Cream S watermelon parent materials, and the sequencing results showed the sequence composition as shown in Sequence 2. A 5662 bp promoter sequence was amplified in the dark-colored Ming 58 and JLM watermelon parent materials, and the sequencing results showed the sequence composition as shown in Sequence 4. Comparing Sequence 2 and Sequence 4 reveals that Sequence 2 contains one tandem repeat sequence as shown in Sequence 1, and Sequence 4 contains three tandem repeat sequences as shown in Sequence 1.
[0078] Using the aforementioned SV identification primer FCI-SV, a 1343 bp fragment was amplified in the light-colored JX-2 and Cream S watermelon parent materials, and a 3859 bp fragment was amplified in the dark-colored Ming 58 and JLM watermelon parent materials. It is evident that the dark-fleshed parent material is 2516 bp (2 * 1258 bp) longer than the light-fleshed parent material. Sequencing revealed significant structural variations (SVs) between the dark and light-fleshed parent materials, with some promoters in the dark-fleshed watermelon material containing repetitive insertion sequences. Specifically, the 1343 bp fragment amplified from the light-fleshed parent material contains one tandem repeat sequence as shown in Sequence 1, while the 3859 bp fragment amplified from the dark-fleshed parent material contains three tandem repeat sequences as shown in Sequence 1. The 2516 bp difference is precisely due to the difference of two 1258 bp tandem repeat sequences as shown in Sequence 1. The amplification results were consistent with the results of the informatics analysis.
[0079] Example 2
[0080] This example illustrates the application of the tandem repeat sequence in the promoter region of the ClFCI gene in identifying the color depth of watermelon flesh.
[0081] Eighteen watermelon varieties (Ming58, AU, ZHT, L600, XHB, TS409, Sanbai, K Wushuang, PI296341, Improved TWF, Hard-fleshed TWF, GS12, GS10, GS89, GS41, QM4K, Congo, 97103) were selected, and genomic DNA was extracted from each. PCR amplification was performed using the primers listed below (PCR system and reaction procedure were the same as in Example 1):
[0082] Upstream primer: 5'-CAAGGATAATTTTAAAATAATG-3' (sequence 6);
[0083] Downstream primer: 5'-ATATACTAATATAATTTGTAGGG-3' (sequence 7).
[0084] Electrophoresis of the PCR amplification products revealed four types of PCR products with lengths of 1343 bp, 2601 bp, 3859 bp, and 5117 bp, respectively, in different watermelon materials. Sequencing analysis showed that these differences were due to variations in the number of tandem repeats shown in sequence 1 (1258 bp). (Electrophoresis results are shown below.) Figure 3As shown in the figure, lanes 1 and 18 are DNA markers (unit: bp), and lane 17 is a blank control without any DNA template; see Table 2 for flesh color. Meanwhile, a Konica Minolta CR-410 colorimeter was used to detect the flesh color of the watermelon, and the "C" value of each tested watermelon material was measured (see Table 2).
[0085] Table 2. Fragment length and flesh color of 18 different watermelon materials
[0086]
[0087] The electrophoretic fragments of these 18 watermelon materials were recovered and sequenced. The results showed that the sequence composition of the four types of PCR products, namely 1343bp, 2601bp, 3859bp, and 5117bp, were as shown in Sequence 2 (1-1343), Sequence 3 (1-2601), Sequence 4 (1-3859), and Sequence 5 (1-5117) in the sequence listing, respectively. That is, the 1343bp fragment contains one sequence shown in Sequence 1, the 2601bp fragment contains two sequences shown in Sequence 1, the 3859bp fragment contains three sequences shown in Sequence 1, and the 5117bp fragment contains four sequences shown in Sequence 1.
[0088] In summary, when the ClFCI gene promoter region of the 18 watermelon materials contains one sequence as shown in Sequence 1, the flesh color is light; when it contains two sequences as shown in Sequence 1, the flesh color is medium or dark; and when it contains three to four sequences as shown in Sequence 1, the flesh color is dark.
