Application of GmSTR1-promoting products in improving plant salt tolerance

Abstract

This invention belongs to the field of crop breeding and genetic engineering technology, and particularly relates to promoting GmSTR1 Application of the expressed products in improving the salt tolerance of plants. GmSTR1 Included in the soybean genome GmSTR1a and GmSTR1b Two homologous genes, GmSTR1a and GmSTR1b The nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. Promote GmSTR1 The expressed product is used for overexpression GmSTR1a or GmSTR1b Gene-based biological products. Experiments have shown that overexpression... GmSTR1a or GmSTR1b Both can improve the salt tolerance of soybeans. (Utilizing...) GmSTR1 Using the expressed products for soybean-assisted breeding is expected to cultivate new salt-tolerant soybean varieties adapted to saline-alkali land, which is of great value for expanding soybean planting area and utilizing saline-alkali land resources.

Description

Technical Field

[0001] The present invention belongs to the technical fields of crop breeding and genetic engineering, and particularly relates to the application of products that promote GmSTR1 expression in improving the salt tolerance of plants. Background Art

[0002] Soybean is an important food and oil crop, and its planting area is often limited by high-quality arable land resources. As the main type of marginal land, saline-alkali land can be used as a potential resource for expanding the soybean planting area after improvement. Exploring key salt-tolerant genes and enhancing the adaptability of soybeans under saline-alkali stress are important bases for utilizing marginal land and expanding the soybean production space.

[0003] Salt stress is one of the main abiotic stresses that limit plant growth and affects photosynthetic efficiency and water retention. During the long evolutionary process, plants have formed a complex and efficient salt tolerance system, and one of the important ways to regulate salt response is through the degradation of specific proteins. In this pathway, RING-type E3 ubiquitin ligases often play an important role. Their RING zinc finger domain can interact with ion transporters to regulate protein stability and hormone signals, thereby enhancing or weakening salt tolerance. In rice, OsRINGzf1 significantly enhances the tolerance of rice to salt and drought stress by ubiquitinating and degrading OsPIP2;1; Arabidopsis Rma1H1 enhances drought tolerance by degrading PIP2;1. However, the functional research of RING-type E3 ubiquitin ligases in soybeans is still very scarce. At the same time, the breeding of traditional salt-tolerant varieties mainly relies on conventional hybridization and phenotypic screening, which not only has a long cycle and low efficiency, but also often only focuses on tolerance indicators such as plant survival rate, and it is difficult to effectively maintain the soybean yield level under saline-alkali conditions while improving salt tolerance, and cannot meet the soybean production needs of marginal land. Therefore, discovering more key salt-tolerant genes and developing related biological products can provide effective targets and strategies for cultivating new salt-tolerant and high-yield soybean varieties. Summary of the Invention

[0004] To solve the above problems, the present invention provides the application of products that promote GmSTR1 [[ID=2…]]expression in improving the salt tolerance of plants. The present invention for the first time discovers that by regulating the expression of GmSTR1 genes, the salt tolerance of soybeans can be significantly increased, ensuring the normal growth of soybeans under saline-alkali conditions, thereby indirectly and effectively increasing the yield of soybeans planted on saline-alkali land, which is beneficial to expanding the soybean planting area.

[0005] To achieve the above object, the specific technical solutions of the present invention are as follows: The first aspect of the present invention provides the application of a product that promotes GmSTR1 expression in improving the salt tolerance of plants, and the GmSTR1 in the soybean genome includes GmSTR1aand GmSTR1b Two homologous genes, GmSTR1a Genes and GmSTR1b The amino acid similarity of the gene-encoded protein was 93.60%. GmSTR1a The nucleotide sequence of the gene is shown in SEQ ID NO.1. GmSTR1b The nucleotide sequence of the gene is shown in SEQ ID NO.2; the product is for overexpression. GmSTR1a or GmSTR1b Gene-based biological products; using said products to... GmSTR1a or GmSTR1b Genes are introduced into plants and overexpressed, thereby improving the plant's salt tolerance.

[0006] Furthermore, the article comprises any one of the following: a. Includes the above GmSTR1a Gene or GmSTR1b Recombinant gene expression vectors; b. Includes the above GmSTR1a Gene or GmSTR1b Recombinant microbial strains of genes.

[0007] Furthermore, the recombinant microbial strain is a strain containing the... GmSTR1a Gene or GmSTR1b The gene was obtained after the recombinant expression vector was transferred into Agrobacterium cells.

