A method for genetic transformation of sunflowers and its application

Abstract

This invention provides a method and application for sunflower genetic transformation, belonging to the field of plant genetic engineering technology. This invention establishes a stable genetic transformation method for sunflower that does not require tissue culture or sterile conditions. Under non-sterile conditions, sunflower explants are immersed in a resuspension of Agrobacterium carrying exogenous genes, and then directly transplanted into a soil culture substrate for cultivation. Transgenic positive seedlings are obtained through screening and identification. The method described in this invention simplifies the process, significantly shortens the cycle, and saves considerable manpower and resources; it provides an efficient strategy for solving the challenges of sunflower genetic transformation, no longer limited by variety genotype. This invention achieves efficient, genotype-independent genetic transformation of sunflowers, providing technical support for basic research and breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and particularly relates to a method for genetic transformation of sunflower and its application. Background Technology

[0002] The statements in this section are merely background information related to the present invention and do not necessarily constitute prior art.

[0003] sunflower( Helianthus annuus Sunflower (L.) is an oilseed crop with high oil content (40-60%) and high protein content (17-20%). It is the world's fourth largest oilseed crop and has the potential to produce edible oil and animal feed globally. Sunflower seeds are rich in vitamins, minerals, and essential metabolites, making them highly valuable nutritionally and medicinally. Establishing a genetic transformation system is crucial for improving traits. However, sunflowers are relatively difficult to transform; their transformation is clearly genotype-dependent, and regeneration is extremely challenging.

[0004] Thanks to advancements in genetic engineering, Agrobacterium tumefaciens-mediated transgenic technology has made some progress in sunflower. Liu Haixue et al. established an Agrobacterium-mediated genetic transformation system for sunflower cotyledon nodes using explants from sterile sunflower seedlings. However, this method requires obtaining explants after seed germination, must be carried out under sterile conditions, necessitates tissue culture, is influenced by numerous factors, demands high operator skill, is time-consuming, and has a transformation efficiency of only 3.8%. Patent publication number CN 120981574 A discloses a rapid and stable Agrobacterium-mediated transformation method for sunflower. This method involves separating cotyledons and primary leaves with intact meristems and radicles from germinating sunflower seeds to generate explants, achieving a transformation efficiency of 9%. However, obtaining positive seedlings still requires a relatively long time and also necessitates a sterile tissue culture process.

[0005] Cut-dip-budding (CDB) technology is a gene delivery technique that has emerged in recent years without the need for tissue culture. Authors Cao XS et al. have established a CDB-based gene delivery system in soybean, simplifying the process, shortening the transformation cycle, avoiding aseptic operation, and making it applicable to multiple commercial soybean varieties, breaking genotype limitations. However, soybeans possess strong regeneration capabilities, so it remains to be seen whether this technology can be successfully applied to other species, or whether it can overcome the regeneration difficulties encountered in sunflowers.

[0006] Therefore, how to establish a high-efficiency, rapid, and stably heritable sunflower transformation system without tissue culture in a non-sterile environment is an urgent problem to be solved. Summary of the Invention

[0007] To overcome the shortcomings of traditional tissue culture genetic transformation techniques, this invention provides a method and application for sunflower genetic transformation. The purpose of this invention is to solve the problems of difficult regeneration, numerous genotype limitations, and long cycles required in sunflower genetic transformation, which almost prevent trait improvement and gene research. Furthermore, this invention aims to address the problems of existing genetic transformation methods requiring numerous culture media and aseptic techniques, placing extremely high demands on operators.

[0008] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions: In a first aspect, the present invention provides a method for genetic transformation of sunflowers, wherein the method involves immersing sunflower explants in a resuspension of Agrobacterium carrying exogenous genes under non-sterile conditions, and then directly transplanting them into a soil culture substrate for cultivation, and obtaining transgenic positive seedlings after screening and identification. The method for preparing the explant is as follows: Soak sunflower seeds at room temperature away from light for 15-24 hours, then remove the seed coat and one cotyledon, leaving the embryo attached to the other cotyledon. Then remove the two young leaves from the remaining embryo.

[0009] The selection of plant materials and the characteristics of the species are crucial for genetic transformation based on CDB technology. The explant preparation method in this invention leverages the strong regenerative capacity of this species, enabling the regeneration of transgenic shoots after infection with Agrobacterium, without the need for induction by tissue culture regeneration medium, thus avoiding cumbersome aseptic operations and the use of large amounts of culture medium.

[0010] In a specific embodiment of the present invention, the sunflower explant soaking process includes two steps: ultrasound and vacuuming. Ultrasound and vacuuming, through the application of external force, allow Agrobacterium carrying exogenous genes to better penetrate the plant tissue, thereby achieving the purpose of infection.

