An electrochemical nucleic acid detection system based on a dual DNA walker and its preparation method
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-06
- Publication Date
- 2026-08-14
AI Technical Summary
但是,目前,DNA 步行器与比率型电化学检测联用的研究较少,双 DNA步行器协同驱动用于肺炎支原体的检测研究仍为空白,因此开发新型协同驱动比率型传感器具有重要意义
Smart Images

Figure CN122564087A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of electrochemical nucleic acid detection technology, specifically relating to an electrochemical nucleic acid detection system based on a dual DNA walker and its preparation method. Background Technology
[0002] The statements herein provide only background information in relation to this invention and do not necessarily constitute prior art.
[0003] Mycoplasma pneumoniae (MP) primarily adheres to the host cell membrane to obtain nutrients, thereby damaging the cell membrane, interfering with normal cellular physiological activities, and ultimately causing pneumonia. In recent years, infections caused by Mycoplasma pneumoniae have increased significantly, having a greater impact on children, and exhibiting periodic epidemics. Real-time detection of Mycoplasma pneumoniae can help effectively suppress its spread.
[0004] DNA walkers are artificially synthesized DNA molecular machines that can autonomously walk along a predetermined path under specific driving forces to amplify signals. The driving forces of DNA walkers are mainly divided into enzyme-driven, non-protease-driven, and non-enzyme-driven forces. Common driving enzymes include ligases, restriction endonucleases, and nicking endonucleases. They drive the DNA walker by catalyzing the ligation, cleavage, and nicking reactions of DNA strands. This electrochemical sensing system requires the artificial addition of enzymes at each step, resulting in low automation and limiting the application of DNA walkers in the field of biosensors.
[0005] A deoxyribonuclease (DNAzyme) is a synthetically produced single-stranded DNA molecule with catalytic function. It consists of a substrate recognition arm and a catalytic core. The substrate recognition arm specifically binds to the substrate strand through complementary base pairing, while the catalytic core is located in the Mg²⁺ region. 2+ Na + or Pb 2+ With the assistance of metal ions, DNA walkers cleave specific sites on substrate chains (DNA or RNA), thereby catalyzing various biochemical reactions without protease dependence. They possess advantages such as high thermal stability, low synthesis cost, programmable sequences, and ease of chemical modification. However, current research on the combined use of DNA walkers and ratiometric electrochemical detection is limited, and research on the synergistic driving of dual DNA walkers for the detection of Mycoplasma pneumoniae remains unexplored. Therefore, developing novel synergistically driven ratiometric sensors is of great significance. Summary of the Invention
[0006] To address the shortcomings of existing technologies, the purpose of this invention is to provide an electrochemical nucleic acid detection system based on a dual DNA walker and its preparation method.
[0007] To achieve the above objectives, the present invention is implemented through the following technical solution: In a first aspect, the present invention provides a dual DNA walker comprising carboxyl magnetic nanoparticles MNPs, tethered W1AL and hairpin H1, wherein both tethered W1AL and hairpin H1 are connected to the surface of carboxyl-modified MNPs via amide bonds. W1 has binding sites for H1 to cut the head of H1 and expose the binding sites for H1; and the binding sites for H1 on W1 are closed by A and L through pairing.
[0008] Secondly, the present invention provides a method for preparing the dual DNA walker, comprising the following steps: Mix and dilute W1, A and L in a certain proportion to obtain mixture one; Heat the mixture and H1 solution separately to the set temperature, maintain for the set time, and then cool. The cooled mixture and H1 solution were added to the activated carboxyl magnetic nanoparticle MNPs dispersion in proportion. The W1AL and hairpin H1 were then incubated to allow W1AL and hairpin H1 to be attached to the surface of the carboxyl magnetic nanoparticles MNPs via amide bonds. The product can be washed and resuspended.
[0009] Thirdly, the present invention provides an electrochemical nucleic acid detection system based on a dual DNA walker, comprising the dual DNA walker, an AuE / H3-Fc sensing interface, and fuel chains H2 and H4-MB.
[0010] Fourthly, the present invention provides an electrochemical nucleic acid detection method based on a dual-DNA walker, comprising the following steps: An unknown concentration of Mycoplasma pneumoniae target T was mixed with the dispersion of a dual DNA walker and fuel chain H2, and the mixture was reacted in a shaker at 35-38°C for a set time. After the reaction was complete, the supernatant was removed by magnetic separation and resuspended in Tris buffer solution to obtain a dispersion. After mixing the dispersion with the H4-MB solution, drop it onto the AuE / H3-Fc sensing interface, incubate for a set time, and then perform an AC voltammetry test.