[0008] Furthermore, the Agrobacterium is Agrobacterium tumefaciens LBA4404.

[0009] Furthermore, the plant in question is a legume.

[0010] Furthermore, the legume in question is soybean.

[0011] Furthermore, the soybean variety is Williams 82.

[0012] A second aspect of the present invention provides a method for cultivating highly salt-tolerant transgenic soybeans, comprising the following steps: The product is introduced into the target soybean, so that... GmSTR1a or GmSTR1b The gene was overexpressed in the target soybean to obtain transgenic soybeans with improved salt tolerance compared to the target soybean.

[0013] Furthermore, the article comprises any one of the following: a. Includes the above GmSTR1a Gene or GmSTR1b Recombinant gene expression vectors; b. Includes the above GmSTR1a Gene or GmSTR1bRecombinant microbial strains of genes.

[0014] Furthermore, the article comprises the... GmSTR1a Gene or GmSTR1b Recombinant gene expression vectors.

[0015] Furthermore, the recombinant expression vector is composed of... GmSTR1a Gene or GmSTR1b The gene was obtained after being introduced into the pTF101 gene vector.

[0016] Furthermore, the method for preparing the recombinant expression vector includes the following steps: Soybean RNA was extracted, reverse transcribed into cDNA, and then amplified using the cDNA as a template. GmSTR1a Gene or GmSTR1b Gene; The vector pTF101 was digested using restriction endonucleases; Will GmSTR1a Gene or GmSTR1b The gene is ligated with the enzyme-digested vector to obtain a recombinant expression vector.

[0017] Furthermore, the vector pTF101 contains a CaMV 35S promoter or GmSTR1a Gene promoter or GmSTR1b Gene promoters.

[0018] Furthermore, the aforementioned GmSTR1a The nucleotide sequence of the gene promoter is shown in SEQ ID NO.7; GmSTR1b The nucleotide sequence of the gene promoter is shown in SEQ ID NO.8.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a way to promote GmSTR1 Application of the expressed products in improving the salt tolerance of plants. GmSTR1 Included in the soybean genome GmSTR1a and GmSTR1b Two homologous genes, GmSTR1a The nucleotide sequence is shown in SEQ ID NO.1. GmSTR1b The nucleotide sequence is shown in SEQ ID NO.2. GmSTR1 Gene expression products are used for overexpression. GmSTR1a Gene or GmSTR1b Gene-based biological products. Experiments in this invention have demonstrated that overexpression... GmSTR1a Gene or GmSTR1b All genes can significantly improve the salt tolerance of soybeans.

[0020] (1) Discovery of new soybean salt-tolerant gene resources: This invention discovers and functionally verifies new soybean salt-tolerant gene resources. GmSTR1 The salt tolerance of genes provides new target genes for molecular breeding of soybean salt tolerance and enriches the soybean salt tolerance gene resource library.

[0021] (2) Significantly enhances the salt tolerance of soybeans: Under salt stress conditions, overexpression GmSTR1a or GmSTR1b The survival rate, growth status and physiological indicators of the transgenic soybean plants were significantly better than those of the wild-type control, and they also showed stronger salt stress tolerance, effectively alleviating the damage of salt to soybean growth and development.

[0022] (3) It provides an effective technical approach for salt-tolerant soybean breeding: based on GmSTR1 Functional verification of the gene allows for the targeted improvement of soybean salt tolerance through transgenic breeding. The resulting highly salt-tolerant transgenic soybean material can be used as a core parent for subsequent hybridization breeding, potentially leading to the development of new salt-tolerant varieties adapted to saline-alkali land. This is of great value for expanding soybean planting area and developing and utilizing saline-alkali land resources.

[0023] (4) Mature technology and clear application prospects: This invention uses an Agrobacterium-mediated stable genetic transformation system for soybeans, which is technically mature, easy to operate, and suitable for large-scale promotion and application. GmSTR1 The application of genetic breeding has laid a solid technological foundation. The highly salt-tolerant transgenic soybean materials developed can be directly used for planting in saline-alkali land, which is of positive significance for improving the soybean production capacity in saline-alkali land and ensuring the security of soybean supply. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 for GmSTR1 Results of gene expression level determination in different tissues of soybean plants; Figure 1 In this context, A represents different tissues of the soybean plant. GmSTR1a Gene expression levels; Figure 1 In this context, B represents different tissues of the soybean plant. GmSTR1b Gene expression levels.

