Methods and applications for constructing immortalized megakaryocyte progenitor cell line hiPSCs based on CRISPR / Cas9-mediated homology-directed repair pathway
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-28
- Publication Date
- 2026-08-14
AI Technical Summary
[0006]本发明的目的在于提供基于CRISPR/Cas9介导同源定向修复途径构建永生化巨核祖细胞潜能hiPSC系的方法,以解决传统病毒整合策略在安全性、稳定性等不理想的技术问题
本发明相较于传统病毒介导的随机整合策略,在安全性、可控性、稳定性及可实施性方面均实现显著突破,具体有益效果如下:
Smart Images

Figure CN122564055A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene editing technology, specifically to a method and application for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway. Background Technology
[0002] Platelets, as core effector cells for hemostasis and coagulation, have irreplaceable transfusion therapeutic value in clinical scenarios such as thrombocytopenia, bone marrow suppression after chemotherapy for hematological diseases, and traumatic bleeding. Currently, clinically used platelets mainly rely on peripheral blood donations from volunteers, which suffers from unstable donor sources, short storage periods (only 5 days at 20-24℃), the risk of HLA / HPA immune rejection from allogeneic transfusion, and the potential risk of bloodborne pathogen transmission, making it difficult to meet routine and emergency clinical needs. Human induced pluripotent stem cells (hiPSCs), with their unlimited self-renewal capacity, multi-lineage differentiation potential, and the advantage of autologous origin avoiding immune rejection, have become the ideal seed cells for large-scale in vitro platelet production. Furthermore, the nucleus-free nature of platelets allows for the elimination of the tumorigenic risk of residual stem cells through gamma ray treatment, further improving the safety of hiPSC-derived platelets in clinical applications.
[0003] Megakaryocytes are the only precursor cells for platelet production. However, the process of directly differentiating hiPSCs into megakaryocytes and further producing functional platelets is complicated and time-consuming, making it difficult to meet the mass production requirements of in vitro large-scale preparation. Furthermore, megakaryocytes themselves have insufficient in vitro proliferation capacity and cannot be used as seed cells for expansion, which limits the large-scale preparation of hiPSC-derived platelets. c-MYC、BMI1 and BCL-XL ( MBX The synergistic expression of the three factors can achieve immortalization of megakaryocyte progenitors (MKPs) and overcome their defects in proliferation. c-MYC As a key growth regulator, it can significantly promote the self-replication and proliferation of MKP. BMI1 By inhibiting INK4A / ARF Gene loci inhibit cellular senescence. BCL-XL Then it can antagonize c-MYC Overexpression triggers a caspase-dependent apoptosis pathway, and the three factors form a synergistic regulatory network of "proliferation-anti-aging-anti-apoptosis". However, when megakaryocytes differentiate into mature cells and produce functional platelets, the exogenous expression of the three factors must be turned off, otherwise it will inhibit megakaryocyte polyploidization and platelet release. Therefore, precise spatiotemporal controllable expression of the three factors is the key to constructing a functional immortalized megakaryocyte line.
[0004] Traditional strategies for constructing immortalized megakaryocyte cell lines (imMKCLs) largely rely on retroviral or lentiviral-mediated random integration techniques to introduce inducible expression sequences containing three factors into hiPSCs. This method has certain limitations: the randomness of the integration site easily leads to insertional mutations or expression silencing of endogenous genes, posing a potential oncogenic risk; the genetic background of the target cells is highly heterogeneous; exogenous gene expression is affected by the chromatin environment of the integration site, resulting in unstable expression levels and a tendency for silencing; cis-regulatory elements of viral vectors are prone to mutual interference, leading to increased leakage of the inducible expression system. Furthermore, viral vectors suffer from residual immunogenicity and complex procedures, limiting their clinical translational potential.
[0005] Therefore, there is a need to develop a novel method for constructing immortalized megakaryocyte progenitor cell (hiPSC) lines to overcome the inherent defects of traditional viral integration strategies in terms of safety, uniformity, and controllability of exogenous genes. Summary of the Invention
[0006] The purpose of this invention is to provide a method for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway, so as to solve the technical problems of unsatisfactory safety and stability of traditional viral integration strategies.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A method for constructing immortalized megakaryocyte progenitor cell line hiPSCs based on the CRISPR / Cas9-mediated homology-directed repair pathway: S1: Use px458-sgROSA26 sgRNA plasmid and pROSA26-CAG-M2rtTA Donor plasmids were transfected into hiPSC-B1 cells using liposome transfection, followed by antibiotic selection to obtain... CAG-M2rtTA hiPSC; S2: Use px458-sgAAVS1 sgRNA plasmid and pAAVS1-TRE-MBX-EGFP donor plasmids were transfected using liposome transfection. CAG-M2rtTA hiPSC, after resistance screening, obtained CAG-M2rtTA / TRE-MBX hiPSC; in, px458-sgROSA26 sgRNA plasmid and px458-sgAAVS1 sgRNA plasmids are used to provide targeted... ROSA26 site and AAVS1 sgRNA at the site; pROSA26-CAG-M2rtTA The nucleotide sequence of the donor plasmid is shown in SEQ ID NO.5; pAAVS1-TRE-MBX-EGFPThe nucleotide sequence of the donor plasmid is shown in SEQ ID NO.6.
[0008] Furthermore, in S1, hiPSC-B1 cells were seeded in Matrigel-pre-coated culture wells and cultured in PGM1 medium containing Y-27632 until cell confluence reached 30%-60%; next, a medium containing Y-27632 was added. px458- sgROSA26 sgRNA plasmid and pROSA26-CAG-M2rtTA Transfection was performed using a liposome transfection system containing the donor plasmid; after transfection, cells were screened for resistance using PGM1 medium containing hygromycin B for 7-10 days; surviving cells were then expanded and identified through integration to obtain... CAG-M2rtTA hiPSC.
[0009] Furthermore, in S2, CAG-M2rtTA hiPSC cells were seeded in Matrigel-pre-coated wells and cultured in PGM1 medium containing Y-27632 until cell confluence reached 30%-60%; next, a medium containing Y-27632 was added. px458- sgAAVS1 sgRNA plasmid and pAAVS1-TRE-MBX-EGFP Transfection was performed using a liposome transfection system containing the donor plasmid; after transfection, cells were screened for resistance using PGM1 medium containing puromycin for 7-10 days; surviving cells were then expanded and identified for integration, yielding cells with dual-site integration. CAG-M2rtTA / TRE-MBX hiPSC.
[0010] Furthermore, it also includes S3: for CAG-M2rtTA / TRE-MBX hiPSC cells were cultured for doxycycline-based induced differentiation to obtain megakaryocyte progenitor cells.
[0011] Furthermore, the method for obtaining megakaryotic progenitor cells is as follows: CAG-M2rtTA / TRE-MBX hiPSC cells were seeded in Matrigel-coated wells and cultured in PGM1 medium containing Y-27632; then, the medium was replaced with StemPro-34 SFM as the basal medium for further culture. From the time the culture medium was changed until day 4, rhBMP-4 and rhVEGF were added to the basal culture medium; From day 4 to day 12, rhSCF, rhTPO, and rhIL-3 were added to the basal culture medium to obtain CD34. + Hematopoietic stem cells; Day 12, collect CD34 +Hematopoietic stem and progenitor cells were suspended in MKP-induced amplification medium; MKP-induced amplification medium was supplemented with rhTPO, rhSCF, rhIL-3, rhIL-6, and doxycycline to form basal medium; cells were seeded into ultra-low adsorption culture plates for suspension culture and continued to be induced and amplified until day 30 of differentiation to obtain immortalized megakaryocyte progenitor cells.
[0012] Furthermore, CAG-M2rtTA / TRE-MBX hiPSC cells were seeded in Matrigel-coated wells and cultured in PGM1 medium containing 10 μmol / L Y-27632. From the time the culture medium was changed until day 4, 50 ng / mL rhBMP-4 and 50 ng / mL rhVEGF were added to the basal culture medium. From day 4 to day 12, 50 ng / mL rhSCF, 50 ng / mL rhTPO, and 25 ng / mL rhIL-3 were added to the basal culture medium to obtain CD34. + Hematopoietic stem cells; The MKP-induced amplification medium was prepared by adding 50 ng / mL rhTPO, 50 ng / mL rhSCF, 25 ng / mL rhIL-3, 20 ng / mL rhIL-6, and 2 μg / mL doxycycline to the basal medium.