[0011] The beneficial effects achieved by one or more embodiments of the present invention described above are as follows: In this invention, a specific and conserved base sequence on the 23S rRNA of nucleotides (MP) is used as a target to design a nucleic acid detection strategy based on a dual DNA walker. This strategy includes a tethered DNA walker driven by a deoxyribozyme (DNAzyme) and a multi-legged DNA walker driven by a toehold-mediated strand displacement reaction (TMSDR). The cascade amplification of the detection signal is achieved through the synergistic effect of the two walkers, thereby constructing a novel electrochemical nucleic acid detection method that is free of nucleic acid amplification and protease, highly sensitive, specific, simple, rapid, and accurate.
[0012] Under optimal conditions, the sensor designed in this invention exhibits a linear range of 5 aM to 50 fM, a limit of detection (LOD) of 2.80 aM, and demonstrates good selectivity, reproducibility, and stability. It also showed excellent detection performance in the analysis of real samples. This sensing strategy shows great application potential in point-of-care testing (POCT) of MP (potentially malignant microscopy). Attached Figure Description
[0013] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0014] Figure 1 This is a schematic diagram of the electrochemical nucleic acid detection system using a dual DNA walker for the detection of MP. Figure 2 This is a polyacrylamide gel electrophoresis image of the sensor activation process. M; 1, W1; 2, A; 3, L; 4, W1AL; 5, H1; 6, W1 / H1; 7, H2; 8, LH2; 9, W2; 10, T; 11, W1AL+H1+H2; 12, W1AL+T+H1+H2; M is the DNA marker (20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 300, 400, 500 bp) (H2 chain concentration is 2 µM, and the average concentration of the remaining DNA chains is 500 nM, "+" indicates addition, "-" indicates no addition). Figure 3These are polypropylene gel electrophoresis images of the optimized H2 chain. M; 1, W1; 2, A; 3, L; 4, W1AL; 5, H1; 6, W1 / H1; 7, W1AL+H1+H2; 8, W1AL+T+H1+H2; 9, W1AL+H1+H2-1; 10, W1AL+T+H1+H2-1; 11, W1AL+H1+H2-2; 12, W1AL+T+H1+H2-2; 13, W1 AL+H1+H2-3; 14, W1AL+T+H1+H2-3; 15, W1AL+H1+H2-4; 16, W1AL+T+H1+H2-4; 17, W1AL+H1+H2-5; 18, W1AL+T+H1+H2-5; 19, W1AL+H1+H2-6; 20, W1AL+T+H1+H2-6, M is the DNA marker (20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 300, 400, 500 bp) (H2 chain and its optimized chain concentration is 2 µM, the average concentration of the remaining DNA chains is 500 nM, "+" indicates addition, "-" indicates no addition). Figure 4 This is a magnified schematic diagram of the shearing of the target strip region of H2 and its optimized chain; Figure 5 This is a polyacrylamide gel electrophoresis image of the sensor activation phase under optimal H2-2 chain conditions. M, 1, W1; 2, A; 3, L; 4, W1AL; 5, H1; 6, W1 / H1; 7, W2; 8, H2-2; 9, LH2-2; 10, T; 11, W1AL+H1+H2-2; 12, W1AL+T+H1+H2-2; M is the DNA marker (20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 300, 400, 500 bp) (H2 chain concentration is 2 µM, and the average concentration of other DNA chains is 500 nM; "+" indicates addition, "-" indicates no addition). Figure 6 This is a polyacrylamide gel electrophoresis image of the sensor signal output stage. M, 1, W2; 2, H3; 3, H4; 4, H3+H4; 5, W2+H3+H4; M is the DNA marker (20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 300, 400, 500 bp) (W2 chain concentration is 2 µM, and the average concentration of the remaining DNA chains is 500 nM, "+" indicates addition, "-" indicates no addition). Figure 7 (A) TEM images of MNPs and MNP@(W1AL / H1) (B); (C) STEM and elemental distribution map of MNP@(W1AL / H1); Figure 8 This is a comparison chart of Zeta potentials; Figure 9 The UV-Vis absorption spectra of W1AL / H1 before and after the reaction with MNPs are shown. Figure 10 It is an electrochemical impedance spectroscopy energy quist plot of the electrode surface after stepwise modification (containing 5.0 mM [Fe(CN)6]3). / 4 (In 0.1 M KCl) Figure 11 It is (A) the ACV response curve of the control experimental group; (B) I MB / I Fc Ratio histogram, a: multi-legged DNA walker 0 aMT; b: multi-legged DNA walker 50 aMT; c: multi-legged DNA walker 50 fMT; d: monopod DNA walker 50 fMT; f: non-tethered multi-legged DNA walker 50 fMT; Figure 12 (A) ACV response curves of W1AL and H1 at different concentration ratios; (B) I MB / I Fc Ratio line graph; Figure 13 In the middle, (A) ACV response curves of MNP@(W1AL / H1) at different concentrations; (B) I MB / I Fc Ratio line graph; Figure 14 In the image, (A) the ACV response curve of DNAzyme incubation time; (B) I MB / I Fc Ratio line graph; Figure 15 In the middle, (A) the ACV response curve of MNPs@(W1AL / H1) walk time; (B) I MB / I Fc Ratio line graph; Figure 16 In the image, (A) the response curves of the ACV of target T at different concentrations were measured using a ratiometric electrochemical biosensor; (B) I MB / I Fc With logC T Linear relationship of (M); Figure 17 In the middle, (A) evaluate the ACV response curve of the sensor selectivity; (B) evaluate the I of the sensor selectivity. MB / I Fc Ratio histogram; Figure 18In the image, (A) the ACV response curve for evaluating sensor reproducibility; (B) the I-value for sensor reproducibility. MB / I Fc Ratio histogram; Figure 19 In the image, (A) the ACV response curve for evaluating sensor stability; (B) the I-value for sensor stability. MB / I Fc Ratio histogram; Figure 20 In the table, (A) the ACV curve of the sample added to the oral swab sample of a normal person; (B) the linear fitting equation of the sample added to the oral swab sample of a normal person; (C) the detection results of seven actual samples (bar chart: left axis; circle; right axis). Detailed Implementation
[0015] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0016] Common clinical detection methods for Mycoplasma pneumoniae include pathogen culture, serological methods, and polymerase chain reaction (PCR). However, each method has limitations. Pathogen culture has a long culture period, thus lacking clinical timeliness; serological methods rely on antibody detection, typically requiring up to one week after infection to detect Mycoplasma pneumoniae antibodies, and a single positive antibody test cannot determine whether it is a past or recent infection; PCR methods may yield false positives, and the equipment is expensive, making it difficult to implement in primary care hospitals.
[0017] Therefore, there is an urgent need to develop a new method for detecting Mycoplasma pneumoniae (MP) that simultaneously meets the requirements of sensitivity, simplicity, speed, and low cost, enabling real-time detection. Electrochemical biosensing technology, with its advantages of high detection sensitivity, simple operation, rapid response, portable instruments, and low cost, has become a popular research direction for the rapid detection of pathogenic microorganisms. This technology is evolving from a single-signal response with poor reproducibility to a dual-signal response with excellent stability, anti-interference ability, and a wide detection range. To further amplify the signal and improve sensitivity, electrochemical biosensors are often combined with DNA walkers.
[0018] A DNA walker is a synthetically produced DNA molecular machine that can autonomously walk along a predetermined path under specific driving force to amplify signals. It mainly consists of three core components: the walking path, the walking chain, and the driving force. Based on spatial dimensions, the walking paths of DNA walkers are classified as 1D (e.g., carbon nanotubes), 2D (e.g., planar electrodes), and 3D (e.g., magnetic beads, gold nanoparticles). Based on the number of walking chains, DNA walkers can be classified into monopodial, bipodial, and multipodial types. The driving force of DNA walkers is mainly divided into enzyme-driven, non-protease-driven, and non-enzymatic-driven forces. Common driving enzymes include ligases, restriction endonucleases, and nicking endonucleases, which drive the DNA walker's movement by catalyzing the ligation, cleavage, and nicking reactions of DNA chains. This electrochemical sensing system requires the artificial addition of enzymes at each step, resulting in low automation and limiting the application of DNA walkers in the field of biosensors. Although the introduction of nicking endonucleases enables automated autonomous walking, they are expensive and easily affected by environmental conditions.
