Use of a gs12-7max nuclease in targeted genome editing in fish

Abstract

The application discloses application of Gs12-7MAX nuclease in fish genome targeted editing and belongs to the technical field of genetic engineering and aquatic breeding. The known CRISPR / Gs12-7MAX gene editing system is applied to fish embryos for the first time, a guide RNA is designed according to a target DNA sequence in a target fish genome, a ribonucleoprotein complex is assembled after the guide RNA is assembled with a Gs12-7MAX protein, and the ribonucleoprotein complex is delivered into a one-cell stage embryo of the fish, so that targeted editing of the fish genome is realized. The known editing system exhibits extremely high editing efficiency and excellent specificity in a low-temperature environment of the fish embryo, and the comprehensive editing performance is significantly better than that of a traditional SpCas9 system in a comparison experiment. The application can be used for creating gene edited fish with genetically improved target traits, and provides a safe, independent and efficient new tool platform for fish gene function analysis and aquatic precise breeding.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and biotechnology, specifically to the application of a Gs12-7MAX nuclease in targeted editing of the fish genome. Background Technology

[0002] Aquaculture is an important part of my country's agricultural industry system. Fish genetic improvement is the core way to improve aquaculture efficiency and industrial competitiveness. Gene editing technology, especially the CRISPR system, has become a key tool for functional genome analysis and precision breeding. However, the core intellectual property rights of the CRISPR / Cas9 system, which is currently widely used in fish research, seriously restrict the independent innovation and industrialization process of precision breeding in my country's aquaculture.

[0003] Specifically, existing Cas9-based fish gene editing technologies have certain limitations: First, their target range is limited to the "NGG" PAM sequence, which restricts the selection of editable sites; second, the Cas9 protein has a large molecular weight, which affects its delivery efficiency and stability; in addition, commonly used plasmid delivery methods also have the risk of foreign gene integration residues.

[0004] To overcome the aforementioned technical bottlenecks, the inventors of this application previously developed a novel CRISPR / Gs12-7MAX gene editing system and obtained Chinese invention patent authorization (authorization announcement number: CN 118979028 B). This patent discloses a variant of the Gs12-7MAX endonuclease protein and its mediated gene editing system. This prior patent only verified the system's general gene editing capability at the mammalian cell level, and did not disclose or imply whether it is applicable to poikilothermic vertebrates (such as fish), nor did it provide a specific method for achieving efficient editing in the special environment of fish embryos.

[0005] In fact, applying a gene-editing tool validated in mammalian cells to fish faces numerous uncertainties and technical hurdles. For example, the in vitro development and microinjection procedures for fish embryos are drastically different from those for mammalian cell culture; more importantly, the culture temperature of fish embryos (e.g., 28°C for zebrafish and around 25°C for commercially important fish like grass carp) is much lower than the 37°C required for mammalian embryos. Since the activity of CRISPR nucleases is typically temperature-dependent, those skilled in the art cannot predict whether the Gs12-7MAX protein will maintain high cleavage activity at low temperatures. Furthermore, the complex genomic background of bony fishes (e.g., multiple rounds of whole-genome duplication) also places higher demands on the specificity of the editing.

[0006] Therefore, exploring and establishing an efficient and universal targeted editing method for the CRISPR / Gs12-7MAX system in fish is of great significance for promoting fish gene function research and the industrialization of precision breeding. Summary of the Invention

[0007] (a) Technical problems to be solved

[0008] To address the shortcomings of existing technologies, this invention provides an application of the Gs12-7MAX nuclease in targeted editing of the fish genome, aiming to solve problems such as limited tools, restricted editing efficiency and specificity, and narrow species applicability in existing fish gene editing technologies.

[0009] (II) Technical Solution

[0010] To achieve the above objectives, this invention applies the Gs12-7MAX system to fish embryos for the first time. By optimizing sgRNA design, RNP complex assembly, and delivery parameters, a method for achieving efficient, stable, and low-toxicity gene editing in fish was established. Unexpectedly, we found that the Gs12-7MAX system not only maintained extremely high editing activity in the low-temperature environment of fish embryos, but its overall editing efficiency and specificity were even superior to the currently widely used SpCas9 system. In addition, this method successfully created gene-edited fish with stable heritability and no intermuscular spines, demonstrating great potential for industrial application.