[0013] This technical solution also provides a plasmid combination for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway, which includes sgRNA plasmids and homology recombination donor plasmids. sgRNA plasmids include those that produce targets ROSA26 sgRNA plasmid A at the site, and the generation of sgRNA targeting AAVS1 sgRNA plasmid B at the site; Homologous recombination donor plasmids include homologous recombination donor plasmid A and homologous recombination donor plasmid B; homologous recombination donor plasmid A contains components for integration into... ROSA26 Tet-On system regulatory elements at the site M2rtTA Homologous recombination donor plasmid B contains components for integration into... AAVS1 tandem of sites c-MYC / BMI1 / BCL-XL Three-Factor and Tet-On System Response Elements THREE Promoter.
[0014] Furthermore, the homologous recombination donor plasmid A contains the hygromycin B resistance gene. Hygro Homologous recombination donor plasmid B contains the puromycin resistance gene. Pure and enhanced green fluorescent protein gene EGFP; Homologous recombination donor plasmid A contains PGK promoters and CAG promoter; PGK Promoter drives hygromycin B resistance gene Hygro Express; CAG Promoter control of Tet-On system control elements M2rtTA Transcription; Tandem in homologous recombination donor plasmid B c-MYC / BMI1 / BCL-XL The three factors include BCL-XL Gene, BMI1 Gene, c-MYC Gene; Enhanced green fluorescent protein gene EGFP , BCL-XL Gene, BMI1 Gene, c-MYC Genes, Tet-On system response elements THREE The promoters were all inserted in reverse into the homologous recombination donor plasmid B.
[0015] Furthermore, the homologous recombination donor plasmid A provides for insertion... ROSA26 The fragment structure at the site is: 5' homologous arm—hygromycin B resistance gene. Hygro — PGK promoter— CAG Promoter—Tet-On system control element M2rtTA —3' homologous arm; Homologous recombination donor plasmid B provides for insertion AAVS1 The fragment structure of the site is: 5' homologous arm—purinemycin resistance gene Pure —Polyadectophosphate polyA —Enhanced Green Fluorescent Protein Gene EGFP — BCL-XL Gene- BMI1 Gene- c-MYC Gene-Tet-On system response element THREE Promoter — 3' homologous arm.
[0016] Furthermore, sgRNA plasmid A was obtained by the following method: the sequence is shown in SEQ ID NO.3. sgROSA26 F and the sequence are shown in SEQ ID NO.4. sgROSA26 R was annealed to obtain double-stranded DNA; pX458 The vector was digested with BbsI restriction endonuclease and ligated with double-stranded DNA. After transformation into competent cells, sgRNA plasmid A was obtained after screening. sgRNA plasmid B was obtained by the following method: the sequence is shown in SEQ ID NO.1. sgAAVS1 F and the sequence are shown in SEQ ID NO.2. sgAAVS1R was annealed to obtain double-stranded DNA; pX458 The vector was digested with BbsI restriction endonuclease and ligated with double-stranded DNA. After transformation into competent cells, sgRNA plasmid B was obtained after screening. The nucleotide sequence of homologous recombination donor plasmid A is shown in SEQ ID NO.5; The nucleotide sequence of homologous recombination donor plasmid B is shown in SEQ ID NO.6.
[0017] The technical principle of this technical solution: This invention relies on CRISPR / Cas9-mediated homology-directed repair (HDR) technology, combined with the human genome ROSA26 , AAVS1 The characteristics of the two safe harbor sites, through the stepwise integration of the Tet-On control system and MBX The immortalization effect module constructs a human induced pluripotent stem cell (hiPSC) line capable of inducing immortalized megakaryocyte progenitor (MKP) potential. The specific principle is as follows: (1) Precise targeting of safe harbor sites: The CRISPR / Cas9 system targets sgRNA (sgRNA) ROSA26 The sgRNA at the site is composed of px458-sgROSA26 Plasmid provided, targeted AAVS1 The sgRNA at the site is composed of px458-sgAAVS1 Plasmids provide specific recognition of the genome. ROSA26 , AAVS1 The safe harbor site guides the Cas9 nuclease to precisely cleave the target site. ROSA26 The site is a constitutive transcriptional region in the human genome that does not encode functional proteins. AAVS1 The site is located in humans PPP1R12C The first intron region of a gene. When exogenous genes are integrated into these two safe haven sites, they usually do not significantly interfere with normal cellular physiological functions and can ensure the long-term stable expression of exogenous genes, laying the foundation for the subsequent site-specific and safe integration of exogenous genes and regulatory elements.
[0018] (2) Homologous targeted repair-mediated precise integration: For the two safe harbor sites, corresponding homologous recombination donor plasmids were designed respectively. pROSA26-CAG-M2rtTA , pAAVS1-TRE-MBX-EGF The donor plasmid contains homologous arms that are homologous to the upstream and downstream sequences of the target site, the target functional element, and selection markers. When Cas9 cleaves and forms a double-strand break, the cell initiates a homology-directed repair mechanism. The homologous arms in the donor plasmid recombine with homologous sequences at the genomic target site, precisely integrating the target functional element into the target site. ROSA26 , AAVS1 Site-specific integration of exogenous genes is achieved, avoiding the risks associated with random integration.
[0019] (3) Dual-module separation and controllable expression: This scheme adopts a design that physically separates the control module and the effect module, and separates the control elements of the Tet-On system. M2rtTA Integration ROSA26 Site, the response element of the Tet-On system THREE Driven MBX Three factors ( c-MYC、BMI1、BCL-XL Integrate into AAVS1 Site. Among them, c-MYC Promotes MKP self-replication and proliferation. BMI1 Inhibit cell senescence ,BCL-XL Antagonism c-MYC Overexpression triggers apoptosis, and these three factors form a synergistic regulatory network promoting proliferation, anti-aging, and anti-apoptosis. The Tet-On system can achieve this. MBX Spatiotemporally controllable expression of the three factors, without the addition of doxycycline (DOX), MBX The three factors are not expressed to avoid their inhibition of megakaryocyte maturation; after the addition of DOX, the M2rtTA protein binds to DOX and undergoes a conformational change, thereby binding with... THREE Starter combination, startup MBX Highly efficient expression of three factors drives immortalized amplification of MKP.
[0020] In order to achieve MBX For precise temporal and climatic control of the three factors, this scheme adopts an innovative design approach that physically separates the regulatory and effector modules. Utilizing dual-donor plasmids, the two modules of the Tet-On system (M2rtTA and TRE) are integrated into different safe harbor sites. Through physical separation at the genome level, the mutual interference between cis-regulatory elements in traditional single-vector designs is minimized. Furthermore, regarding… pAAVS1-TRE-MBX-EGFP For the plasmid, this study employed a dual-leakage prevention expression design: firstly, a strong anti-leakage expression design was introduced at the 5' end of the insert fragment. polyA Transcription terminators prevent the transcriptional readthrough of upstream endogenous genes into the insertion fragment; secondly, they prevent the entire transcriptional process from proceeding. TRE-MBX-EGFP Expression cassettes are inserted in the reverse direction of genome transcription, further avoiding THREE The unusual interaction between the promoter and the genome sequence enhances the precision and rigor of the Tet-On induction system on multiple levels.
[0021] (4) Stepwise transfection and screening: Using liposome non-viral transfection, the sgRNA plasmid and the corresponding donor plasmid were introduced into hiPSC-B1 cells in two steps: Step 1 transfection px458-sgROSA26 and pROSA26-CAG-M2rtTA Plasmids were obtained through hygromycin B resistance screening. CAG-M2rtTA Unit-point integrated cells; second step transfection px458-sgAAVS1 and pAAVS1- TRE-MBX-EGFPThe plasmid was used for selection based on puromycin resistance to obtain hiPSC lines with dual-site integration. Meanwhile, pAAVS1- TRE-MBX-EGFP The EGFP reporter gene in the donor plasmid can be directly monitored. MBX The induced expression status of the three factors was verified by PCR and Sanger sequencing to ensure the accuracy of integration and to obtain the target cell line.