[0011] In a specific embodiment of the present invention, the specific steps of immersing sunflower explants in Agrobacterium resuspension carrying exogenous genes are as follows: S1. Place sunflower explants in OD 600 In Agrobacterium resuspension I carrying exogenous genes, the concentration was 0.4-0.6. S2. Sonicate the container containing liquid S1. S3. Replace the liquid in container S2 with OD. 600 After resuspending Agrobacterium-containing exogenous genes in II solution at a concentration of 0.9-1.2, vacuum was applied.

[0012] In a specific embodiment of the present invention, the conditions for ultrasonic treatment are: 40-50Hz, 5-10s; The vacuum is maintained at -0.05 to -0.1 MPa for 3-7 minutes, and repeated 2-3 times. More specifically, the ultrasonic treatment conditions are: 45 Hz, 8 s; The vacuum was maintained at -0.08 MPa for 5 minutes, and repeated 3 times.

[0013] In a specific embodiment of the present invention, the Agrobacterium is Agrobacterium tumefaciens; The Agrobacterium tumefaciens includes Agrobacterium tumefaciens GV3101, Agrobacterium tumefaciens EHA105, Agrobacterium tumefaciens C58C1, Agrobacterium tumefaciens LBA4404 or Agrobacterium tumefaciens AGL1; more specifically, the Agrobacterium tumefaciens is Agrobacterium tumefaciens GV3101 or EHA105.

[0014] Agrobacterium infection solutions can increase the adsorption of Agrobacterium on recipient cells by reducing surface tension, and can also improve the efficiency of T-DNA transport by affecting cell membrane permeability, thereby increasing the efficiency and success rate of Agrobacterium-mediated genetic transformation. Traditional infection solutions include acetylsuccinone (AS), MgCl2, and MES (2-morpholinoethanesulfonic acid), and the specific formulations required vary among species.

[0015] In a specific embodiment of the present invention, the Agrobacterium resuspension is obtained by diluting Agrobacterium cells with Agrobacterium infection solution; The Agrobacterium infection solution is an aqueous solution containing 10 mM MgCl2 and 10 mM MES.

[0016] According to the principles of Agrobacterium-mediated genetic transformation, infection can only be achieved when a plant releases phenolic signals to attract Agrobacterium and activate virulence genes after injury. At this point, T-DNA can be transferred from the Agrobacterium cell to the plant cell and integrated into the plant genome. Therefore, a foreign gene can be constructed into the T-DNA region of a binary expression vector, and the constructed vector can be transformed into Agrobacterium. Subsequently, the Agrobacterium in the infection solution utilizes its own characteristics to transfer the T-DNA containing the foreign gene into the plant cell, thereby achieving Agrobacterium-mediated genetic transformation. Therefore, the foreign gene can be any gene or empty. In a specific embodiment of the present invention, the exogenous gene includes a developmental regulatory gene; the exogenous gene also includes one or more of a reporter gene, an resistance gene, and a target gene; The developmental regulatory genes include ipt , HaWOX5 ; The reporter gene includes the green fluorescent protein gene. GFP Red fluorescent protein gene RFP Cyan fluorescent protein gene CFPβ-glucuronidase GUS synthesis gene, luciferase LUC synthesis gene, or red betaine RUBY Synthetic genes; The resistance gene includes the spectinomycin gene. SpecN Hygromycin phosphotransferase gene hpt Neomycin phosphotransferase gene npt Kanamycin resistance gene kanR or glufosinate resistance gene bar ; Reporter genes or resistance genes form the basis for subsequent screening and identification. The appropriate screening method is selected based on the specific type of the reporter gene or resistance gene. For example, the reporter gene is... GFP Seedlings can be screened using fluorescent lamps; those emitting green fluorescence are positive. For example, if the reporter gene is red betaine... RUBY For synthetic genes, the presence or absence of a positive plant can be directly determined by whether the new shoots are red; if the resistance gene is... bar In this case, screening can be done directly by spraying herbicides. Seedlings that survive after spraying an appropriate amount of herbicide are considered positive. In addition, screening and identification can also be done using common methods such as PCR, qPCR, qRT-PCR, and immunoassay.

[0017] There are no restrictions on the variety of sunflowers mentioned; for example, different varieties of sunflower plants, including oil sunflowers and flowering sunflowers, etc.

[0018] In a specific embodiment of the present invention, the exogenous gene includes a developmental regulatory gene. ipt Developmental regulatory genes HaWOX5 Reporter genes GFP and resistance genes SpecN ; or, The exogenous genes include developmental regulatory genes. ipt Reporter genes RUBY and resistance genes SpecN .

[0019] The culture conditions of infected explants also have a certain impact on transformation efficiency. A warm and humid environment is more conducive to maintaining the regenerative activity of sunflowers and promoting the growth of new shoots.