[0026] Figure 2 for GmSTR1 Spatiotemporal expression patterns of genes under salt stress. Figure 2 In the figure, A represents the leaf. GmSTR1a Genes and GmSTR1b The transcriptional level of genes changes dynamically. Figure 2 B in the root is GmSTR1a Genes and GmSTR1b Dynamic changes in gene transcription levels. Samples were taken after treatment with 150 mM NaCl at 0 h, 1 h, 2 h, 4 h, 24 h, and 48 h, and FPKM values ​​were determined by RNA-seq. Data are presented as mean ± standard error, n=5. Significance was assessed using Student's t-test, compared with the 0 h control; * indicates significance. p <0.05, ** indicates p <0.01.

[0027] Figure 3 for GmSTR1 In soybean lines with overexpressed genes GmSTR1 Results of relative gene expression level measurement. Figure 3 A in the text is GmSTR1a In soybean lines with overexpressed genes GmSTR1a Results of relative gene expression level measurement. Figure 3 B in the text is GmSTR1b In soybean lines with overexpressed genes GmSTR1b Results of relative gene expression level measurement; ** indicates p <0.01.

[0028] Figure 4 for GmSTR1 Phenotypic characteristics of soybean lines with overexpressed genes after 16 days of soil-cultured salt treatment. Figure 4 A in the text is GmSTR1a Phenotype of soybean lines with overexpressed genes; Figure 4 B in the text is GmSTR1b Phenotypic characteristics of soybean lines with overexpressed genes.

[0029] Figure 5 Wild-type soybean lines and GmSTR1a Growth phenotypes of soybean lines with overexpressed genes under normal conditions and 150 mM NaCl treatment; Figure 5 The top row of images shows the growth phenotypes of soybean lines in the untreated group; Figure 5 The bottom row of images shows the growth phenotypes of soybean lines treated with 150 mM NaCl; each line in the image shows two biological replicates, from left to right: two wild-type soybeans and two... GmSTR1a Soybean 35S gene overexpression STR1a-OE2 , 2 strains GmSTR1a Soybean 35S gene overexpression STR1a-OE5 , 2 strains GmSTR1a Gene overexpression soybeans pSTR1a-STR1a-OE1 , 2 strains GmSTR1a Gene overexpression soybeans pSTR1a-STR1a-OE2The scale is 10cm.

[0030] Figure 6 for GmSTR1a Statistics on the relative chlorophyll content, aboveground length, and aboveground fresh weight of soybean lines with overexpressed genes. Figure 6 A in the text is GmSTR1a Statistical chart of relative chlorophyll content SPAD values ​​in soybean lines with gene overexpression. Figure 6 B in the text is GmSTR1a Statistical chart of aboveground part length of soybean lines with overexpressed genes. Figure 6 C in the text is GmSTR1a Statistical chart of aboveground fresh weight of soybean lines with overexpressing gene. Data are presented as mean ± standard error, n=5. Significance was determined using Student's t-test; * indicates significance. p <0.05, ** indicates p <0.01.

[0031] Figure 7 Wild-type soybean lines and GmSTR1b Growth phenotypes of soybean lines with overexpressed genes under normal conditions and 150 mM NaCl treatment; Figure 7 The top row of images shows the growth phenotypes of soybean lines in the untreated group. Figure 7 The bottom row of images shows the growth phenotypes of soybean lines treated with 150 mM NaCl; each line in the image shows two biological replicates, from left to right: two wild-type soybeans and two... GmSTR1b Soybean 35S gene overexpression STR1b-OE3 , 2 strains GmSTR1b Soybean 35S gene overexpression STR1b-OE5 , 2 strains GmSTR1b Gene overexpression soybeans pSTR1a-STR1b-OE5 , 2 strains GmSTR1b Gene overexpression soybeans pSTR1a-STR1b-OE8 The scale is 10cm.

[0032] Figure 8 for GmSTR1b Statistics on the relative chlorophyll content, aboveground length, and aboveground fresh weight of soybean lines with overexpressed genes. Figure 8 A in the text is GmSTR1b Statistical chart of relative chlorophyll content SPAD values ​​in soybean lines with gene overexpression. Figure 8 B in the text is GmSTR1b Statistical chart of aboveground part length of soybean lines with overexpressed genes. Figure 8 C in the text is GmSTR1b Statistical chart of aboveground fresh weight of soybean lines with overexpressing gene. Data are presented as mean ± standard error, n=5. Significance was determined using Student's t-test; * indicates significance. p <0.05, ** indicates p<0.01. Detailed Implementation

[0033] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0034] In some embodiments of the present invention, the soybean variety used is Williams 82.