[0022] To further shorten the cell line establishment cycle, the inventors attempted a strategy of simultaneous co-transfection at two sites combined with simultaneous screening using two antibiotics. However, preliminary experimental results showed that even with the initial enrichment of transfected positive cells based on the antibiotic tag, it was still difficult to obtain positive monoclonal antibodies with precise integration at both sites. This may be related to the extremely low probability of simultaneous HDR events at both sites in hiPSCs. Therefore, this study ultimately adopted a strategy of "first..." ROSA26 ,back AAVS1 The two-step editing process was used, and hygromycin and puromycin were used for step-by-step screening. After each round of screening, PCR and sequencing were combined for verification to finally obtain the target cell line.
[0023] (5) Induction of differentiation: The hiPSC line with dual-site integration was induced to differentiate into CD34 by adding cytokines such as bone morphogenetic protein 4 and vascular endothelial growth factor. + Hematopoietic stem and progenitor cells, plus thrombopoietin, doxycycline, etc. to induce CD34 + Hematopoietic stem and progenitor cells are expanded into immortalized MKPs; after Dox is withdrawn, MKPs are further induced to differentiate and mature, resulting in platelet-like structural cells, thus achieving controllable induction from hiPSCs to functional platelet precursor cells.
[0024] In summary, the technical challenge in constructing the immortalized MKP system lies in achieving... MBX Three factors ( c-MYC、BMI1、BCL- XL Precise temporal and climatic control of the three factors. Synergistic expression of the three factors can effectively drive the immortalization and expansion of MKP, overcoming the deficiency of insufficient self-proliferation capacity of megakaryocytes. However, sustained expression of the three factors significantly inhibits polyploid maturation and platelet release in megakaryocytes. Therefore, low leakage and high responsiveness of the induction system are crucial to cell line function. Previous studies have often constructed the regulatory and effector elements of the Tet-On system in the same vector, which easily leads to mutual interference between cis-regulatory elements. Simultaneously, basal leakage expression caused by upstream gene readthrough severely affects the precision of the induction system, failing to simultaneously meet the dual requirements of MKP immortalization and differentiation maturation. This technical solution overcomes the shortcomings of existing technologies by stepwise integrating the Tet-On regulatory system with… MBX Immortality effect module at ROSA26 , AAVS1At two safe harbor sites, the Tet-On induction system and... MBX The physical isolation and functional synergy of the effector modules effectively solve the key technical bottlenecks of high leakage expression and loose regulation in traditional single-vector strategies, providing a reliable technical path for constructing inducible megakaryocyte cell lines that have both immortalization and normal differentiation and maturation capabilities.
[0025] The beneficial effects of this technical solution are: Compared with traditional virus-mediated random integration strategies, this invention achieves significant breakthroughs in terms of safety, controllability, stability, and feasibility. Specific beneficial effects are as follows: (1) Significantly improves safety: adopts ROSA26 , AAVS1 The precise integration of dual safe harbor sites completely avoids the problems of endogenous gene insertion mutations and expression silencing caused by random integration of traditional viruses, eliminating potential carcinogenic risks at the genomic level. At the same time, the entire process uses liposome-based non-viral transfection, leaving no viral vector residues, avoiding immunogenicity caused by viral elements, reducing the genetic heterogeneity of cell lines, meeting the quality control requirements of clinical-grade cell products, and significantly improving the clinical translation potential of hiPSC-derived platelets.
[0026] (2) Implementation MBX Three-factor precise time-space control: Through the design of physically separating the regulation module and the effect module, combined with polyA Optimizations such as terminator and reverse insertion of effector elements effectively eliminated the mutual interference of cis-regulatory elements in traditional single-vector designs, blocking basal leakage expression caused by upstream gene readthrough. Experiments confirmed that without Dox, MBX The absence of expression of the three factors does not affect megakaryocyte maturation; after Dox induction, the three factors are expressed efficiently and stably, driving the immortalization and expansion of MKP; after Dox withdrawal, MKP can differentiate and mature normally and produce platelet-like structures, thus resolving the contradiction between immortalization and differentiation and maturation and ensuring the functionality of the cell line.
[0027] (3) Improve the stability and uniformity of exogenous gene expression: The chromatin environment of the safe harbor site is stable, which can ensure the integration of exogenous genes. M2rtTA, MBX The three factors (factors) are expressed stably over a long period, avoiding the problems of unstable exogenous gene expression and easy silencing caused by differences in the chromatin environment at the integration site in traditional random integration. At the same time, homologous targeted repair enables site-controlled integration of exogenous genes, making the genetic background of different cell clones highly homogeneous, which facilitates the standardized construction and quality control of cell lines.
[0028] (4) Optimization of cell line construction process: A stepwise transfection and stepwise resistance screening strategy was adopted, combined with EGFPThe reporter gene visualization, PCR, and sequencing verification effectively solves the technical challenges of low HDR efficiency at multiple sites in hiPSCs and difficulty in screening positive clones, reducing the difficulty and shortening the establishment cycle. The non-viral transfection method is simple to operate and has a controllable process, eliminating the need for complex virus packaging procedures, thus reducing experimental costs and operational barriers. This transfection and screening strategy can provide a replicable technical reference for multi-site gene editing of similar pluripotent stem cells.
[0029] (5) Providing ideal in vitro large-scale preparation of platelet seed cells: The constructed immortalized megakaryocyte progenitor cell line (hiPSC) retains the advantages of hiPSC's unlimited self-renewal and multi-lineage differentiation, and also achieves... MBX The controlled expression of the three factors enabled the immortalized expansion of MKP, overcoming the drawbacks of traditional hiPSC direct differentiation into megakaryocytes, such as cumbersome procedures, long cycles, and insufficient megakaryocyte self-proliferation capacity. This study provides a new seed cell solution for in vitro platelet preparation and also offers a replicable technical reference for precise gene editing and multi-gene modification of pluripotent stem cells.
[0030] In summary, this invention combines CRISPR / Cas9-mediated HDR technology with dual safe harbor sites, Tet-On controllable expression system, and stepwise transfection screening strategy to achieve precise and controllable integration of multiple genes and multiple sites. It is not only applicable to the construction of immortalized megakaryocyte progenitor potential hiPSC lines, but also provides a replicable and scalable technical solution for the precise gene editing, multi-gene modification, and functionalization of pluripotent stem cells, and has broad technical application value. Attached Figure Description
[0031] Figure 1 As in Embodiment 1 of the present invention px458-sgROSA26 , px458-sgAAVS1 Plasmid schematic diagram and sequencing results.
[0032] Figure 2 The donor plasmid construction map and sequencing verification of key functional elements in Example 1 of this invention: A: pROSA26-CAG-M2rtTA Plasmid mapping; B: pAAVS1-TRE-MBX-EGFP Plasmid mapping; C: pROSA26-CAG-M2rtTA In the carrier Hygro Resistance genes and M2rtTA Component sequencing results; D: pAAVS1-TRE-MBX-EGFP In the carrier EGFP, BCL-XL, BMI1, c-MYC Component sequencing results.
[0033] Figure 3 This is Example 2 of the present invention. ROSA26Site-targeted integration of Tet-On system (tetracycline-positive induction system) regulatory elements M2rtTA Schematic diagram and verification results: A: ROSA26 Schematic diagram of site-specific integration; B: Agarose gel electrophoresis results of PCR products of the 5′ and 3′ ligation sequences; Sanger sequencing results of PCR products of C: 5′ and 3′ ligation sequences.
[0034] Figure 4 This is for Embodiment 2 of the present invention. AAVS1 Site-targeted integration of Tet-On system (tetracycline positive induction system) effector elements MBX and EGFP Schematic diagram and verification results: A: AAVS1 Schematic diagram of site-specific integration; B: Agarose gel electrophoresis results of PCR products of the 5′ and 3′ ligation sequences; Sanger sequencing results of PCR products of C: 5′ and 3′ ligation sequences.