[0020] In a specific embodiment of the present invention, the culture conditions in the soil-based substrate are as follows: After dark incubation at 20-24℃ for 45-50 hours, the plants are moved to a greenhouse at 25-27℃ with humidity maintained at 65%~75% and 16 hours of light / 8 hours of darkness. Dark incubation is conducive to Agrobacterium infection of explants, while a humid environment is more conducive to genetic transformation and the growth of transgenic plants.

[0021] To further improve conversion efficiency, the soil-based culture substrate can be optimized. Preferably, the soil-based culture substrate comprises one or more of peat moss, vermiculite, perlite, sand, or nutrient soil. More preferably, the soil substrate is a mixture of nutrient soil and vermiculite in a ratio of 4:3.

[0022] The above method can break the limitation of genotype and can be applied to a variety of existing sunflower varieties; in a specific embodiment of the present invention, the sunflower is an oil sunflower, specifically Kangdi No. 5 or S606.

[0023] In a second aspect, the present invention provides the application of the above-described method in sunflower gene function verification, preparation of transgenic sunflowers, preparation of gene-edited sunflowers, preparation of sunflower gene function verification reagents, and preparation of reagents for manufacturing transgenic or gene-edited sunflowers.

[0024] The above one or more technical solutions have the following beneficial effects: This invention establishes a stable genetic transformation method for sunflower mediated by Agrobacterium tumefaciens that does not require tissue culture or sterile conditions. By screening suitable explants and optimizing the infection steps, the process is simplified, the cycle is significantly shortened, and a large amount of manpower and resources are saved. It solves the problem of difficult sunflower regeneration, is no longer limited to specific varieties, and achieves efficient genetic transformation of sunflower that is independent of genotype.

[0025] The method provided by this invention can be used in conjunction with gene editing technology, RNAi technology, overexpression technology, etc., to promote the analysis of more plant functional genes, accelerate the breeding process and the cultivation of superior varieties, and provide a powerful tool for the application and transformation of plant molecular breeding research.

[0026] Advantages of additional aspects of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0027] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0028] Figure 1 This is an electrophoresis diagram of the enzyme digestion vector and amplified fragment in this invention, where lanes 1-7 are respectively... Trans2K®Plus DNA Marker, pIB1 vector digested with KpnI+EcoRI, pIB1 vector digested with KpnI+EcoRI, fragment CmYLCV-RUBY-Hspt878, fragment CaMV35S-ipt-NOS, fragment CaMV35S-HaWOX5-NOS, fragment CaMV35S-SpecN-CaMVpoly(A) signal.

[0029] Figure 2 The reporter gene in Embodiment 1 of this invention is GFP A schematic diagram of the carrier pHa1 structure.

[0030] Figure 3 The reporter gene in Embodiment 2 of this invention is RUBY A schematic diagram of the carrier pHa2 structure.

[0031] Figure 4 This is a schematic diagram of the operation flow of a sunflower genetic transformation method according to the present invention. In the diagram, A represents seed soaking; B shows the morphology of the embryo and cotyledons; C is a magnified view of a portion of Figure B, with the arrow indicating the cutting location; D shows the morphology of the explant after removing the embryo; E shows the explant soaking in Agrobacterium resuspension solution I; F shows ultrasound; G shows the explant soaking in Agrobacterium resuspension solution II; H shows vacuuming; and I shows the transplanting of the explant into the soil culture substrate.

[0032] Figure 5 These are phenotypic images of transgenic positive sunflower seedlings and wild-type seedlings obtained using the genetic transformation method of this invention in Embodiment 1 of this invention, as well as electrophoresis images for identifying exogenous genes. In the images, A is under white light; B is under excitation light at 480 nm; and C is for detecting exogenous genes. GFP Electrophoresis image after PCR amplification, using Maker: Trans 2K®Plus DNA Marker: 1-12 represent transgenic positive seedlings, 13-14 represent plasmid pHa1, 15 represents transformation-negative seedlings, 16 represents wild-type, and 17 represents ddH2O; D indicates detection of exogenous genes. ipt The electrophoresis image used was Maker. Trans 2K®Plus DNA Marker: 1-12 represent transgenic positive seedlings, 13-14 represent plasmid pHa1, 15 represents transformation-negative seedlings, 16 represents wild-type seedlings, and 17 represents ddH2O; E indicates detection of exogenous genes. HaWOX5 The electrophoresis image used was Maker. Trans 2K®Plus DNA Marker: 1-12 are transgenic positive seedlings, 13-14 are plasmid pHa1, 15 is transformation negative seedlings, 16 is wild type, and 17 is ddH2O.