[0035] This invention constructs a genetically modified soybean using soybean transgenic technology. GmSTR1 Overexpression in soybean materials revealed that overexpression... GmSTR1 Genes can enhance the salt tolerance of soybeans. The main methods include: obtaining and amplifying the gene encoding the E3 ubiquitin ligase from soybean Williams 82 seeds. GmSTR1 Genes; constructing from GmSTR1 Recombinant expression vectors driven by their own promoters and CaMV 35S promoters; soybean transgenic technology that improves soybean quality by transferring the recombinant expression vectors into Agrobacterium and infecting soybean explants with Agrobacterium. GmSTR1a or GmSTR1b Gene expression levels, obtained GmSTR1 Overexpression of this substance in soybean lines enhances the salt tolerance of soybeans.

[0036] Example 1: GmSTR1 Determination of gene expression levels in different tissues of soybean plants Leaf, flower, stem, root, root nodule, and seed tissues from soybeans at the same growth stage were selected. Total RNA was extracted from each tissue and reverse transcribed into cDNA. Using cDNA as a template, quantitative real-time PCR was employed for detection. GmSTR1a and GmSTR1b Gene expression levels.

[0037] GmSTR1a The nucleotide sequence of the gene's CDS coding region is shown in SEQ ID NO.1. GmSTR1b The nucleotide sequence of the gene's CDS region is shown in SEQ ID NO.2.

[0038] SEQ ID NO.1: ATGGCCTTAGACCAGTATTTTGATGAGGCTGTGCCCCAGTTGGATTCCTTGGAAGATAAATCGTCTCTCGAAACATGGAAATGTGGCAGTGACGATATTGCAGATTCGGATAGAAATGCCTCTGGTGGCTTTGATTGCAACATATGCCTGGAGTGTGTGCAAGATCCAGTGGTCACTCTTTGTGGCCATCTCTACTGCTGGCCCTGTATTTACAAATGGCTTAATTTACAAACTGCCTCTTCTGAAAATGAAGAAGAGAAGCAACAATGTCCAGTCTGCAAATCAGAAATCTCACAGTCGTCCCTTGTTCCACTATACGGCCGCGGCCAAACCGTGTTACCATCTAAAGGCAAAGGCCACCAAGTAGGGGTTGTCATACCAAGAAGACCCCTTGGTCCTACACTTGATTCCGCAACTGTTTCCCCACCTATTTCTCACGTTTATCATCGCCATTATCCGAATCATCCTCAACAATTCAACTCAATTCCTGGCAGTTACACTTCAATGTTCAACACAGGTGGTTCACTAGCAAATGCTTTTGATACAACATATGGAGTCTTTGGTGAGATGATATATGCAAGGGTCTTTGGGAACCAGATGACTAACACATATACATACCCGAATTCTTATGATCTTTCAAGGAACAGTAATCCGAGGATCAGAAGGCATTTAATGCAAGTTGATAGATCACTCAATAGAATCACTTTTTTCCTCCTTTGTTGCATTGTTTTGTGCCTTCTCTTATTCTGA。

[0039] SEQ ID NO.2: .

[0040] Specific quantitative primers were designed based on the CDS coding region sequences of the two genes for quantification. GmSTR1a The nucleotide sequences of the upstream and downstream primers for gene expression level analysis are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and are used for quantification. GmSTR1b The nucleotide sequences of the upstream and downstream primers for gene expression level analysis are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. The expression levels of the two genes in different tissues were calculated by relative quantification using soybean internal reference gene normalization. Biological and technical replicates were set up in the experiment to ensure the reliability of the results.

[0041] SEQ ID NO.3: 5'-TCCTACACTTGATTCCGCAAC-3'; SEQ ID NO.4: 5'-TTGAACATTGAAGTGTAACTGCC-3'; SEQ ID NO.5: 5'-TTCTGTTACTGTTTCCCGACCT-3'; SEQ ID NO. 6: 5'-TGAACATTGAAGTGTAACTGCC-3'.

[0042] The results are as follows Figure 1 As shown, GmSTR1a Genes and GmSTR1b Both genes are tissue-specific expression genes, and their expression patterns differ. GmSTR1a The gene is expressed at the highest level in the root, followed by the stem, and at extremely low levels in the leaf, flower, root nodule and seed. GmSTR1b The gene was expressed at the highest level in the stem, followed by the leaves, and at the lowest level in the flower. Only low levels of expression were found in the roots, root nodules, and seeds.