[0019] This invention uses a specific and conserved sequence on the 23S rRNA of Myxobolus leptospira (MP) as a target, prepares a multi-legged DNA walker using magnetic nanoparticles as a carrier, and modifies its surface with tethered walking chains. This strategy allows for purification via magnetic separation, and the rational chain design simplifies the cleaning and operational steps of the detection process. Finally, a sensitive and rapid ratiometric signal output is achieved using an electrochemical workstation, providing a new method for the early diagnosis of MP infection and laying the theoretical foundation for its point-of-care testing (POCT) application.
[0020] In a first aspect, the present invention provides a dual DNA walker comprising carboxyl magnetic nanoparticles MNPs, tethered W1AL and hairpin H1, wherein both tethered W1AL and hairpin H1 are connected to the surface of carboxyl-modified MNPs via amide bonds. W1 has binding sites for H1 to cut the head of H1 and expose the binding sites for H1; and the binding sites for H1 on W1 are closed by A and L through pairing.
[0021] In some embodiments, the nucleotide sequence of W1 is as shown in SEQ ID No. 1; The nucleotide sequence of A is shown in SEQ ID No. 2; The nucleotide sequence of L is shown in SEQ ID No. 3; The nucleotide sequence of H1 is shown in SEQ ID No. 4.
[0022] Secondly, the present invention provides a method for preparing the dual DNA walker, comprising the following steps: Mix and dilute W1, A and L in a certain proportion to obtain mixture one; Heat the mixture and H1 solution separately to the set temperature, maintain for the set time, and then cool. The cooled mixture and H1 solution were added to the activated carboxyl magnetic nanoparticle MNPs dispersion in proportion. The W1AL and hairpin H1 were then incubated to allow W1AL and hairpin H1 to be attached to the surface of the carboxyl magnetic nanoparticles MNPs via amide bonds. The product can be washed and resuspended.
[0023] In some embodiments, the molar ratio of W1, A and L is 0.8-1.2:0.8-1.2:0.8-1.2.
[0024] Preferably, the molar ratio of W1, A and L is 0.9-1.1:0.9-1.1:0.9-1.1.
[0025] Further preferably, the molar ratio of W1, A and L is 1:1:1.
[0026] In some embodiments, the heating temperature is 85-95°C and the heating time is 5-15 minutes.
[0027] Preferably, the heating temperature is 87-92℃ and the heating time is 7-12 minutes.
[0028] Specifically, the heating temperature is 90°C and the heating time is 10 minutes.
[0029] In some embodiments, after adding the mixture and H1 solution to the activated carboxyl magnetic nanoparticle (MNP) dispersion, the concentration ratio of W1AL to H1 is 1:15-25, preferably 1:19-21, and more preferably 1:20.
[0030] In some embodiments, the incubation temperature is 3-5°C and the incubation time is 8-24 hours.
[0031] Thirdly, the present invention provides an electrochemical nucleic acid detection system based on a dual DNA walker, comprising the dual DNA walker, an AuE / H3-Fc sensing interface, and fuel chains H2 and H4-MB.
[0032] In some embodiments, the nucleotide sequence of H2 is shown in SEQ ID No. 6; The nucleotide sequence of H4 is shown in SEQ ID No. 9.
[0033] In some embodiments, the method for preparing the AuE / H3-Fc sensing interface is as follows: The gold electrode is polished to a mirror finish using an alumina paste. The polished gold electrode was rinsed sequentially with anhydrous ethanol and ultrapure water. Cyclic voltammetry scans were performed on the gold electrode in sulfuric acid solution until a stable cyclic voltammetric curve was obtained. The electrode was then cleaned to obtain the activated gold electrode. H3 was reduced using a tri(2-chloroethyl) phosphate TCEP solution; The reduced H3 solution was added dropwise to the surface of the activated gold electrode and incubated for a set time to allow H3 to be fixed on the surface of the gold electrode through Au-S bonds. After overnight treatment, the gold electrode was cleaned and then the blocking agent MCH was added to block the excess active sites on the surface of the gold electrode. The electrode was cleaned with Tris buffer solution to obtain the AuE / H3-Fc sensing interface.
[0034] Preferably, the potential range of the cyclic voltammetric scan is -0.2 V to +1.6 V.
[0035] Fourthly, the present invention provides an electrochemical nucleic acid detection method based on a dual-DNA walker, comprising the following steps: An unknown concentration of Mycoplasma pneumoniae target T was mixed with the dispersion of a dual DNA walker and fuel chain H2, and the mixture was reacted in a shaker at 35-38°C for a set time. After the reaction was complete, the supernatant was removed by magnetic separation and resuspended in Tris buffer solution to obtain a dispersion. After mixing the dispersion with the H4-MB solution, drop it onto the AuE / H3-Fc sensing interface, incubate for a set time, and then perform an AC voltammetry test.