[0035] Figure 5 This is Example 3 of the present invention. CAG-M2rtTA / TRE-MBX Experimental results of DOX (doxycycline)-induced MBX expression and megakaryotype analysis in hiPSC lines: A: The schematic diagram illustrates DOX-mediated regulation of MBX expression and its effects on MKP proliferation and differentiation; B: HiPSC stage after DOX induction EGFP Reporter gene expression (scale bar: 50 μm); C–E: DOX-ON group c-MYC, BMI1 and BCL-XL mRNA expression levels (n = 3); F: MKP stage cells under continuous DOX induction EGFP Expression and proliferation status (scale bar: 50 μm); G: Whether to express or not to express MBX In the case of (DOX-ON group or non-DOX group), Wright-Giemsa staining of MKP from #1-1 (above) and DNA ploidy flow cytometry analysis (scale bar: 20 μm). H: Flow cytometry analysis of CD41a and CD42b expression in MKP cells from WT iPSC and #1-1 cell line under different DOX treatment conditions.
[0036] Figure 6Comparison of hiPSC transfection efficiency between liposome transfection and electroporation transfection in Example 1: A: Observed under a fluorescence microscope after electroporation and lipid transfection. EGFP Fluorescence (scale bar: 50 μm); B: The proportion of EGFP-positive cells detected by flow cytometry 48 h after transfection; C: Bar chart of transfection efficiency; quantitative data are expressed as mean ± standard error, n=3; independent samples t-test was used to compare transfection efficiency between two groups; *P<0.05 indicates that the difference is statistically significant. Detailed Implementation
[0037] The present invention will be further described in detail below with reference to the embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art; the experimental methods used are all conventional methods and can be completed according to the described recombinant technology (see Molecular Cloning, Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can all be obtained commercially.
[0038] The cell lines used in this protocol are as follows: human induced pluripotent stem cells hiPSC-B1 (Cellapy) were cultured in Matrigel coated plates with PGM1 at 37°C and 5% CO2. The cells were passaged by digestion with Accutase every 4 days, and routine mycoplasma testing was performed and confirmed to be negative.
[0039] The main reagents used in this study included: T4 DNA ligase, TransZol Up Plus RNA total RNA extraction kit (Beijing TransGen Biotech Co., Ltd.), DH5α chemocompetent cells, TIANamp genomic DNA extraction kit (Tiangen Biotech (Beijing) Co., Ltd.), Hifair AdvanceFast one-step reverse transcription-genomic DNA removal premix (Shanghai Yisheng Biotechnology Co., Ltd.), 2× Universal SYBR Green Fast qPCR premix (Wuhan Aibote Biotechnology Co., Ltd.), StemPro-34 SFM serum-free medium, Opti-MEM serum-reduced medium, Accutase cell digestion solution, Lipofectamine Stem transfection reagent (Thermo Fisher Scientific, USA), P3 Primary Cell 4D-Nucleofector X electroporation kit (Lonza, Switzerland), recombinant human bone morphogenetic protein 4 (rhBMP-4), and recombinant human vascular endothelial growth factor (rhBMP-4). rhVEGF, Recombinant Human Stem Cell Factor (rhSCF), Recombinant Human Thrombopoietin (rhTPO), Recombinant Human Interleukin 3 (rhIL-3), Recombinant Human Interleukin 6 (rhIL-6), Recombinant Human Interleukin 11 (rhIL-11) (PeproTech, USA), PE-labeled anti-human CD41a monoclonal antibody, APC-labeled anti-human CD42b monoclonal antibody (BioLegend, USA), Propidium Iodide (PI) (Beyotime Biotechnology Co., Ltd.), Wright-Gymsa staining kit (BASO), Puromycin, Hygromycin B, Doxycycline (TargetMol, USA), Y-27632 2HCl inhibitor (Selleck, USA).
[0040] Example 1: Plasmid Construction (1) Construction of sgRNA plasmid The basic vector for the Cas9 / sgRNA vector is pSpCas9(BB)-2A-GFP ( PX458 Addgene, #48138). Targeting humans. AAVS1 and ROSA26 Two safe sites were used to design two specific sgRNA sequences to ensure gene editing efficiency and specificity.
[0041] The forward and reverse primers for the specific sgRNA sequences at the two sites are as follows: sgAAVS1 F: CACC GGGGCCACTAGGGACAGGAT (SEQ ID NO. 1); sgAAVS1 R: AAAC ATCCTGTCCCTAGTGGCCCC (SEQ ID NO.2); sgROSA26 F: CACC TCAGGATTGCAGCTCGCGCC (SEQ ID NO.3); sgROSA26 R: AAAC GGCGCGAGCTGCAATCCTGA (SEQ ID NO. 4).
[0042] Among them, positive oligonucleotides ( sgAAVS1 F, sgROSA26 A CACC sticky terminus is introduced at the 5' end of the F) reverse oligonucleotide (F) sgAAVS1 R, sgROSA26 An AAAC sticky terminus is introduced at the 5' end of the R) to match the residue after BbsI digestion. pX458 Vector ends. The synthesized forward and reverse oligonucleotides were mixed in a 1:1 molar ratio and placed in annealing buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, 50 mmol / L NaCl, pH 8.0). The mixture was denatured at 95°C for 5 min and then allowed to cool naturally to room temperature to form double-stranded DNA (dsDNA). pX458 The vector was digested with BbsI restriction endonuclease at 37°C for 4 hours, and the linearized vector fragment was recovered by 1% agarose gel electrophoresis. The annealed dsDNA was then ligated with the linearized DNA using T4 DNA ligase. pX458 The vector was ligated overnight at 16°C. The ligation product was transformed into DH5α competent cells and plated on LB solid medium containing ampicillin (100 μg / mL), and cultured at 37°C for 12–16 h. Single colonies were picked and inoculated into LB liquid medium, cultured with shaking, and the plasmid was extracted. Sanger sequencing (Qingke Biotechnology) verified that the sgRNA sequence was correctly inserted into the BbsI site of the vector, thus obtaining the recombinant plasmid.px458-sgAAVS1 and px458- sgROSA26 .
[0043] This study targets humans AAVS1 , ROSA26 Two safe sites were used to design specific sgRNAs and construct recombinant expression plasmids. Sanger sequencing results showed that ( Figure 1 ), target AAVS1 and ROSA26 The sgRNA sequence at each site was accurately inserted. pX458 The BbsI restriction site of the vector showed an insertion sequence that was completely identical to the designed sequence, with no base mutations, deletions, or abnormal insertions detected. Successful acquisition was ultimately achieved. px458-sgAAVS1 and px458-sgROSA26 Recombinant plasmids can be used for subsequent site-targeted editing experiments.
[0044] (2) Construction of homologous recombination donor plasmids This method constructs donor plasmids. pAAVS1-TRE-MBX-EGFP and pROSA26-CAG-M2rtTA All were constructed using the pUC57 plasmid as the basic framework. Each functional fragment (including...) ROSA26 / AAVS1 Homologous arms, selection marker genes, promoters, and target genes / regulatory elements were precisely digested with specific restriction endonucleases, separated by agarose gel electrophoresis and purified by gel recovery. These were then combined with the pUC57 vector, which had been linearized and purified using restriction endonucleases, and assembled in a modular, stepwise manner via a T4 DNA ligase-mediated ligation reaction. pROSA26-CAG-M2rtTA Targeted integration ROSA26 upstream and downstream homologous arms of the site, hygromycin ( Hygro ) Filter box and PGK / CAG Two-way promoter expression box, in which PGK Startup driver Hygro Gene expression, CAG Promoter regulation M2rtTA Gene transcription; pAAVS1-TRE-MBX-EGFP Targeted integration AAVS1 upstream and downstream homologous arms of the site, puromycin ( puro ) Filter box and polyadenylation (polyA) signal sequence, simultaneously inserted EGFP, BCL-XL, BMI1, c-MYC and TRE Control elements, the above EGFP, BCL-XL, BMI1, c-MYC and TREAll elements were inserted into the reverse insertion vector. The ligation products were transformed into DH5α competent E. coli, plated on LB agar containing ampicillin, and single colonies were picked. Positive clones were screened by colony PCR and restriction endonuclease digestion. Subsequently, plasmids were extracted in small quantities. Finally, Sanger sequencing technology was used to verify the sequences of key ligation regions and all functional elements of each plasmid, confirming that the sequences of each element were accurate and the insertion direction conformed to the pre-designed sequence.