[0011] The technical solution provided by this invention is as follows:

[0012] A fish genome targeted editing method based on the CRISPR / Gs12-7MAX system includes the following steps:

[0013] (1) Design and synthesize single-stranded guide RNA (sgRNA) for the target DNA region containing the NTTV PAM sequence in the genome of the target fish.

[0014] (2) The sgRNA and Gs12-7MAX protein were mixed in vitro and assembled into a ribonucleoprotein complex (RNP).

[0015] (3) The RNP complex was delivered into a one-cell stage fish embryo by microinjection;

[0016] (4) After the injected embryos are cultured, and after they develop, individual fish whose genomes have been successfully edited are screened by genome extraction and sequencing analysis.

[0017] Furthermore, after optimization, the final concentration of Gs12-7MAX protein in the RNP complex is 500 ng / μL, and the final concentration of sgRNA is 90 ng / μL. This concentration combination can achieve extremely high editing efficiency while maintaining excellent embryo survival rate, thus achieving the best balance between editing efficiency and biosafety.

[0018] The preferred fish species are cyprinids, including but not limited to zebrafish (a model animal), as well as silver carp and grass carp, which have significant economic value.

[0019] In the above method, we demonstrated for the first time that the editing efficiency of Gs12-7MAX nuclease in the embryonic environment of fish (such as zebrafish) can reach 100%, and the types of mutations induced are extremely rich. By comparing it with the SpCas9 system at the same target sites, we were surprised to find that the average individual editing efficiency of Gs12-7MAX at most target sites was significantly higher than that of SpCas9. In particular, under low temperature culture conditions, the system showed a highly efficient and stable editing capability that could not have been expected by those skilled in the art based on the teachings of prior patents.

[0020] The present invention also provides fish with targeted genome editing prepared by the above method. In one specific embodiment, by targeting and knocking out the runx2b gene, a homozygous mutant strain of zebrafish with completely absent intermuscular spines that can be stably inherited was successfully obtained. This has also been efficiently verified in economically important fish species such as blunt snout bream and grass carp.

[0021] The aforementioned gene editing methods or fish models can be widely applied to the construction of fish gene function research models, the genetic improvement of economic traits of aquatic animals (such as the number of intermuscular spines, growth rate, etc.), and the cultivation of new aquatic varieties or core breeding materials with specific superior traits.

[0022] (III) Beneficial Effects

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] (1) High editing efficiency and rich genotypes: The Gs12-7MAX system has shown superior editing activity to the traditional SpCas9 system in the fish involved in this invention. It can effectively induce mutations at the target site and generate a variety of genotypes, providing rich materials for functional studies and trait screening.

[0025] (2) Simple operation and low toxicity: The delivery method uses pre-assembled ribonucleoprotein complexes, which avoids cumbersome steps such as plasmid construction and shortens the experimental cycle. At the same time, this method has no risk of exogenous DNA integration, which is in line with the development trend of "traceless" editing. Moreover, it has not shown dose-dependent acute embryotoxicity within the experimental concentration range.

[0026] (3) Precise targeting and high specificity: By utilizing the highly specific Gs12-7MAX endonuclease and optimizing the design and delivery strategy of sgRNA, the specificity of gene editing is ensured and the off-target effect is low.

[0027] (4) Wide applicability to species: It has been successfully verified to be effective in zebrafish (model fish) and blunt snout bream and grass carp (important economic fish), proving that the technical solution has potential universality of application in different cyprinid fish and even a wider range of aquatic organisms;

[0028] (5) Great potential for industrial application: This invention has successfully created a fish model with a clear improved phenotype, providing a practical technical path and valuable germplasm resources for the upgrading of aquaculture varieties, and has good prospects for industrial application. Attached Figure Description

[0029] Figure 1 Survival rate and editing efficiency of zebrafish embryos injected with different concentrations of Gs12-7MAX RNP complex;