[0043] Example 2: GmSTR1 Evaluation of spatiotemporal expression patterns of genes under salt stress Soybean plants with uniform growth stages were selected and subjected to salt stress treatment with 150 mM NaCl. Leaf and root tissues were collected at 0 h, 1 h, 2 h, 4 h, 24 h, and 48 h of treatment, with biological replicates established. Total RNA was extracted from each tissue, and transcriptome sequencing libraries were constructed and RNA-seq analysis was performed, quantifying the results using FPKM values. GmSTR1a Genes and GmSTR1b Gene transcriptional expression levels; 0h was used as a control.

[0044] The results are as follows Figure 2 As shown, under salt stress, GmSTR1a Genes and GmSTR1b The genes exhibited significant induced expression characteristics in both leaves and roots, with tissue-specific differences. In leaves, the expression levels of both genes showed a fluctuating upward trend with treatment time. GmSTR1b The overall gene expression pattern was initially elevated, then stabilized, and then decreased, with significant upregulation compared to the control at most time points; in the roots, GmSTR1a The gene response is more intense, and GmSTR1b The gene showed only a slight upregulation and remained at a low level of expression overall.

[0045] The above results indicate that GmSTR1a Genes and GmSTR1b All genes are involved in the soybean response to salt stress, among which GmSTR1aThe genes may act as key early response genes in the roots, while in the leaves they participate in salt stress response in different dynamic modes.

[0046] Example 3: Construction of soybean overexpression materials 1. Target gene amplification GmSTR1a The promoter sequence of the gene is shown in SEQ ID NO.7. GmSTR1b The promoter sequence of the gene is shown in SEQ ID NO.8.

[0047] SEQ ID NO.7:

[0048] SEQ ID NO.8:

[0049] Design specific amplifications respectively GmSTR1a Gene promoter fragments, GmSTR1a gene CDS coding region fragment, GmSTR1b Gene promoter fragments, GmSTR1b Primer set for gene CDS coding region fragment: amplification GmSTR1a The primers for the gene promoter fragment were GmSTR1a-Promoter-F and GmSTR1a-Promoter-R; amplification GmSTR1a The primers for the CDS coding region fragment of the gene are GmSTR1a-CDS-F and GmSTR1a-CDS-R; amplification GmSTR1b The primers for the gene promoter fragment were GmSTR1b-Promoter-F and GmSTR1b-Promoter-R; amplification GmSTR1b The primers for the CDS coding region fragment of the gene are GmSTR1b-CDS-F and GmSTR1b-CDS-R, and the specific primer sequence information is shown in Table 1.

[0050] Table 1 Primer Information Each 20 μL PCR amplification system contains: 1 μL template DNA, 1 μL each of forward and reverse primers, 10 μL of 2× high-fidelity DNA polymerase, and sterile ddH2O to make up the difference.

[0051] The amplification program was as follows: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 58℃ annealing for 2 min, 68℃ extension for 30 s, 35 cycles; 68℃ final extension for 5 min, and storage at 4℃.

[0052] 2. Construction of overexpression vectors and recombinant strains S1. Using the pTF101 vector as a backbone, restriction endonucleases were employed. Sac I and Sma I performed double enzyme digestion on the pTF101 vector to recover the linearized vector pTF101. Simultaneously, the amplified... GmSTR1a gene CDS coding region fragment and GmSTR1b The gene CDS coding region segment was transmitted through the same Sac I and Sma After double digestion with enzyme I, the recombinant vector was ligated into the linearized pTF101 vector. The ligation product was transformed into competent E. coli cells, and positive clones were screened and verified by sequencing to obtain constitutive promoter-driven recombinant vectors. p35s-STR1a and p35s-STR1b .Will p35s-STR1a and p35s-STR1b After being transfected into Agrobacterium LBA4404 competent cells, overexpression was obtained after screening and verification.GmSTR1a Recombinant Agrobacterium strains and overexpression of genes GmSTR1b Recombinant Agrobacterium strains.