[0045] This study successfully constructed pROSA26-CAG-M2rtTA and pAAVS1-TRE-MBX-EGFP Two homologous recombination donor plasmids ( Figure 2 A and 2B, for details regarding key components in the plasmid structure, see Table 1. pROSA26-CAG-M2rtTA Include ROSA26 upstream and downstream homologous arms of the site, hygromycin ( Hygro ) Screening components and M2rtTA Control elements; pAAVS1-TRE- MBX-EGFP Include AAVS1 upstream and downstream homologous arms of the site TRE Startup driver MBX Three-factor tandem expression elements and EGFP Reporter genes.
[0046] Sanger sequencing was performed to validate the key functional regions of the two donor plasmids, and the results showed... M2rtTA, Hygro, TRE, c-MYC, BMI1, BCL-XL and EGFP The sequences of all core components are completely matched with the design sequence, with no base mutations, deletions, or read frame shifts. Figure 2 (C, 2D) confirmed that the two donor plasmids were constructed correctly and can be used for subsequent site-specific integration experiments.
[0047] Table 1: pROSA26-CAG-M2rtTA and pAAVS1-TRE-MBX-EGFP Explanation of key elements of two homologous recombination donor plasmids
[0048] pROSA26-CAG-M2rtTA The nucleotide sequence of the homologous recombination donor plasmid is (SEQ ID NO.5):
[0049] pAAVS1-TRE-MBX-EGFP The nucleotide sequence of the homologous recombination donor plasmid is (SEQ ID NO.6):
[0050] Example 2: Liposome Transfection and Antibiotic Screening This technical solution employs a stepwise liposome transfection combined with a stepwise screening strategy for corresponding antibiotics, sequentially completing... ROSA26 site and AAVS1 The targeted integration of the target site was achieved, and each step of the liposome transfection process utilized existing conventional liposome transfection kits and methods. The first step involved... ROSA26 For site-targeted integration, one day before transfection, hiPSC-B1 cells in logarithmic growth phase were digested with Accutase and then inoculated at 3-4 × 10⁻⁶ cells / day. 5 Cells were seeded at a density of 10 cells / well into pre-coated Matrigel 6-well plates, and PGM1 medium containing 10 μmol / L Y-27632 was added. The plates were then incubated at 37°C with 5% CO2 until cell confluence reached 30%-60%. Transfection was then performed. The transfection complex was diluted with Opti-MEM medium (200 μL per well) and added... px458-sgROSA26 plasmids and pROSA26-CAG-M2rtTA Donor plasmid (mass ratio of donor to donor plasmid 1:2, total 3 μg plasmid per well) was vortexed and mixed, then Lipofectamine Stem Reagent (6 μL per well; transfection reagent to plasmid total mass ratio 2:1) was added. After standing at room temperature for 15 min, the complex was slowly added dropwise to the cell culture wells, the culture plate was gently shaken to mix, and culture continued. For at least 24 h post-transfection, the final concentration of Y-27632 in the culture medium was maintained at 10 μmol / L to ensure cell survival. 48 h after transfection, the medium was replaced with fresh PGM1 medium, and hygromycin B was added at a final concentration of 200 μg / mL to initiate resistance selection (this concentration is the minimum complete killing concentration for hiPSC-B1 cells determined in preliminary experiments). The drug-containing medium was changed daily, and selection continued for 7-10 days. Dead cell debris was removed promptly. Surviving cells were expanded and identified through integration to obtain... CAG-M2rtTA Positive hiPSC line. Genomic DNA was extracted using the TIANamp Genomic DNA Kit; integration events were verified using transsgRNA-mediated Cas9 cleavage site PCR; PCR products were separated and purified by 1.5% agarose gel electrophoresis and then subjected to Sanger sequencing to assess integration status.
[0051] CAG-M2rtTA The screening and identification of positive cell clones are detailed below: Based on CRISPR-Cas9 / HDR technology, px458-sgROSA26 and pROSA26-CAG-M2rtTAPlasmids were co-transfected into hiPSCs via liposomes. After continuous selection with hygromycin for 7-10 days, single clones with stable morphology and good proliferative activity were selected for expansion culture. Positive clones maintained the typical clonal growth morphology of hiPSCs, with a high nucleocytoplasmic ratio, no signs of spontaneous differentiation, and stable passage capacity. Genomic DNA was extracted from positive clones and targeted... ROSA26 PCR amplification was performed on the upstream and downstream integration junctions at the site. Agarose gel electrophoresis results showed that positive clones amplified the target bands of the expected size in both the 5' and 3' junctions, while the wild-type control group showed no specific band amplification, confirming that the target sequence had been successfully integrated into the hiPSC. ROSA26 site ( Figure 3 B). Sanger sequencing of the PCR-positive products showed that the integration junction sequence was consistent with the target sequence and ROSA26 The flanking genome sequences of the site were completely matched, and no base mismatches, deletions, or insertions were found. Figure 3 C). Ultimately, two plants were obtained that were correctly identified through double testing. CAG-M2rtTA Positive hiPSC lineage, used for subsequent AAVS1 Site-targeted editing experiments.
[0052] On this basis, AAVS1 Site-targeted integration operations, to identify the correct CAG-M2rtTA Positive hiPSCs are recipient cells. Following the liposome transfection protocol described above, cell plating and transfection were performed. The plasmid used for transfection was... px458-sgAAVS1 plasmids and pAAVS1-TRE-MBX-EGFP Donor plasmid (mass ratio of donor to donor plasmid 1:2); 48 h after transfection, replace with fresh PGM1 medium, add puromycin at a final concentration of 0.5 μg / mL to initiate the second round of resistance selection, continue treatment for 7-10 days, and finally obtain... ROSA26 and AAVS1 A population of cells with dual-site integration and dual resistance was used for subsequent monoclonal selection and integration identification. Genomic DNA was extracted using the TIANamp Genomic DNA Kit; integration events were verified using trans-sgRNA-mediated Cas9 cleavage site PCR; PCR products were separated and purified by 1.5% agarose gel electrophoresis and then subjected to Sanger sequencing to assess integration status.
[0053] CAG-M2rtTA / TRE-MBX The screening and identification of positive cell clones are detailed below: After being verified as correct CAG-M2rtTA Based on the hiPSC line (clone 1), further transfection was performed using liposomes. px458-sgAAVS1 and pAAVS1-TRE-MBX-EGFP Plasmids were screened for monoclonal antibodies using puromycin to complete the process. AAVS1 Targeted integration of site-effecting elements ( Figure 4A). The selected single clones were identified by dual identification using conjugation PCR and Sanger sequencing. The results showed that four cell clones were... AAVS1 Both the 5' and 3' junction regions amplified the target bands of the expected size. The junction region sequences matched the designed sequences. AAVS1 The flanking genome sequences of the site were completely matched, with no abnormal base mutations. Figure 4 (B, 4C). The above results confirm that this study was successfully completed. ROSA26 and AAVS1 The step-by-step precise integration of dual safe harbor sites has yielded the following results: CAG-M2rtTA / TRE-MBX hiPSC line.