[0030] Figure 2 To demonstrate the gene-editing activity of Gs12-7MAX in zebrafish;

[0031] Among them, A. Sequence mutation analysis map of target 1 and target 2 of the runx2b gene; B. Agarose gel electrophoresis verification results of the corresponding edited individuals;

[0032] Figure 3 The average individual editing efficiency of Gs12-7MAX and SpCas9 at four target sites;

[0033] Where ***P<0.001 indicates an extremely significant difference; **P<0.01 indicates a significant difference;

[0034] Figure 4 The frequency distribution of insertion / deletion mutation types generated by Gs12-7MAX in zebrafish;

[0035] Figure 5 A schematic diagram of the phenotype of zebrafish after Gs12-7MAX knockout of the runx2b gene;

[0036] Among them, A. Alizarin red skeletal staining results of wild-type zebrafish; B. Alizarin red skeletal staining results of homozygous zebrafish;

[0037] Figure 6 To demonstrate the gene editing activity of Gs12-7MAX in blunt snout bream;

[0038] Among them, A. Sequence mutation analysis map of the runx2b gene target; B. Agarose gel electrophoresis verification results of the corresponding edited individuals;

[0039] Figure 7 To demonstrate the gene-editing activity of Gs12-7MAX in grass carp;

[0040] Among them, A. Sequence mutation analysis map of the runx2b gene target; B. Agarose gel electrophoresis verification results of the corresponding edited individuals. Detailed Implementation

[0041] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0042] Example 1: Screening for the optimal delivery concentration of Gs12-7MAX ribonucleoprotein complex in zebrafish

[0043] This embodiment optimized the delivery concentration of the Gs12-7MAX ribonucleoprotein complex in zebrafish embryos. Zebrafish runx2b gene target site 1 (sequence same as runx2b-1 in Example 2 below) was selected. Purified Gs12-7MAX protein was mixed with in vitro transcribed sgRNA at a molar ratio of 1:2 to form the RNP complex. Five concentration gradients were set (see Table 1), and each concentration of the RNP complex was microinjected into zebrafish one-cell stage embryos (approximately 100 embryos per gradient), and cultured in a 28°C incubator. Embryo viability was assessed 24 h post-injection. Genomic DNA was extracted from 32 randomly selected viable embryos from each group at 48 h, and editing efficiency was calculated using target PCR amplification and Sanger sequencing.

[0044] Table 1. Injection concentration gradient of Gs12-7MAX RNP complex

[0045]

[0046] The results are as follows Figure 1As shown, the 24-hour survival rates at all concentrations were between 92% and 94% (the survival rate for WT was approximately 98%), with no significant differences between groups, indicating that the Gs12-7MAX RNP complex did not exhibit dose-dependent acute embryotoxicity within the experimental concentration range. Editing efficiency showed a clear dose-dependent increasing trend with increasing protein concentration, with the editing efficiency reaching over 85% at concentrations of 500 ng / μL and above. Considering editing efficiency, embryo survival rate, and economic cost, the concentration combination of 500 ng / μL Gs12-7MAX protein + 90 ng / μL sgRNA achieved high editing efficiency while maintaining good embryo survival rate. Therefore, this concentration was determined as the optimal working concentration for the Gs12-7MAX system in zebrafish.

[0047] Example 2: Evaluation of the genome editing activity of Gs12-7MAX endonuclease in zebrafish

[0048] This embodiment evaluates the genome editing activity of the endonuclease Gs12-7MAX in zebrafish. A mixture of Gs12-7MAX protein and sgRNA was microinjected into one-cell stage zebrafish embryos. The sgRNA, paired with the target site, guides the Gs12-7MAX nuclease to recognize and bind to the target gene, thereby activating genome cleavage activity. Embryos were collected 48 h after injection, and genomic DNA was extracted, followed by agarose gel electrophoresis and Sanger sequencing. The number of mutant individuals was counted, and the editing activity at the target site was analyzed.

[0049] In this embodiment, the target gene selected is the zebrafish runx2b gene, and the PAM recognized by sgRNA is NTTV. The corresponding sequence is shown in Table 2, and the underlined region is the target pairing region.