[0033] Figure 6These are phenotypic images of transgenic positive seedlings and wild-type seedlings obtained under white light using the genetic transformation method of this invention, as well as electrophoresis images for identifying exogenous genes, in Embodiment 2 of this invention. In particular, A shows the phenotypic images of transgenic positive seedlings and wild-type seedlings under white light; B shows the images for detecting exogenous genes. RUBY The electrophoresis image used was Maker. Trans 2K®Plus DNA Marker: 1-10 represent transgenic positive seedlings, 11-12 represent plasmid pHa2, 13 represents transformation-negative seedlings, 14 represents wild-type, and 15 represents ddH2O; C indicates detection of exogenous genes. ipt The electrophoresis image used was Maker. Trans 2K®Plus DNA Marker: 1-10 represent transgenic positive seedlings, 11-12 represent plasmid pHa2, 13 represents transformation-negative seedlings, 14 represents wild-type, and 15 represents ddH2O; D indicates detection of exogenous genes. SpecN The electrophoresis image used was Maker. Trans 2K®Plus DNA Marker: 1-10 are transgenic positive seedlings, 11-12 are plasmid pHa2, 13 is transformation negative seedlings, 14 is wild type, and 15 is ddH2O.

[0034] Figure 7 The images show the phenotypic diagrams of transgenic positive seedlings and wild-type seedlings obtained using the genetic transformation method of the present invention in Embodiment 3 of the present invention, where A represents the state under white light; and B represents the state under excitation light of 480nm.

[0035] Figure 8 The following is a comparative example of the steps and morphology of obtaining explants in this invention. In this example, A represents the morphology of the embryo and cotyledons; B is a partial enlargement of Figure A; C is the morphological structure after making a cut between the plumule and radicle; and D is the morphology of the explant after removing two young leaves. Detailed Implementation

[0036] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0037] It should be noted that any aspects of this invention not described in detail are well known to those skilled in the art. Experimental methods in the following examples that do not specify specific conditions were performed under conventional conditions or as recommended by the manufacturer. Experimental steps not detailed herein were referenced from *Molecular Cloning: A Laboratory Manual* (edited by Michael R. Green and Joseph Sambrook, 4th edition), pathophysiological experiments, online databases, etc.

[0038] Unless otherwise specified, all materials and reagents used in the following embodiments were obtained commercially.

[0039] Agrobacterium tumefaciens GV3101 was purchased from Shanghai Weidi Biotechnology Co., Ltd., product number: AC1001S; Agrobacterium tumefaciens EHA105 was purchased from Shanghai Weidi Biotechnology Co., Ltd., product number: AC1013S; Glycerin was purchased from Shanghai McLean Biochemical Technology Co., Ltd., product number: G6201-500g. Kanamycin was purchased from Beijing Coolplay Technology Co., Ltd., product number: SL3820-10×1mL.

[0040] Rifampicin was purchased from Beijing Coolplay Technology Co., Ltd., product number: SL3881-10×1mL. The trademark name of Green Manure is Hua Wuque, and the product number is 20-20-20+TE. Carbendazim was purchased from Guoguang, product number: PD85150-35.

[0041] KpnI was purchased from NEB, item number: R3142; EcoRI was purchased from NEB, item number: R3101.

[0042] The culture medium for Agrobacterium was LB medium, with the following formula: 10 g / L tryptone (Sinopharm, catalog number 69024138), 5 g / L yeast extract (Beijing Solarbio, catalog number: Y8020), 10 g / L sodium chloride (Sinopharm, catalog number: 10019318), and 15 g / L agar powder (Sinopharm, catalog number: 10000561).

[0043] In this invention, the Maker used is Trans 2K®Plus DNA Marker, purchased from Quan Shi Jin, catalog number: BM111-01.

[0044] Infection solution mother liquor formula: Stock solutions: 1M MgCl2: Dissolve 20.33g MgCl2·6H2O in 100mL ddH2O; 0.5M MES: Dissolve 9.762g MES in 100mL ddH2O, and adjust the pH to 5.6 with KOH. MES: Full name 2-Morpholinoethanesulfonic Acid. MgCl2·6H2O was purchased from Sinopharm, catalog number: 10012818; MES was purchased from TargetMol, catalog number: T40545; KOH was purchased from Sinopharm, catalog number: 10017018.

[0045] The working solution is an aqueous solution containing 10 mM MgCl2 and 10 mM MES.

[0046] In this invention, the specific type of vector is a plasmid.

[0047] Carrier information: The vector was constructed via homologous recombination. Expression cassette fragments were amplified using primers listed in Table 1. The CaMV35S-ipt-NOS and CaMV35S-HaWOX5-NOS fragments were then ligated via homologous recombination into the KpnI+EcoRI-digested backbone vector pIB1 (backbone vector pIB1 is disclosed in the article Cao XS, Xie HT, Song ML, et al. Cut–dip–budding delivery system enables genetic modifications in plants without tissue culture. The Innovation, 2023, 4(1): 100345, named binaryvector in the article), thus obtaining vector pHa1. A schematic diagram of the pHa1 vector structure is shown below. Figure 2 As shown; where, ipt , HaWOX5 The gene numbers are U83986.1 and 110906266, respectively, and they were obtained through synthesis; CaMV35S and NOS Obtained from pIB1 plasmid.