[0054] Example 3: Inducing hiPSC-targeted MKP (megakaryocytic progenitor cell) differentiation (1) Differentiation induction methods and effects Verification was performed via PCR and Sanger sequencing. ROSA26 and AAVS1 Two-site precise integration, positive hiPSC monoclonal cells with typical stem cell morphology (#1-1: correctly identified positive clone, clone 1-1). CAG-M2rtTA / TRE-MBX hiPSCs), after passage, selected logarithmic growth phase cells with uniform clonal morphology, no spontaneous differentiation, and 60%–70% confluence were used. Single-cell suspensions were prepared by Accutase digestion and then cultured at 2 × 10⁻⁶ cells / cells. 4 pcs / cm 2 Cells were seeded at a density of 10 μmol / L in Matrigel pre-coated 12-well plates and cultured in PGM1 medium containing 10 μmol / L LY-27632 for 24 h. When cell confluence reached 30%, the medium was replaced with StemPro-34 SFM-based mesodermal-hematopoietic lineage induction medium. During differentiation days 0-4, 50 ng / mL rhBMP-4 (recombinant human bone morphogenetic protein 4) and 50 ng / mL rhVEGF (recombinant human vascular endothelial growth factor) were added to the medium. From days 4-12, the medium was replaced with hematopoietic stem-progenitor cell expansion medium, with 50 ng / mL rhSCF (recombinant human stem cell factor), 50 ng / mL rhTPO (recombinant human thrombopoietin), and 25 ng / mL rhIL-3 (recombinant human interleukin-3) added to the StemPro-34 SFM basal medium. Half the medium was replaced with fresh medium every two days to induce CD34 cell production. +Hematopoietic stem and progenitor cells. On day 12 of differentiation, hematopoietic stem and progenitor cells suspended in the culture system were collected, centrifuged at 300×g at room temperature for 5 min, and the supernatant was discarded. The cells were then resuspended in MKP induction amplification medium (StemPro-34SFM basal medium supplemented with 50 ng / mL rhTPO, 50 ng / mL rhSCF, 25 ng / mL rhIL-3, and 20 ng / mL rhIL-6).
[0055] Next, the cells were treated as follows, and four groups were established: Induction group (DOX-ON, with 2 μg / mL DOX added continuously from day 12 of differentiation); The non-DOX group (no DOX added throughout the process); DOX removal group (DOX-OFF, 2 μg / mL DOX added on days 12-18 of differentiation, DOX removed on day 18 and cultured for another 6 days); Wild-type blank control group (WT, normal iPSC origin differentiation, no DOX added throughout the process).
[0056] The DOX-ON group uses 1.5 × 10 5 The cells were seeded at a density of 1 cell / mL into 6-well ultra-low adsorption plates for suspension culture. The culture medium containing 2 μg / mL DOX was completely replaced every 2 days to maintain the cell density at 1~2×10⁻⁶ cells / mL. 5 Cells were counted and passaged every 3-4 days at a density of [number] cells / mL, and induced to expand until day 30 of differentiation. During this period, cell samples were collected for observation of EGFP reporter gene expression under a fluorescence microscope and for flow cytometry analysis. In the non-DOX and WT groups, the medium was completely replaced with DOX-free medium every 2 days. Cell samples were collected on day 18 of differentiation for Wright-Giemsa staining and flow cytometry analysis. In the DOX-OFF group, after DOX was removed on day 18 of differentiation, the medium was replaced with DOX-free medium and cultured for another 6 days. Cell samples were collected on day 24 of differentiation for flow cytometry analysis of CD41a and CD42b expression.
[0057] Experimental results show that DOX induces increased MBX expression and promotes... hiPSCs are derived from MKP proliferation. This can be controlled via DOX. The expression of MKP regulates its proliferation and differentiation. A). To evaluate the structure constructed in this study The response of hiPSC cells to DOX-induced signals was verified by selecting correctly identified positive clones (#1-1). During the iPSC stage, uniform expression distribution of DOX-ON cells was observed under a fluorescence microscope. Fluorescent signal; however, no fluorescence signal was observed in the non-DOX group. Fluorescent expression ( B). Further detection was performed using real-time quantitative PCR. The mRMA expression levels of the three factors were as follows: C~E), DOX-ON group and The mRNA expression levels were 14.78±1.28 (P<0.0001), 7.87±0.24 (P<0.0001), and 6.70±0.11 times (P=0.001) in the WT group, respectively; no significant difference was observed in the expression of the above genes between the non-DOX group and the WT group. Subsequently, hiPSCs were oriented to differentiate into MK cells. In the DOX-ON group, 2 μg / mL DOX was added to the differentiation medium starting from day 12 of differentiation. Fluorescence microscopy images showed that the DOX-ON group cells maintained proliferation even after 30 days of culture and 5 passages, and exhibited [further details needed]. Continuous and stable expression ( F). Wright-Gymsa staining results showed that on day 18 of differentiation, the DOX-ON group still maintained the morphological characteristics of megakaryotic progenitor cells, while the non-DOX group and WT group showed the morphological characteristics of mature megakaryotic cells with enlarged cell bodies and lobed nuclei. G). Flow cytometry was used to detect DNA ploidy and the expression of CD41a and CD42b. (G, H), the results showed that the DOX-ON group exhibited megakaryotic progenitor cell characteristics (the proportion of cells with DNA ploidy greater than 4N was 5.0%, CD41a + CD42b - The cell proportion was 48.1%, CD41a + CD42b + The proportion of cells with DNA ploidy greater than 4N was 10.9%; while the non-DOX group was able to differentiate into mature megakaryocytes (the proportion of cells with DNA ploidy greater than 4N was 17.9%, CD41a). + CD42b - The cell proportion was 22.3%, CD41a + CD42b + The cell proportion was 40.7%; however, after DOX removal (DOX-OFF), the cells were able to differentiate normally from the progenitor stage into mature megakaryocytes (CD41a). + CD42b - The cell proportion was 19.9%, CD41a + CD42b + The cell proportion was 33.5%.
[0058] The above results suggest that DOX induces... hiPSC system Overexpression of MKP promotes its proliferation during differentiation and does not affect MKP maturation after removal.
[0059] (2) Results Analysis This study successfully used CRISPR-Cas9-mediated HDR technology to study the hiPSC genome. and The dual-safe-harbor site completed the Tet-On control system and The stepwise and precise integration of immortalization elements enabled the construction of a Dox-controlled induced immortalized MKP potential hiPSC line. The innovative value of this strategy is systematically explained from three dimensions: genome safety, controllability of the induction system, and feasibility of the technical route. The research limitations and future application directions are also objectively analyzed.
[0060] (2.1) Precise integration of safe harbor sites improves the biosafety and expression determinism of seed cells at the genomic level. Compared to previous lentivirus and retrovirus-mediated random integration strategies, this study adopted... and A dual-safety-harbor precise integration strategy enhances the genomic safety and expression determinism of exogenous gene introduction. Previous studies have shown that while random viral integration can achieve efficient expression of exogenous genes, it easily leads to insertional mutations and expression silencing of endogenous genes. Furthermore, it presents problems such as chromatin environment-dependent expression instability at the integration site, viral element residue, and uncontrollable integration copy number, which are detrimental to the quality control and standardized construction of seed cells. Combining this with CRISPR-Cas9-mediated HDR technology can further achieve precise targeted integration at these sites. In this study, combining PCR and Sanger sequencing results confirmed that Tet-On regulatory elements and... The effect elements are precisely integrated into and The expected location of the site and the integration junction sequence perfectly match the design, with no base mismatches, insertions, or deletions, achieving site-controllable and precise integration of exogenous genes. For hiPSCs, intended as "seed cells" for large-scale in vitro platelet production, this approach avoids the potential safety risks of random viral integration at the genomic level, reduces the genetic heterogeneity of cell lines, and better meets the quality control requirements and standardized construction needs of clinical-grade cell products.