[0053] S2, using restriction endonucleases Nco I and Sma I double-digested vector p35S- STR1a and p35s- STR1b Subsequently, the CaMV 35S promoter fragment on the vector was removed, and the linearized vector backbone lacking the promoter was recovered. The amplified vector was then used as the target vector. GmSTR1a Gene promoter fragments and GmSTR1b The gene promoter fragment is an insertion fragment, which is processed by... Nco I and Sma After double digestion with enzyme I, the enzymes were ligated to the linearized backbone described above. The ligation products were transformed into E. coli, positive clones were screened and sequenced for verification, and overexpression was obtained. GmSTR1a Recombinant gene expression vector pSTR1a-STR1a and overexpression GmSTR1b Recombinant gene expression vector pSTR1b- STR1b , pSTR1a-STR1a and pSTR1b-STR1b Gene expression is driven by the gene's own promoter. pSTR1a-STR1a and pSTR1b-STR1b After being transfected into Agrobacterium LBA4404 competent cells, overexpression was obtained after screening and verification. GmSTR1a Recombinant Agrobacterium strains and overexpression of genes GmSTR1b Recombinant Agrobacterium strains.

[0054] 3. Soybean genetic transformation and mutant screening Agrobacterium-mediated transformation of vector p35s- STR1a, pSTR1a-STR1a, p35s- STR1b and pSTR1b- STR1b Williams 82 soybean cotyledonary nodes were transformed separately, and regenerated plants were obtained through resistance selection, differentiation culture, and rooting culture. Genomic DNA was extracted from the leaves of the regenerated plants, and PCR detection and sequencing verification were performed using specific primers to screen for and obtain [the desired plants]. GmSTR1a Overexpression lines, GmSTR1b Overexpression strains.

[0055] Stable genetic transformation of soybean was achieved using Agrobacterium soybeani-mediated cotyledonary node transformation, which included seed surface disinfection and germination, preparation of Agrobacterium, preparation of explants, infection and co-culture, shoot induction, shoot elongation, and rooting cultivation.

[0056] (1) Disinfection and germination of seeds: Fresh Williams 82 soybean seeds harvested in the current year were used. Select plump, mature, healthy seeds without damage or spots. Disinfect with chlorine for 16 hours, remove the seeds and place them on a sterile workbench to blow off the residual chlorine for 30 minutes. Then, put the seeds into petri dishes and seal them for storage.

[0057] (2) Preparation of Agrobacterium: Select the single colony of recombinant Agrobacterium constructed in step 2, inoculate it into YEP liquid medium containing a final concentration of 50 mg / L kanamycin and 25 mg / L rifampicin, and culture at 28℃ and 250 rpm for 24 h with shaking. Then, transfer 0.6 mL of the obtained culture to 300 mL of YEP liquid medium containing a final concentration of 25 mg / L kanamycin and 12.5 mg / L rifampicin, and culture at 28℃ and 250 rpm for 8 h. Collect the cells and resuspend the cells in a liquid co-culture medium of the same volume to obtain the bacterial suspension.

[0058] The formulation of the liquid co-culture medium was as follows: B5 medium base salt 0.321 g / L, sucrose 30 g / L, 2-morpholine ethanesulfonic acid 3.9 g / L, water as solvent, pH 5.4, sterilized at 121℃ for 20 min, and after cooling, filtered sterile gibberellin, 6-benzyladenine, cysteine, dithiothreitol and acetylsylsyringone were added under aseptic conditions; the final concentrations of gibberellin, 6-benzyladenine, cysteine, dithiothreitol and acetylsylsyringone in the liquid co-culture medium were 0.25 mg / L, 1.67 mg / L, 400 mg / L, 154.2 mg / L and 200 μmol / L, respectively.

[0059] (3) Preparation of explants: Select soybean seeds that have been swollen and uncontaminated in step (1) and place them in a sterile culture dish. Cut the seeds longitudinally along the hilum with a scalpel, separate the cotyledons and hypocotyl into two halves, and make four wounds at the cotyledon nodes. After removing the seed coat, use them as explants for later use.

[0060] (4) Infection and co-culture: Pour 50 mL of the bacterial suspension obtained in step (2) into a clean, sterile disposable culture dish, place 50 explants prepared in step (3) into the dish, and infect at room temperature for 30 min, stirring the bacterial suspension during this period to ensure that the explants are in full contact with the fresh bacterial suspension. Add 30 mL of liquid co-culture medium to a sterile stainless steel square box lined with two layers of filter paper. Remove the infected explants and shake off the Agrobacterium bacterial suspension on the explants, then lay them flat on the filter paper with the adaxial side facing up. After sealing the stainless steel square box, place it in a plant culture room and co-culture in the dark at 24°C for 4 days.