[0048] The expression cassette fragments were amplified using the primers in Table 1. The expression cassettes CaMV35S-ipt-NOS, CaMV35S-SpecN-CaMV poly(A) signal, and cMYLCV-RUBY-HSPT878 terminator fragments were then ligated into the KpnI+EcoRI-digested backbone vector pIB1 (backbone vector pIB1 is disclosed in the article Cao XS, Xie HT, Song ML, et al. Cut–dip–budding delivery system enables genetic modifications in plants without tissue culture. The Innovation, 2023, 4(1):100345, named binary vector in the article), resulting in vector pHa2. A schematic diagram of the vector element connections is shown below. Figure 2As shown. Among them, the expression cassette CaMV35S-SpecN-CaMV poly(A) signal and the expression cassette cMYLCV-RUBY-HSPT878terminator fragment were amplified from plasmids containing the RUBY reporter gene published in the previously published article Cao X, Xie H, Wang Z, Guo R, Jing F, He Y, Wang M, Liu H, Li Y, Niu Q, Li G, Lang Z, Zhu JK. An efficient tissue-culture-free soybean genetic transformation technology using the extremely simple cut-dip-budding strategy. Innovation (Camb). 2025 Dec 3;7(3):101221.doi: 10.1016 / j.xinn.2025.101221. PMID: 41789138; PMCID: PMC12957558. The electrophoresis results of the relevant constructs are shown in Figure 1 .

[0049] Among them, the plasmid vector backbones of vectors pHa1 and pHa2 contain nptII, but the T-DNA region does not contain nptII. After transformation into Agrobacterium, Agrobacterium was conferred kanamycin resistance, but plants were not conferred kanamycin resistance.

[0050] The primer information required for constructing the vector is shown in Table 1.

[0051] Table 1 Primer Information Table In this invention, Agrobacterium carrying exogenous genes can be preserved in solid culture medium, can be preserved in liquid culture medium at room temperature in the dark for two weeks, or can be cryopreserved with glycerol for later use.

[0052] In this invention, the genetic transformation efficiency is calculated as follows: [(number of plants displaying reporter gene fluorescence) / (total number of treated plants)] × 100% or [(number of plants displaying red) / (total number of treated plants)] × 100% or [(number of plants with PCR positive results) / (total number of treated plants)] × 100%.

[0053] The present invention will be further described in detail below with reference to specific embodiments. It should be noted that the specific embodiments are explanations of the present invention and not limitations thereof.

[0054] Example 1 This embodiment discloses a method for genetic transformation of sunflowers. Based on CDB technology, the sunflower variety used is Kangdi 5, and the vector used is pHa1. A schematic diagram of the vector is shown below. Figure 2 As shown, the Agrobacterium tumefaciens used is GV3101. The operation flowchart is shown below. Figure 4 As shown.

[0055] The specific operating steps are as follows: S1. Prepare Agrobacterium strains carrying exogenous genes. In the initial stage, the exogenous gene was constructed into a vector to obtain vector pHa1. The primer information used is shown in Table 1 above. Vector pHa1 was then transferred into Agrobacterium strain GV3101 by heat shock method. For specific methods, please refer to the product manual of Shanghai Weidi Biotechnology Co., Ltd., product number: AC1001S, to obtain GV3101 carrying the exogenous gene.

[0056] GV3101 carrying the foreign gene was activated and spread onto LB solid medium containing 50 μg / mL kanamycin (kna) and 50 μg / mL rifampin (Rif). 150 μL of 50% glycerol was added to the center of the medium, followed by 150 μL of the activated GV3101 bacterial suspension carrying the foreign gene. The mixture was spread evenly and incubated upside down in a 28°C incubator for 16 h.

[0057] S2. Processing sunflower seeds Wash sunflower seeds 3-5 times with tap water, then soak them in a carbendazim solution (0.02g carbendazim dissolved in 1 liter of tap water) for 30 minutes. Rinse them thoroughly, then soak them in water, ensuring there is enough water (sunflower seeds are light and will float). Use a large container, ideally allowing each sunflower seed to float on the surface to ensure oxygenation and promote germination. Soak overnight at room temperature in the dark for 18 hours.

[0058] S3. Prepare Agrobacterium resuspension carrying exogenous genes I The Agrobacterium infection solution was prepared as an aqueous solution containing 10 mM MgCl2 and 10 mM MES.