[0061] (2.2) Implementation of dual-donor plasmid dual-module separation design Controllable expression of factors The core technical challenge in building the immortalized MKP system lies in achieving... Precise temporal and tropic control of the three factors: Synergistic expression of the three factors can drive the immortalization and expansion of MKP, while sustained expression significantly inhibits polyploid maturation and platelet release in megakaryocytes. Therefore, low leakage and high responsiveness of the induction system are crucial for cell line function. Previous studies have often constructed the regulatory and effector elements of the Tet-On system in the same vector, which easily leads to interference between cis-regulatory elements and basal leakage expression caused by upstream gene readthrough, severely affecting the precision of the induction system. To achieve... For precise temporal and climatic control of the three factors, this study adopted a design approach that separates the regulation and effect modules, integrating the Tet-On system... Control elements integrated into site, will The driven effect module is integrated into The site, through physical separation at the genome level, effectively eliminated the mutual interference between cis-regulatory elements. Furthermore, by introducing a polyA terminator between the upstream gene and the inserted sequence, and employing a reverse insertion design for the effector element, basal leakage expression caused by upstream gene readthrough and abnormal interactions with the genome sequence were further blocked. Experimental results confirmed that without the addition of Dox, the cell line showed no significant... Fluorescent expression, The mRNA levels of the three factors were not significantly different from those of wild-type hiPSCs; however, after Dox induction... The cells exhibited stable fluorescence expression and significantly upregulated transcriptional levels of the three factors. Furthermore, the induction system maintained excellent Dox responsiveness throughout the entire process of hiPSC differentiation into MKP cells. More importantly, under continuous Dox induction, MKP cells achieved stable in vitro expansion, and upon Dox withdrawal, the cells further differentiated and matured, producing platelet-like structures. This result fully demonstrates the high precision and controllability of the induction system constructed using this strategy.
[0062] (2.3) Stepwise liposome transfection protocol improves the feasibility of precise multi-site editing of hiPSCs The high efficiency of hiPSC cell line establishment through precise integration at two sites depends not only on the rational design of safe harbor sites and the optimization of the induced expression architecture, but also on plasmid delivery systems and positive clone enrichment protocols adapted to the biological characteristics of hiPSCs. While traditional viral delivery systems can achieve efficient introduction of exogenous plasmids, they suffer from complex procedures, the risk of random genome integration, and viral element residues, significantly increasing the compliance threshold and safety risks for subsequent clinical translation of cell lines. Therefore, this study employed a non-viral transfection method throughout the entire process to deliver the CRISPR-Cas9 system and homologous recombination donor plasmid.
[0063] In the application of genome editing targeting hiPSCs, the generally low efficiency of CRISPR-Cas9-mediated HDR homologous recombination is a common problem, especially when facing multi-site targeting, where the selection of positive clones often restricts the acquisition of target cell lines. To address this issue, this study added an antibiotic selection tag to the insert cassette of the donor plasmid, enriching target clones through antibiotic screening, thus reducing the difficulty of cell line establishment. Building on this, to further shorten the cell line establishment cycle, a strategy of simultaneous co-transfection at two sites combined with simultaneous screening with two antibiotics was attempted. However, preliminary experimental results showed that even with the initial enrichment of transfected positive cells based on the antibiotic tag, it was still difficult to obtain positive single clones with precise integration at both sites. This may be related to the extremely low probability of simultaneous HDR events at both sites in hiPSCs. Therefore, this study ultimately adopted a strategy of "first..." ,back The two-step editing process, using hygromycin and puromycin for stepwise screening, with PCR and sequencing verification after each round of screening, ultimately yielded the target cell line. This strategy demonstrates that when integrating exogenous fragments into multiple gene loci using CRISPR-Cas9-mediated HDR technology on hiPSCs, stepwise transfection combined with screening tags helps improve the enrichment efficiency and screening feasibility of target clones. This transfection strategy can provide a reference for the construction of similar cell lines.
[0064] In summary, this study proposes a CRISPR-Cas9-mediated HDR technology... and Dual-safe-harbor site-specific stepwise targeted integration of Tet-On regulatory system and The three-factor construction strategy not only makes up for the technical limitations of random integration of traditional viral vectors, providing a safer and more controllable seed cell scheme for constructing hiPSC lines with the differentiation potential of immortalized megakaryocyte progenitor cells with clinical application potential, but also provides a replicable and scalable technical paradigm for the precise and controllable gene editing and functional modification of pluripotent stem cell-derived functional cell lines.
[0065] Comparative Example 1: Evaluation of Cell Transfection System Efficiency To screen non-viral transfection systems suitable for hiPSC, the plasmid delivery efficiency of liposome transfection and electroporation transfection was compared in parallel. All transfection plasmids were... (With EGFP reporter gene), the specific method is as follows.
[0066] Electroporation transfection Transfection was performed using a Lonza 4D-Nucleofector transfector. HiPSC-B1 cells in the logarithmic growth phase with 60%-70% confluence were collected. Single-cell suspensions were prepared by Accutase digestion, and cells were collected by centrifugation at 300×g for 5 min at room temperature. The cell volume used in a single electroporation was 2×1026 The total volume of the electroporation system was 100 μL: 82 μL nuclear transfer buffer, 12 μL of matching auxiliary agents, 6 μg of endotoxin-free plasmids, and enzyme-free water to make up the volume. The contact time between cells and the nuclear transfer system was controlled within 10 min, and the hiPSC-specific CA-137 program was used for electroporation. Immediately after electroporation, 500 μL of PGM1 medium containing 10 μmol / L Y-27632, preheated at 37℃, was added, and the cells were incubated at 37℃ for 5 min. Then, the cells were injected at a rate of 1×10⁻⁶ cells / mL. 6 The cells were seeded at a density of cells / well into Matrigel-coated 6-well plates and incubated at 37°C in a 5% CO2 incubator.
[0067] Liposome transfection One day before transfection, hiPSC-B1 cells were loaded at 3×10⁻⁶ cells per cell line. 5 Cells were seeded at a density of 1 cell / well in Matrigel-coated 6-well plates, and PGM1 medium containing 10 μmol / L Y-27632 was added. Cells were cultured until confluence reached 30%-60%, at which point transfection was performed. The transfection complex consisted of 250 μL Opti-MEM medium, 6 μg endotoxin-free plasmid, and 12 μL Lipofectamine Stem transfection reagent (reagent to plasmid mass ratio 2:1). The mixture was vortexed and incubated at room temperature for 15 min. The complex was then slowly added dropwise to the cell culture wells, gently mixed, and incubated at 37 ℃ in a 5% CO2 incubator.
[0068] Next, transfection efficiency was assessed and the cell culture system was determined. Twenty-four hours after transfection, both groups of cells were replaced with fresh PGM1 medium without Y-27632. Forty-eight hours after transfection, the cells were observed using a fluorescence microscope. Expression status, flow cytometry detection The proportion of positive cells was used to evaluate the transfection efficiency of the two methods. Considering the ease of operation, cell state maintenance, and transfection efficiency, the liposome transfection method was ultimately chosen for the formal experiments.
[0069] To screen for non-viral plasmid delivery systems suitable for hiPSC, this study compared the delivery efficiencies of liposome transfection and electroporation transfection in parallel. 48 h after transfection, fluorescence microscopy revealed a large number of plasmids in both groups. Positive cells with uniform fluorescence signal distribution ( A) Flow cytometry quantitative analysis results showed that the liposome transfection group The positive cell rate was 39.0% ± 0.23%, and in the electroporation transfection group it was 42.03% ± 1.05%. Both methods (B and 6C) demonstrate good plasmid delivery capabilities. Considering the ease of operation, cell state maintenance, and transfection efficiency, liposome transfection was used as the plasmid delivery method for subsequent two-site targeted integration experiments.
[0070] This study compared the efficacy of two mainstream methods: liposome transfection and electroporation transfection. The results showed that both methods could achieve efficient plasmid delivery to hiPSCs, with the positive rate in the electroporation transfection group slightly higher than that in the liposome transfection group (42.03%±1.05% vs 39.0%±0.23%). However, the experiment revealed that electroporation transfection caused significant cell damage to hiPSCs, easily leading to massive cell death. Furthermore, it was costly and highly dependent on equipment. Since this study required two rounds of continuous homologous recombination editing, repeated electroporation stimulation would further exacerbate cell damage, severely affecting the maintenance of hiPSC stem cell characteristics and clonogenic ability, making it unsuitable for the two-site stepwise editing technical route. Considering transfection efficiency, cell viability maintenance, ease of operation, and compatibility with the two-round editing process, liposome transfection was ultimately chosen as the plasmid delivery method for this study.
[0071] The above descriptions are merely embodiments of the present invention, and common knowledge regarding specific structures and characteristics is not elaborated upon here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the structure of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.