[0061] (5) Induction of shoot clusters: After co-culture, the elongated hypocotyl of the explant was cut off, leaving 0.5 cm, which was inserted at a 37° angle on the shoot induction medium and transferred to the plant culture room for 4 weeks. Fresh shoot induction medium was replaced every two weeks.

[0062] The formula for the bud induction medium was as follows: B5 medium base salt 0.321 g / L, sucrose 30 g / L, 2-morpholine ethanesulfonic acid 3.9 g / L, agar 8 g / L, water as solvent, pH 5.7, sterilized at 121℃ for 20 min; when cooled to 50℃, filtered sterile 6-benzyladenine, ticarcillin, cefadroxil and glufosinate were added; the final concentrations of 6-benzyladenine, ticarcillin, cefadroxil and glufosinate in the bud induction medium were 1.67 mg / L, 250 mg / L, 100 mg / L and 5 mg / L, respectively.

[0063] (6) Bud elongation: After 4 weeks of induction of buds in step (5), the cotyledons are removed and transferred to the bud elongation medium. The medium is then placed in the plant culture room and replaced with fresh bud elongation medium every 2 weeks.

[0064] The formula for the shoot elongation medium was as follows: MS medium 4.43 g / L, sucrose 30 g / L, 2-morpholine ethanesulfonic acid 0.59 g / L, agar 8 g / L, water as solvent, pH 5.7, sterilized at 121℃ for 20 min; when cooled to 50℃, filtered asparagine, glutamine, indoleacetic acid, zeatin, gibberellin, ticarcillin and cephalosporin were added; the final concentrations of asparagine, glutamine, indoleacetic acid, zeatin, gibberellin, ticarcillin and cephalosporin in the shoot elongation medium were 50 mg / L, 50 mg / L, 0.1 mg / L, 1 mg / L, 0.5 mg / L, 250 mg / L and 100 mg / L, respectively.

[0065] (7) Rooting cultivation: Cut off the young stems that have grown to 3 cm in the bud elongation medium, dip them in indolebutyric acid for 30 seconds and then insert them into the rooting medium. Place them in the plant culture room and cultivate them until roots grow. Then, take the rooted seedlings out of the medium, wash off the residual medium from the roots, transfer them into the soil and move them to the greenhouse for cultivation. These are the resistant transgenic soybean plants.

[0066] The rooting medium formula is: MS medium 4.43 g / L, sucrose 20 g / L, 2-morpholinoethanesulfonic acid 0.59 g / L, plant gel 4 g / L, and water as the solvent.

[0067] (8) Identification of overexpression materials: 50 mg of leaves from resistant transgenic soybean plants and normal soybean plants were collected, and RNA was extracted using the TRIzol method. cDNA was obtained by reverse transcription. Quantitative reverse transcription polymerase chain reaction was performed using the primer set shown in SEQ ID NO.3~SEQ ID NO.6 to determine the expression level.GmSTR1a and GmSTR1b The amount of expression, obtaining overexpression GmSTR1a and GmSTR1b Soybean plants: overexpression GmSTR1a The soybean plants are 35s- STR1a-OE2 35s- STR1a- OE5 , pSTR1a-STR1a-OE1 , pSTR1a-STR1a-OE2 overexpression GmSTR1b The soybean plants are 35s- STR1b-OE3 35s- STR1b-OE5 , pSTR1b-STR1b-OE5 , pSTR1b-STR1b-OE8 The present invention will contain p35s-STR1a overexpression GmSTR1a The genetically modified soybean plant OE-2 is denoted as 35s-STR1a-OE2 ,contain p35s-STR1a overexpression GmSTR1a The genetically modified soybean plant OE-5 is denoted as 35s-STR1a-OE5 ,contain pSTR1a-STR1a overexpression GmSTR1a The genetically modified soybean plant OE-1 is denoted as pSTR1a-STR1a-OE1 ,contain pSTR1a-STR1a overexpression GmSTR1a The genetically modified soybean plant OE-2 is denoted as pSTR1a-STR1a-OE2 ; containing p35s-STR1b overexpression GmSTR1b The genetically modified soybean plant OE-3 is denoted as 35s- STR1b-OE3 , containing p35s-STR1b overexpression GmSTR1b The genetically modified soybean plant OE-5 is denoted as 35s-STR1b-OE5 , containing pSTR1b-STR1b overexpression GmSTR1b The genetically modified soybean plant OE-5 is denoted as pSTR1b-STR1b-OE5 , containing pSTR1b-STR1b overexpression GmSTR1b The genetically modified soybean plant OE-8 is denoted as pSTR1b-STR1b-OE8 .