[0050] Table 2. Names and corresponding sequences of sgRNAs

[0051]

[0052] The activity of Gs12-7MAX endonuclease in zebrafish was detected by RNP delivery. Male and female zebrafish were paired 1:1 the night before injection and separated by a septum. The septum was removed 30 minutes before injection, and spawning occurred naturally before microinjection. A Gs12-7MAX RNP complex was formed by mixing 500 ng / μL of Gs12-7MAX protein and 90 ng / μL of sgRNA, and then mixed with nuclease-free water to prepare the injection sample. The sample was injected into one-cell stage zebrafish embryos using a PLI-100A zebrafish microinjector (Warner, USA). After injection, the zebrafish embryos were cultured in embryo culture medium at 28°C for 48 h. Genomic DNA was then randomly extracted from 16 zebrafish embryos using a rapid lysis method. PCR amplification was performed on the target site, and band changes were observed by agarose gel electrophoresis. At the same time, Sanger sequencing was used to observe changes in the peak pattern near the target site to determine the genome editing activity of Gs12-7MAX endonuclease in zebrafish.

[0053] The results are as follows Figure 2 As shown, both sgRNAs induced sequence mutations near the PAM site, and the sequencing peaks showed disordered peaks near the target site. Furthermore, statistical analysis of the number of mutant individuals revealed that the Gs12-7MAX nuclease exhibited high editing activity in zebrafish, with editing efficiency of 100% at both target sites.

[0054] Example 3: Comparison of editing efficiency between Gs12-7MAX and SpCas9 at the same target site in zebrafish

[0055] This embodiment compared the editing efficiency of Gs12-7MAX and the existing SpCas9 system at the same target site in zebrafish. Four different target sites of the zebrafish runx2b gene were selected, and the specific sgRNA sequences are shown in Table 3. The underlined regions are the target pairing regions. All targets simultaneously satisfy the NGG PAM of SpCas9 and the NTTV PAM of Gs12-7MAX to ensure that both systems can target the same DNA region. For each target site, corresponding SpCas9 sgRNA and Gs12-7MAX crRNA were designed. The same concentration of RNP complex from both systems was microinjected into zebrafish one-cell stage embryos (approximately 100 embryos per target site per system), and cultured at 28°C for 48 h after injection. Genomic DNA was extracted from 32 embryos randomly collected from each group, and the population mutation rate was calculated by target PCR amplification and Sanger sequencing. At the same time, 8 embryos from each group were used for amplicon deep sequencing to calculate the average editing efficiency per individual.

[0056] Table 3. Names and corresponding sequences of sgRNAs

[0057]

[0058] The results are shown in Table 4 and Figure 3 As shown in the figure, Gs12-7MAX demonstrated superior or equivalent editing efficiency to SpCas9 at three of the four target sites (target sites 1, 3, and 4). Statistical analysis showed that the average individual editing efficiency of Gs12-7MAX at target sites 1 and 4 was significantly higher than that of SpCas9, and only slightly lower at target site 2. Combining the two sets of data, the overall editing efficiency of the Gs12-7MAX system in zebrafish is comparable to or even better than that of SpCas9. Furthermore, due to its ability to recognize NTTV PAM, it can target AT-rich regions that SpCas9 cannot edit, thus having a wider range of applications.

[0059] Table 4. Population mutation rates of Gs12-7MAX and SpCas9 at the same target site in zebrafish.

[0060]

[0061] Example 4: Analysis of insertion / deletion mutation profiles induced by the CRISPR / Gs12-7MAX system at target sites in zebrafish

[0062] In this embodiment, F0 generation zebrafish individuals with Gs12-7MAX edited mutations were testcrossed with WT to generate F1 generation. The distribution characteristics of indels after targeted cleavage of Gs12-7MAX at the target site were detected. The target site selected in this embodiment was runx2b-1 from Example 2. Target site amplification was performed on the F1 generation generated from the testcross, and the distribution and size characteristics of indels were analyzed by Sanger sequencing.