Claims
1. A method for constructing immortalized megakaryocyte progenitor cell line hiPSCs based on the CRISPR / Cas9-mediated homology-directed repair pathway, characterized in that: S1: Use px458-sgROSA26 sgRNA plasmid and pROSA26-CAG-M2rtTA Donor plasmids were transfected into hiPSC-B1 cells using liposome transfection, followed by antibiotic selection to obtain... CAG-M2rtTA hiPSC; S2: Use px458-sgAAVS1 sgRNA plasmid and pAAVS1-TRE-MBX-EGFP donor plasmids were transfected using liposome transfection. CAG-M2rtTA hiPSC, after resistance selection, obtained CAG-M2rtTA / TRE-MBX hiPSC; in, px458-sgROSA26 sgRNA plasmid and px458-sgAAVS1 sgRNA plasmids are used to provide targeted... ROSA26 site and AAVS1 sgRNA at the site; pROSA26-CAG-M2rtTA The nucleotide sequence of the donor plasmid is shown in SEQ ID NO.5; pAAVS1-TRE-MBX-EGFP The nucleotide sequence of the donor plasmid is shown in SEQ ID NO.
6.
2. A method for constructing immortalized megakaryocyte progenitor cell line hiPSCs based on the CRISPR / Cas9-mediated homology-directed repair pathway, characterized in that: In S1, hiPSC-B1 cells were seeded in Matrigel-pre-coated culture wells and cultured in PGM1 medium containing Y-27632 until cell confluence reached 30%-60%; next, a medium containing Y-27632 was added. px458- sgROSA26 sgRNA plasmid and pROSA26-CAG-M2rtTA Transfection was performed using a liposome transfection system containing the donor plasmid; after transfection, cells were screened for resistance using PGM1 medium containing hygromycin B for 7-10 days; surviving cells were then expanded and identified through integration to obtain... CAG-M2rtTA hiPSC.
3. The method for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway according to claim 2, characterized in that: In S2, CAG-M2rtTA hiPSC cells were seeded in Matrigel-pre-coated wells and cultured in PGM1 medium containing Y-27632 until cell confluence reached 30%-60%; next, a medium containing Y-27632 was added. px458-sgAAVS1 sgRNA plasmid and pAAVS1-TRE-MBX-EGFP Transfection was performed using a liposome transfection system containing the donor plasmid; after transfection, cells were screened for resistance using PGM1 medium containing puromycin for 7-10 days; surviving cells were then expanded and identified for integration, yielding cells with dual-site integration. CAG-M2rtTA / TRE-MBX hiPSC.
4. The method for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway according to claim 3, characterized in that: Also includes S3: CAG-M2rtTA / TRE-MBX hiPSC cells were cultured for doxycycline-based induced differentiation to obtain megakaryocyte progenitor cells.
5. The method for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway according to claim 4, characterized in that: The method for obtaining megakaryotic progenitor cells is as follows: CAG-M2rtTA / TRE- MBX hiPSC cells were seeded in Matrigel-coated wells and cultured in PGM1 medium containing Y-27632; then, the medium was replaced with StemPro-34 SFM as the basal medium for further culture. From the time the culture medium was changed until day 4, rhBMP-4 and rhVEGF were added to the basal culture medium; From day 4 to day 12, rhSCF, rhTPO, and rhIL-3 were added to the basal culture medium to obtain CD34. + Hematopoietic stem cells; Day 12, collect CD34 + Hematopoietic stem and progenitor cells were suspended in MKP-induced amplification medium; MKP-induced amplification medium was supplemented with rhTPO, rhSCF, rhIL-3, rhIL-6, and doxycycline to form basal medium; cells were seeded into ultra-low adsorption culture plates for suspension culture and continued to be induced and amplified until day 30 of differentiation to obtain immortalized megakaryocyte progenitor cells.
6. The method for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway according to claim 5, characterized in that: Will CAG-M2rtTA / TRE-MBX hiPSC cells were seeded in Matrigel-coated wells and cultured in PGM1 medium containing 10 μmol / L Y-27632. From the time the culture medium was changed until day 4, 50 ng / mL rhBMP-4 and 50 ng / mL rhVEGF were added to the basal culture medium. From day 4 to day 12, 50 ng / mL rhSCF, 50 ng / mL rhTPO, and 25 ng / mL rhIL-3 were added to the basal culture medium to obtain CD34. + Hematopoietic stem cells; The MKP-induced amplification medium was prepared by adding 50 ng / mL rhTPO, 50 ng / mL rhSCF, 25 ng / mL rhIL-3, 20 ng / mL rhIL-6, and 2 μg / mL doxycycline to the basal medium.
7. A plasmid combination for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway, characterized in that: It includes sgRNA plasmids and homologous recombination donor plasmids; sgRNA plasmids include those that produce targets ROSA26 sgRNA plasmid A at the site, and the generation of sgRNA targeting AAVS1 sgRNA plasmid B at the site; Homologous recombination donor plasmids include homologous recombination donor plasmid A and homologous recombination donor plasmid B; homologous recombination donor plasmid A contains components for integration into... ROSA26 Tet-On system regulatory elements at the site M2rtTA Homologous recombination donor plasmid B contains components for integration into... AAVS1 tandem of sites c-MYC / BMI1 / BCL-XL Three-Factor and Tet-On System Response Elements TRE Promoter.
8. The plasmid combination for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway according to claim 7, characterized in that: Homologous recombination donor plasmid A contains the hygromycin B resistance gene. Hygro Homologous recombination donor plasmid B contains the puromycin resistance gene. Puro and enhanced green fluorescent protein gene EGFP ; Homologous recombination donor plasmid A contains PGK promoters and CAG promoter; PGK Promoter drives hygromycin B resistance gene Hygro Express; CAG Promoter control of Tet-On system control elements M2rtTA Transcription; Tandem in homologous recombination donor plasmid B c-MYC / BMI1 / BCL-XL The three factors include BCL-XL Gene, BMI1 Gene, c-MYC Gene; Enhanced green fluorescent protein gene EGFP , BCL-XL Gene, BMI1 Gene, c-MYC Genes, Tet-On system response elements TRE The promoters were all inserted in reverse into the homologous recombination donor plasmid B.
9. The plasmid combination for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway according to claim 8, characterized in that: Homologous recombination donor plasmid A provides for insertion ROSA26 The fragment structure at the site is: 5' homologous arm—hygromycin B resistance gene. Hygro — PGK promoter— CAG Promoter—Tet-On system control element M2rtTA —3' homologous arm; Homologous recombination donor plasmid B provides for insertion AAVS1 The fragment structure of the site is: 5' homologous arm—purinemycin resistance gene Puro —Polyadectophosphate polyA —Enhanced Green Fluorescent Protein Gene EGFP — BCL-XL Gene- BMI1 Gene- c-MYC Gene-Tet-On system response element TRE Promoter — 3' homologous arm.
10. The plasmid combination for constructing immortalized megakaryocyte progenitor cell potential hiPSC lines based on the CRISPR / Cas9-mediated homology-directed repair pathway according to claim 7, characterized in that: sgRNA plasmid A was obtained by the following method: the sequence is shown in SEQ ID NO.
3. sgROSA26 F and the sequence are shown in SEQ ID NO.
4. sgROSA26 R was annealed to obtain double-stranded DNA; pX458 The vector was digested with BbsI restriction endonuclease and ligated with double-stranded DNA. After transformation into competent cells, sgRNA plasmid A was obtained after screening. sgRNA plasmid B was obtained by the following method: the sequence is shown in SEQ ID NO.
1. sgAAVS1 F and the sequence are shown in SEQ ID NO.
2. sgAAVS1 R was annealed to obtain double-stranded DNA; pX458 The vector was digested with BbsI restriction endonuclease and ligated with double-stranded DNA. After transformation into competent cells, sgRNA plasmid B was obtained after screening. The nucleotide sequence of homologous recombination donor plasmid A is shown in SEQ ID NO.5; The nucleotide sequence of homologous recombination donor plasmid B is shown in SEQ ID NO.6.