[0068] The results are as follows Figure 3 As shown, compared to the WT wild type, the constructed GmSTR1a and GmSTR1b In overexpression lines, GmSTR1a and GmSTR1b The relative expression levels of the genes were significantly upregulated, indicating that overexpression was successfully achieved. GmSTR1 Positive soybean strains.

[0069] Example 4: GmSTR1 Determination of agronomic traits in overexpressed plants The stable overexpression material screened in Example 3 was used for subsequent experiments. Wild-type soybean Williams 82 was used as a control, and the expression was carried out using soil cultivation. GmSTR1a Overexpression soybean lines, GmSTR1b Overexpressing soybean lines and wild-type soybeans were subjected to salt stress treatment.

[0070] To further validate the results, the overexpression lines and control materials were cultured in half Hoagland's nutrient solution. Seeds were first germinated on filter paper, then transferred to normal nutrient solution for one week of growth. The treatment group was then subjected to 150 mM NaCl stress for 5 days, followed by normal culture for 3 days, and the phenotype was observed.

[0071] Figures 4 to 8 The results show that under normal conditions GmSTR1a Overexpression lines, GmSTR1b There was no significant difference between the overexpression lines and the wild type; after salt treatment, the growth of all plants was inhibited, but... GmSTR1a and GmSTR1b The overexpression lines showed significantly better growth than the wild type. Salt-stressed plants were stunted and had yellowing leaves, while... GmSTR1a and GmSTR1b The chlorophyll content, aboveground part length, and fresh weight of the strain were significantly higher than those of the wild type. These results indicate that overexpression... GmSTR1a or GmSTR1b Both can significantly enhance the salt tolerance of soybeans.

[0072] The above identification results indicate that the invention created... GmSTR1 Overexpression of the material improved salt tolerance, meeting the industrialization needs of high-quality soybeans.

[0073] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Promote GmSTR1 The application of the expressed product in improving plant salt tolerance is characterized by, The GmSTR1 Included in the soybean genome GmSTR1a and GmSTR1b Two homologous genes, GmSTR1a The nucleotide sequence of the gene is shown in SEQ ID NO.

1. GmSTR1b The nucleotide sequence of the gene is shown in SEQ ID NO.2; the product is for overexpression. GmSTR1a or GmSTR1b Gene-based biological products; using said products to... GmSTR1a or GmSTR1b Genes are introduced into plants and overexpressed, thereby improving the plant's salt tolerance.

2. The promoting method according to claim 1 GmSTR1 The application of the expressed product in improving plant salt tolerance is characterized by, The article includes any one of the following: a. Includes the above GmSTR1a Gene or GmSTR1b Recombinant gene expression vectors; b. Includes the above GmSTR1a Gene or GmSTR1b Recombinant microbial strains of genes.

3. The promoting method according to claim 2 GmSTR1 The application of the expressed product in improving plant salt tolerance is characterized by, The recombinant microbial strain is one containing the above... GmSTR1a Gene or GmSTR1b The gene was obtained after the recombinant expression vector was transferred into Agrobacterium cells.

4. The promoting method according to claim 1 GmSTR1 The application of the expressed product in improving plant salt tolerance is characterized by, The plant in question is a legume.

5. The promoting method according to claim 4 GmSTR1 The application of the expressed product in improving plant salt tolerance is characterized by, The legume in question is soybean.

6. A method for cultivating highly salt-tolerant transgenic soybeans, characterized in that, Includes the following steps: The product of claim 1 is introduced into the target soybean, so that... GmSTR1a or GmSTR1b The gene was overexpressed in the target soybean to obtain transgenic soybeans with improved salt tolerance compared to the target soybean.

7. The method for cultivating highly salt-tolerant transgenic soybeans according to claim 6, characterized in that, The article includes any one of the following: a. Includes the above GmSTR1a Gene or GmSTR1b Recombinant gene expression vectors; b. Includes the above GmSTR1a Gene or GmSTR1b Recombinant microbial strains of genes.

8. The method for cultivating highly salt-tolerant transgenic soybeans according to claim 7, characterized in that, The product comprises the above. GmSTR1a Gene or GmSTR1b Recombinant gene expression vectors.

9. The method for cultivating highly salt-tolerant transgenic soybeans according to claim 8, characterized in that, The recombinant expression vector is composed of GmSTR1a Gene or GmSTR1b The gene was obtained after being introduced into the pTF101 gene vector.

Images