[0063] Statistical analysis of sequencing results from all target sites in the F1 generation revealed a diverse range of insertion / deletion mutation types generated by the CRISPR / Gs12-7MAX system in zebrafish. Approximately 64% of edited individuals exhibited both deletion and insertion mutations (102 / 159), about 34% showed only small deletions (54 / 159), and only about 2% of edited sites showed small insertions (3 / 159) (see Table 5). Further analysis indicated that the mutations resulting from this system were primarily characterized by deletions within 20 bp accompanied by insertions within 30 bp, with simple deletions not exceeding 25 bp also occurring, while simple insertions within 15 bp were relatively rare (see Table 5). Figure 4 Therefore, the CRISPR / Gs12-7MAX system can induce a highly diverse range of mutation types.

[0064] Table 5. Types of insertion / deletion mutations generated by Gs12-7MAX in zebrafish

[0065]

[0066] Example 5: Phenotypic analysis of zebrafish runx2b gene knockout using the CRISPR / Gs12-7MAX system

[0067] This embodiment uses Alizarin Red whole-skeleton staining (adult fish) to observe the staining of wild-type and Gs12-7MAX edited homozygous mutant zebrafish. After fixation in 4% paraformaldehyde for 48 h, the fish were rinsed overnight with ddH2O; subsequently, they were bleached in a mixture of 3% H2O2 and 1% KOH (volume ratio = 1:20) for 4 h; rinsed with ddH2O for 30 min; treated in saturated sodium tetraborate solution for 12 h; rinsed with ddH2O for 30 min; stained in a mixture of 1% Alizarin Red S (Sigma) and 1% KOH for 24 h; rinsed with ddH2O for 24 h; rinsed in a mixture of 1% trypsin (Solarbio) and 2% saturated sodium tetraborate for 24 h to remove impurities; cleared in a gradient of 25%, 50%, and 100% glycerol, stored, and then the intramuscular spine phenotype of the zebrafish was observed and photographed.

[0068] The results are as follows Figure 5 As shown, wild-type zebrafish have a significant number of intermuscular spines on their back and tail. Figure 5 A), the total number of intermuscular spines on one side is approximately 43-45; in homozygous mutant zebrafish, all intermuscular spines are absent. Figure 5 (B) but intramuscular spine imprints are present. This indicates that editing the zebrafish runx2b gene using the CRISPR / Gs12-7MAX system can successfully breed individuals with a non-intramuscular spine phenotype, and this phenotype can be stably inherited.

[0069] Example 6: Evaluation of gene editing activity of Gs12-7MAX endonuclease in blunt snout bream and grass carp

[0070] This embodiment further evaluated the gene editing activity of the endonuclease Gs12-7MAX in the economically important fish species *Brucea shingrass* and *Caulis Grass Carp*. The RNP complex of Gs12-7MAX protein and sgRNA was microinjected into one-cell stage embryos of *Brucea shingrass* and *Caulis Grass Carp*. The sgRNA, paired with the target site, guided the Gs12-7MAX nuclease to recognize and bind to the target gene, thereby activating genome cleavage activity. Embryos were collected 48 h post-injection, and genomic DNA was extracted, followed by agarose gel electrophoresis and Sanger sequencing. The number of mutant individuals was counted, and the editing activity at the target site was analyzed.

[0071] In this embodiment, the target genes selected are the runx2b genes of bluntnose bream and grass carp. The PAM recognized by the sgRNA is NTTV, and the corresponding sgRNA sequence for bluntnose bream is UAUUUCUACUAUUGUAGAU. CAGUCCCAGAAUGCACUACCCGG The corresponding sgRNA sequence for grass carp is UAAUUUCUACUAUUGUAGAU CGUUGGCACAGUAACCCGCAUGG The underlined area is the targeted pairing area.