[0089] Then, four representative samples were selected: L600, XHB, Ming 58, and GS89 (pulp color as shown). Figure 4 As shown), PCR amplification was performed using the following primers (PCR system and reaction procedure are the same as in Example 1):
[0090] The upstream sequence is: 5'-CAAGGATAATTTTAAAATAATG-3' (sequence 6);
[0091] The downstream sequence is: 5'-GTAAAGATGGGTTGGGTTGTTTAC-3' (sequence 8).
[0092] The PCR amplification products were subjected to electrophoresis and sequencing. The sequence composition of the amplified fragments of L600, XHB, Ming58, and GS89 was found to be as shown in 2, 3, 4, and 5 of the sequence listing, respectively.
[0093] Meanwhile, following the method described in Petry FC and Mercadante AZ. New method for carotenoid extraction and analysis by HPLC-DAD-MS / MS in freeze-dried Citrus and Mangopulps. Journal of the Brazilian Chemical Society. 2018, 1:205-215, the carotenoid content (unit: mg / 100g FW, representing the number of mg of target substance per 100g fresh weight) in the flesh of watermelon materials with different shades of flesh color was detected using Ultra Performance Liquid Chromatography (UPLC) (ExionLC™ AD, https: / / sciex.com.cn / ) and Tandem Mass Spectrometry (MS / MS). The results are shown in Table 3.
[0094] Table 3. Carotene content and colorimeter values in watermelon samples.
[0095]
[0096] Depend on Figure 4 As shown in Table 3, the number of sequences shown in Sequence 1 in the promoter region of the ClFCI gene in watermelon materials is significantly related to the depth of flesh color: when only one sequence shown in Sequence 1 is present, the flesh color is light; when two sequences shown in Sequence 1 are present, the flesh color is medium or dark; when three to four sequences shown in Sequence 1 are present, the flesh color is dark; and the number of sequences shown in Sequence 1 is positively correlated with the content of carotene in watermelon materials that causes the depth of flesh color.
[0097] In summary, primers of sequences 6 and 7 can be used to detect the SV sequence of the promoter region of the ClFCI gene in watermelon materials with dark and light flesh colors, thereby identifying whether the flesh color of the watermelon material is dark or light. Alternatively, the promoter region fragment of the ClFCI gene in watermelon materials can be amplified using sequences 6 and 8, and the number of tandem repeat sequences in the obtained ClFCI gene promoter region fragment can be used to identify whether the flesh color of the watermelon material is dark or light.
[0098] Example 3
[0099] This example illustrates the spatiotemporal expression analysis of the ClFCI gene, confirming that the SV differences in the promoter region (i.e., the number of tandem repeat sequences in sequence 1) lead to high expression of the target gene in deep-fleshed varieties.
[0100] The expression levels of the ClFCI gene in the roots, stems, leaves, flowers, and fruits of the watermelon variety JLM were detected using quantitative real-time PCR to preliminarily analyze the mechanism of action of ClFCI. Simultaneously, the cDNA of the two parents, Cream S and JLM, and representative F2 fruits were analyzed to determine the expression of the ClFCI gene in fruits with different flesh colors. Details are as follows:
[0101] Using cDNA from the roots, stems, leaves, flowers, and fruits of the tested materials as templates, PCR amplification was performed using the following quantitative real-time PCR primers.
[0102] Primers for real-time PCR:
[0103] FCI_qPCR_F: 5'-CAGTAGGTGCATCATCTCCAG-3';
[0104] FCI_qPCR_R: 5'-CAATCTCAGCTTCATTGTCGC-3';
[0105] ACTIN_F: 5'-CCTACAACTCAATTATGAAGTGTG-3';
[0106] ACTIN_R: 5'-GAAATCCACATCTGCTGGAAGGTG-3'.
[0107] Among them, primer FCI_qPCR is a specific primer for the spatiotemporal expression analysis of ClFCI, and primer ACTIN is an internal reference primer for real-time PCR.
[0108] The quantitative PCR amplification reaction system (20 μL) consisted of: 20 ng cDNA template, 2×GoTaq... ® qPCR MasterMix 10 μL, 10 μM upstream primer 0.4 μL, 10 μM downstream primer 0.4 μL, and Nuclear-Free Water to make up to 20 μL.