[0059] Pipette 2 mL of Agrobacterium infection solution into the bacterial plate (S1, obtained after 16 h of inverted growth in a 28°C incubator) that was plated the day before. Resuspend the bacterial solution by aspirating and collecting it into a 50 mL centrifuge tube. Add Agrobacterium infection solution to adjust the bacterial solution to OD. 600 The concentration was 0.5, and Agrobacterium resuspension I carrying the exogenous gene was prepared. It was poured into a 200mL sterile Erlenmeyer flask and shaken on a shaker at 50rpm for half an hour in the dark to activate the bacteria.

[0060] S4. Prepare explants and soak them in Agrobacterium resuspension I carrying the exogenous gene. After soaking the seeds overnight, remove the seed coat and one cotyledon. Using the back of a scalpel, break the cotyledon in half, leaving the embryo in the other half. Use the back of the scalpel to remove the two young leaves from the embryo (the apical bud is not yet visible) to obtain explants. Then, soak the explants in an Erlenmeyer flask containing 15 mL of Agrobacterium resuspension I carrying the foreign gene in S3 solution. Do not use too many explants to avoid overcrowding; approximately 100 explants are sufficient.

[0061] To improve the infection efficiency of Agrobacterium, shake the conical flask occasionally to help ensure even infection and wetting.

[0062] S5, Ultrasound The conical flask containing explants and Agrobacterium resuspension I with exogenous genes was sonicated for 8 seconds at 45 Hz. At this time, the water level in the sonication chamber was slightly higher than the bacterial suspension level in the conical flask.

[0063] S6. Prepare Agrobacterium resuspension II and replace it. Take another clean 50mL centrifuge tube, add 10mL of Agrobacterium infection solution, resuspend the remaining bacteria on the bacterial plate (S1, obtained after inverted growth in a 28℃ incubator for 16h), collect it into a 50mL centrifuge tube, and maintain OD. 600 The concentration was 1.0, and Agrobacterium resuspension II was prepared; the liquid in the conical flask in S5 was poured out and replaced with Agrobacterium resuspension II.

[0064] To ensure even mixing, place on a shaker at 110 rpm and shake for 1-1.5 hours at room temperature, away from light.

[0065] S7. Prepare the soil substrate. Mix the potting soil and vermiculite in a 4:3 ratio and sterilize. Add 5g of green manure and 0.1g of carbendazim to 5L of ultrapure water (no sterilization required), and mix the soil and water thoroughly. Pour the soil into the culture box and gently press it down.

[0066] S8, Vacuuming Place the conical flask in S6 in a vacuum chamber and evacuate it to -0.08 MPa. Repeat the evacuation process three times, each time for 5 minutes, shaking twice during the process.

[0067] S9, Transplantation Carefully remove the explants from S8 and place them tightly in the prepared soil substrate with the wound side down. Cover with a sealed transparent cap, ensuring the explants are in contact with the soil to allow for water absorption. Incubate in the dark at 20-24℃ for 48 hours.

[0068] S10. Transfer the culture box containing sunflower seedlings to a greenhouse at 26℃ with 16 hours of light / 8 hours of darkness. Continue culturing until one month after transformation to calculate the conversion rate.

[0069] S11. Four days after transplanting to the greenhouse, observe the plant under a fluorescent lamp (excitation light 480nm). Cut off non-transgenic regenerated buds and remove the terminal bud (to reduce apical dominance and promote de novo regeneration of transgenic buds). If the newly grown leaves emit green fluorescence, the plant is a transgenic positive seedling and should be transplanted for further cultivation. Transformation negative seedlings (i.e., seedlings that failed after genetic transformation) and wild-type seedlings should continue to be cultivated under the same conditions. Continue to observe, spraying water every 2-3 days to maintain humidity at 65%~75%. Pay special attention to maintaining moisture during the first 10 days after transplanting.

[0070] Seventeen days after transformation, the newly grown buds were irradiated with 480nm fluorescent light, such as... Figure 5 As shown in Figure B, the newly grown shoots of transgenic positive seedlings emit green fluorescence, while wild-type (WT) seedlings do not; Figure 5 As shown in Figure A, under white light, there was no significant difference in phenotype between the transgenic positive seedlings and the wild-type seedlings.