[0072] The activity of the Gs12-7MAX endonuclease in blunt snout bream and grass carp was detected by RNP delivery. Male and female blunt snout bream and grass carp were injected with oxytocin before microinjection, followed by artificial insemination and microinjection. A Gs12-7MAX RNP complex was formed by mixing 1000 ng / μL Gs12-7MAX protein and 180 ng / μL sgRNA, and then mixed with nuclease-free water to form the injection sample. This sample was injected into one-cell stage embryos of both blunt snout bream and grass carp. After incubation at 25°C for 48 h, genomic DNA was randomly extracted from 16 embryos using a rapid lysis method. PCR amplification was performed on the target sites, and band changes were observed by agarose gel electrophoresis. Simultaneously, Sanger sequencing was used to observe changes in the peak patterns near the target sites to determine the genome editing activity of the Gs12-7MAX endonuclease in blunt snout bream and grass carp.

[0073] The results are as follows Figure 6 and Figure 7 As shown, the Gs12-7MAX endonuclease exhibited high editing activity in both blunt snout bream and grass carp, with editing efficiencies reaching 100% and 78.57%, respectively. This indicates that the system possesses efficient genome editing capabilities in different fish species.

[0074] It should be stated that the Gs12-7MAX protein used in this invention is a known prior art, and its amino acid sequence and core mutations have been fully disclosed in the applicant's prior authorized patent CN 118979028 B. Therefore, this specification does not provide a separate sequence listing for its sequence to ensure sufficient disclosure. The core of this invention lies in the first discovery and verification of a novel use of this known protein in the specific biological group of fish, and the corresponding optimized editing method adapted to the fish embryonic environment.

[0075] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. Use of a Gs12-7MAX nuclease in targeted genome editing in fish, characterized in that, The embryo incubation temperature for the targeted genome editing of fish is 25-28℃, and the targeted genome editing includes the following steps: (1) A guide RNA is designed for the target DNA sequence in the genome of the target fish, and the guide RNA can guide the Gs12-7MAX protein to specifically recognize and cut the target DNA sequence; (2) The guide RNA and Gs12-7MAX protein were co-delivered into a one-cell stage fish embryo; (3) The early embryos of the fish are cultured to obtain individual fish with edited genomes.

2. The application of the Gs12-7MAX nuclease according to claim 1 in targeted editing of the fish genome, characterized in that, The guide RNA is a single-stranded guide RNA, specifically sgRNA.

3. The application of a Gs12-7MAX nuclease according to claim 1 or 2 in targeted editing of the fish genome, characterized in that, The target DNA sequence contains the PAM sequence of NTTV, where N is any base and V is A, C, or G.

4. The application of a Gs12-7MAX nuclease according to claim 1 or 2 in targeted editing of the fish genome, characterized in that, The guide RNA is obtained through in vitro transcription or chemical synthesis, and after being mixed with Gs12-7MAX protein in vitro to form a ribonucleoprotein complex, it is delivered to the one-cell stage embryo of the fish via microinjection.

5. The application of the Gs12-7MAX nuclease according to claim 4 in targeted editing of the fish genome, characterized in that, In the ribonucleoprotein complex, the final concentration of Gs12-7MAX protein is 500-1000 ng / μL, and the final concentration of sgRNA is 90-180 ng / μL.

6. The application of the Gs12-7MAX nuclease according to claim 1 in targeted editing of the fish genome, characterized in that, The target DNA sequence is located on an endogenous gene that can affect fish traits.

7. The application of the Gs12-7MAX nuclease according to claim 6 in targeted editing of the fish genome, characterized in that, The genome-targeted editing causes the endogenous gene to lose or change its function, thereby causing the fish to exhibit the trait of being without intermuscular spines.

8. The application of the Gs12-7MAX nuclease according to claim 4 in targeted editing of the fish genome, characterized in that, In the ribonucleoprotein complex, the final concentration of Gs12-7MAX protein was 500 ng / μL, and the final concentration of sgRNA was 90 ng / μL.

9. The application of the Gs12-7MAX nuclease according to claim 1 in targeted editing of the fish genome, characterized in that, The fish species mentioned are zebrafish, blunt snout bream, or grass carp.

10. The application of the Gs12-7MAX nuclease according to claim 1 in targeted editing of the fish genome, characterized in that, The embryos for targeted editing of the fish genome are incubated at 25°C or 28°C.

Images