[0109] The quantitative PCR amplification reaction program was as follows: Stage 1: 95℃ pre-denaturation for 5 min; Stage 2: 95℃ for 20 s, 58℃ for 20 s, 72℃ for 30 s, for a total of 40 cycles; Stage 3: 94℃ for fluorescence release for 8 min.
[0110] The results are as follows Figure 6 As shown, the ClFCI gene is expressed in the roots, stems, leaves, flowers, and fruits of JLM.
[0111] The expression of the ClFCI gene in the fruits of 40 F2 generation watermelon materials used for constructing deep-fleshed and shallow-fleshed pool sequencing from parental materials Cream S and JLM and their F2 populations was further examined. The results are as follows: Figure 7 As shown ( Figure 7 In the study, Y1-Y20 were representative F2 plants with deep yellow flesh, and W1-W20 were representative F2 plants with light yellow flesh. The results showed that, among parents with different flesh colors and segregating populations, the expression level of the ClFCI gene in the fruits of dark-fleshed materials was significantly higher than that in light-fleshed varieties, with an expression level 2-3 times higher.
[0112] These results indicate that tandem repeats in the promoter region of the ClFCI gene can lead to high expression of the ClFCI gene, thereby causing a deepening of the watermelon flesh color.
[0113] Example 4
[0114] This example illustrates that overexpression of the ClFCI gene can deepen the color of watermelon flesh.
[0115] An overexpression vector for ClFCI was constructed using the pYBA1302 vector: the full-length CDS of ClFCI was amplified from the cDNA of watermelon material 97103 and then inserted into the EcoRI / XhoI site of pYBA1302. Following the watermelon genetic transformation method published in our laboratory (Zhang Jie; Guo Shaogui; Ren Yi; Zhang Haiying; Gong Guoyi; Zhou Ming; Wang Guizhang; Zong Mei; He Hongju; Liu Fan; Xu Yong*; High-level expression of a novel chromoplast phosphate transporter ClPHT4;2 is required for flesh color development in watermelon , New Phytologist, 2017, 213(3):1208-1221.), Agrobacterium carrying the target plasmid (FCI-OE) was transformed into watermelon material L600. The successful transformation of watermelon by the overexpression vector was confirmed using specific primers (upstream primer for the 35S promoter and downstream primer for the ClFCI gene) and Bar test strips. After obtaining the homozygous T2 line, the fruit pulp color phenotype was observed.
[0116] The upstream primer for the 35S promoter and the downstream primer for the ClFCI gene are as follows:
[0117] 35S-F: 5'-GAAGTTTCATTTCATTTGGAGAGG-3';
[0118] ClFCI-R: 5'-ACTTGAAACCTCAACAATCTC-3'.
[0119] By constructing a line transgenic ClFCI gene overexpression strain, observation of the pulp color phenotype in the offspring revealed (e.g.) Figure 8 As shown in the diagram (the first "control" is an empty vector control, and the following three are different transgenic lines), overexpression of the ClFCI gene in the light-fleshed variety L600 can deepen the flesh color of watermelons, and the content of carotenoids in the flesh was found to be significantly increased. This indicates that overexpression of the ClFCI transgene can enhance the deepening of watermelon flesh color.
[0120] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Watermelon ClFCI The application of genes in controlling the color depth of watermelon flesh.
2. A method for deepening the color of watermelon flesh, said method comprising overexpressing in watermelon plants ClFCI Manipulation of genes.
3. The method according to claim 2, characterized in that: The overexpression in watermelon plants ClFCI Gene manipulation included constructing using the pYBA1302 vector. ClFCI The operation of overexpressing a gene using a vector and then transferring the overexpression vector into watermelon plants.
4. The method according to claim 3, characterized in that: The method includes... ClFCI The CDS of the gene was inserted into the EcoRI / XhoI site of pYBA1302 to obtain a gene containing... ClFCI The pYBA1302 recombinant vector containing the gene; then the pYBA1302 recombinant vector containing the gene; ClFCI The pYBA1302 recombinant vector of the gene was transferred into Agrobacterium, and then the Agrobacterium was transformed into watermelon plants.