[0071] Statistical analysis revealed that 12 GFP transgenic positive seedlings were obtained from an initial 107 seeds, resulting in a genetic transformation efficiency of 11.2%. Additionally, DNA was extracted from leaves of the transgenic positive seedlings, transgenic negative seedlings, and wild-type seedlings using the CTAB method for PCR detection. The exogenous gene on the transgenic positive seedlings was verified by PCR, with plasmid pHa1 used as a positive control, and transgenic negative seedlings, wild-type (WT) seedlings, and water used as negative controls. The reporter gene was amplified using primers GGAAGGTGGCACCTACAAATG (SEQ ID NO.10) and TACATACTAAGGGTTTCTTATATGCTC (SEQ ID NO.11). GFP The result is as follows Figure 5 As shown in Figure C, plasmids and transgenic positive seedling genomes can amplify positive bands, while wild-type and transformation-negative seedlings cannot amplify the target bands; simultaneously, primers ATGGATCTGCGTCTAATTTTCGGT (SEQ ID NO.12) and CTAGCACATTCCGAACGGTG (SEQ ID NO.13) were used for amplification. ipt The result is as follows Figure 5 As shown in Figure D, transgenic positive seedlings can amplify and obtain the target band, while transgenic negative seedlings and wild-type seedlings do not obtain the target band; at the same time, for HaWOX5 Gene identification was performed using primer pairs ATGACATCGGTTCCGGTTCC (SEQ ID NO.14) and TTAGGGTTTGGAGGTGGTGG (SEQ ID NO.15). The results are as follows: Figure 5As shown in Figure E, the target band can be amplified in transgenic positive seedlings, but the target band cannot be obtained in transgenic negative seedlings and wild-type seedlings. The above PCR experiments were performed using 2 × Taq Plus Master Mix Ⅱ (Dye Plus) (manufacturer: Vazyme, catalog number: P213-01), and the specific method is as described in its instruction manual.

[0072] The above results demonstrate that the present invention provides a method for stable genetic transformation of sunflowers. This method can usually obtain identification results within one month, and positive plants can be obtained in as little as half a month, which significantly shortens the time compared to the traditional genetic transformation method through tissue culture.

[0073] Example 2 The difference from Example 1 is that the exogenous gene was constructed into the vector to obtain vector pHa2, and the vector structure diagram is shown below. Figure 3 As shown, it was transformed into Agrobacterium EHA105.

[0074] Fourteen days after the transformation, the screening and identification results are as follows: Figure 6 As shown in Figure A, under white light, the newly grown leaves of the transgenic positive seedlings are red, which is visible to the naked eye, indicating that RUBY synthesis was successful, while this phenotype is not present in the wild type.

[0075] Statistical analysis revealed that 10 transgenic positive seedlings were obtained from an initial 119 seeds, resulting in a genetic transformation efficiency of 8.4%. DNA was extracted from the transgenic positive seedlings, negatively transformed seedlings, and wild-type seedlings using the CTAB method for further testing. The exogenous gene on the transgenic positive seedlings was verified by PCR, with the pHa2 plasmid used as a positive control. PCR experiments were performed using 2 × Taq Plus Master Mix II (Dye Plus) (manufacturer: Vazyme, catalog number: P213-01), following the manufacturer's instructions. Primers GAGGCTTGGCTCAAGTTTGG (SEQ ID NO.16) and TGCGACCCTCGCCATGATCC (SEQ ID NO.17) were used for amplification. RUBY The result is as follows Figure 6 As shown in Figure B, the PCR results are consistent with the phenotypic identification results. Transgenic positive seedlings can amplify the target band, but wild-type, transform-negative plants, and control water cannot amplify the target band. Further testing with primers ATGGATCTGCGTCTAATTTTCGGT (SEQ ID NO.12) and CTAGCACATTCCGAACGGTG (SEQ ID NO.13) for the exogenous gene was conducted. ipt The test results are as follows Figure 6As shown in Figure C, the DNA of all transgenic positive seedlings could be amplified to obtain the target band, while the wild-type, transformation-negative plants, and control water could not amplify to obtain the target band. The exogenous gene was amplified and detected using primers GAGCCACTTGTTGGCTGTTC (SEQ ID NO.18) and ATATTGAGCTGGAAGTCTTTCCATAG (SEQ ID NO.19). specN The result is as follows Figure 6 As shown in Figure D, the DNA of transgenic positive seedlings can be amplified to obtain the target band, while wild-type, transgenic negative plants and control water cannot amplify to obtain the target band.

[0076] Example 3 The difference from Example 1 is that the sunflower variety used in this example is S606. The screening and identification results 26 days after transformation are as follows... Figure 7 As shown, under white light, there was no significant difference in phenotype between the transgenic positive seedlings and the wild-type seedlings. Figure 7 (Figure A in the diagram) Under fluorescent light, the transgenic positive seedlings emit green fluorescence ( Figure 7 (See Figure B in the diagram). Statistical analysis showed that from an initial 88 seeds, 9 transgenic positive seedlings were obtained, resulting in a genetic transformation efficiency of 10.2%.

[0077] Comparative Example 1 The only difference between this comparative example and Example 1 is the explant. In this comparative example, the explant was prepared by making a cut between the plumule and hypocotyl of the retained embryo. The explant was obtained by cutting between the plumule and hypocotyl of the retained embryo, and then using the back of a knife to remove the two young leaves on the retained embryo along arrow directions 1 and 2 respectively. The acquisition process and morphology are as follows. Figure 8 As shown, Figure 8 Figure A in the diagram represents the preservation of embryo and cotyledon morphology, and... Figure 8 A partial magnification of Figure A in the image yields Figure 8 Image B in the diagram, after cutting it once, yields the following result: Figure 8 The morphological structure shown in Figure C is obtained by further removing two young leaves. Figure 8The explant shown in Figure D is an example. When this explant was used for infection, no transgenic positive seedlings were obtained from 233 seeds. This may be because cells in the hypocotyl region are usually already in the differentiation and maturation stage, with low meristematic capacity and dedifferentiation potential, making it difficult to induce adventitious buds or regenerate complete plants during culture. Furthermore, hypocotyl cutting may not easily integrate exogenous genes (e.g., low transformation efficiency), or its wound signaling and hormone response patterns may be unfavorable for bud initiation and growth, thus failing to produce transgenic positive seedlings as efficiently as young shoots. However, it should be noted that the purpose of this invention is not to explore the molecular mechanisms of cell differentiation. One objective of this invention is simply to provide those skilled in the art with a reproducible method for obtaining positive seedlings using young shoots as explants, or simply to provide a preferred explant selection strategy.

[0078] The above results demonstrate that the method provided by this invention can overcome genotype limitations and achieve regeneration in various sunflower species, realizing stable Agrobacterium-mediated genetic transformation. Furthermore, suitable explants are crucial for successful transformation.

[0079] While the specific embodiments of the present invention have been described above in conjunction with the accompanying drawings, this is not intended to limit the scope of protection of the present invention. Those skilled in the art should understand that various modifications or variations that can be made by those skilled in the art without creative effort based on the technical solutions of the present invention are still within the scope of protection of the present invention.

Claims

1. A method for genetic transformation of sunflowers, characterized in that, Under non-sterile conditions, sunflower explants were immersed in Agrobacterium resuspension carrying exogenous genes and then directly transplanted into soil culture substrate for cultivation. Transgenic positive seedlings were obtained after screening and identification. The method for preparing the explant is as follows: Soak sunflower seeds at room temperature in the dark for 15-24 hours, then remove the seed coat and one cotyledon, leaving the embryo attached to the other cotyledon. Then remove the two young leaves from the remaining embryo.

2. The sunflower genetic transformation method as described in claim 1, characterized in that, The process of soaking sunflower explants includes two steps: ultrasound and vacuuming.

3. The sunflower genetic transformation method as described in claim 2, characterized in that, The specific steps for immersing sunflower explants in Agrobacterium resuspension carrying exogenous genes are as follows: S1. Place sunflower explants in OD 600 In Agrobacterium resuspension I carrying exogenous genes at a concentration of 0.4-0.6; S2. The container containing liquid S1 is subjected to ultrasonic treatment; S3. Replace the liquid in container S2 with OD. 600 After resuspending Agrobacterium-containing exogenous genes in II solution at a concentration of 0.9-1.2, vacuum was applied.

4. The sunflower genetic transformation method as described in claim 3, characterized in that, The ultrasonic treatment conditions are: 40-50Hz, 5-10s; The vacuum is maintained at -0.05 to -0.1 MPa for 3-7 minutes, and repeated 2-3 times.

5. The sunflower genetic transformation method as described in claim 1, characterized in that, The Agrobacterium is Agrobacterium tumefaciens.

6. The sunflower genetic transformation method as described in claim 1, characterized in that, The Agrobacterium resuspension was obtained by diluting Agrobacterium cells with Agrobacterium infection solution; the Agrobacterium infection solution was an aqueous solution containing 10 mM MgCl2 and 10 mM 2-morpholine ethanesulfonic acid.

7. The sunflower genetic transformation method as described in claim 1, characterized in that, The exogenous genes include developmental regulatory genes; The exogenous genes also include one or more reporter genes and resistance genes.

8. The sunflower genetic transformation method as described in claim 7, characterized in that, The exogenous genes include developmental regulatory genes. ipt Developmental regulatory genes HaWOX5 Reporter genes GFP, resistance gene SpecN ; or, The exogenous genes include developmental regulatory genes. ipt Reporter genes RUBY Resistance genes SpecN .

9. The sunflower genetic transformation method as described in claim 1, characterized in that, The culture conditions for transplanting into soil-based substrate are as follows: After incubating in the dark at 20-24℃ for 45-50 hours, move to a greenhouse at 25-27℃ with humidity maintained at 65%~75% and 16 hours of light / 8 hours of darkness.

10. The application of the method according to any one of claims 1-9 in sunflower gene function verification, preparation of transgenic sunflowers, preparation of gene-edited sunflowers, preparation of sunflower gene function verification reagents, and preparation of reagents for manufacturing transgenic sunflowers or gene-edited sunflowers.

Images