[0036] In some embodiments, the target T is a 23S rRNA fragment of Mycoplasma pneumoniae with the deoxynucleotide sequence CAAGAAAGUAAGAGCCGUCAAAG.
[0037] In some embodiments, the reaction time in the shaker is 60-100 min, preferably 70-90 min.
[0038] The present invention will be further described below with reference to the embodiments.
[0039] Example Experimental reagents and materials Tris(2-carboxyethyl)phosphonic hydrochloride, 6-mercapto-1-hexanol and N-hydroxythiosuccinimide sodium salt were all purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.
[0040] Sodium chloride, magnesium chloride, sodium hydroxide, potassium ferricyanide, potassium ferrocyanide, and potassium chloride were all purchased from Sinopharm Chemical Reagent Co., Ltd.
[0041] Carboxyl magnetic nanoparticles were purchased from Beijing Bio-Tech Biotechnology Co., Ltd.
[0042] 6× glycerol gel loading buffer and all nucleic acid sequences were purchased from Shanghai Sangon Biotech Co., Ltd.
[0043] The 20 bp DNA Ladder Marker was purchased from Takara Biotechnology Ltd.
[0044] Hydrochloric acid and concentrated sulfuric acid were purchased from Yantai Far East Fine Chemical Co., Ltd.
[0045] Anhydrous ethanol was purchased from Tianjin Fuyu Fine Chemical Co., Ltd.
[0046] Ethyl[3-(dimethylamino)propyl]carbodiimide hydrochloride was purchased from BBI Life Sciences Ltd.
[0047] The 30% acrylamide solution was purchased from Shanghai Beyotime Biotechnology Co., Ltd.
[0048] The nucleic acid extraction kit was purchased from Beijing Mairuida Technology Co., Ltd.
[0049] Ultrapure water provided by Sichuan Youpu Ultrapure Technology Co., Ltd. was used throughout the entire experiment.
[0050] The actual samples of Mycoplasma pneumoniae infection were taken from Qilu Hospital of Shandong University (Jinan, Shandong Province).
[0051] The buffer solution used in this invention is prepared from DEPC water.
[0052] The DNA and its sequence used in this invention are shown in Table 1.
[0053] Table 1
[0054] Note: 'r' in the sequence refers to the cut-off site.
[0055] Experimental instruments All electrochemical tests were performed using a CHI 660E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd.).
[0056] Zeta potentials were measured using Zetasizer nanoinstruments (Malvern Instruments Ltd., UK).
[0057] The TU-1901 dual-beam UV-Vis spectrophotometer is used to collect UV absorption spectra (Beijing Purkinje General Instrument Co., Ltd.).
[0058] MNPs and MNP@(W1AL / H1) were obtained by imaging with the FEI Talos F200x (Thermo Fisher Scientific, Inc.).
[0059] Electrophoresis experiments and imaging were performed using a DYCZ-24F electrophoresis apparatus (Beijing Liuyi Biotechnology Co., Ltd.) and a Tanon-2500R gel imaging system (Shanghai Tianneng Technology Co., Ltd.).
[0060] All centrifugation operations were performed using a TGL-16 benchtop high-speed refrigerated centrifuge.
[0061] Gel electrophoresis experiment First, the glass plates were washed sequentially with tap water, dish soap, and ultrapure water. After washing, the glass plates were wiped with ultrapure water, anhydrous ethanol, and ultrapure water, respectively, and then allowed to air dry. The dried glass plates were then installed in the gel casting holder and secured with clips. Next, a 12% polyacrylamide gel was prepared, stirred for 3 minutes, and immediately poured into the prepared glass plates. A comb was inserted, and the gel was allowed to stand at room temperature for about 4 hours until it was completely solidified. The comb was removed, and the glass plates and gel were placed in the electrophoresis apparatus. An appropriate amount of 1×TBE buffer (1000 mL ultrapure water, 10.8 g Tris, 0.744 g EDTA, 5.5 g boric acid) was added.
[0062] Add 2 μL of 6×glycerol gel loading buffer to each centrifuge tube containing 10 μL of sample, mix well, and then load the sample sequentially into the gel wells. Set the electrophoresis apparatus parameters to a constant voltage of 330 V and 24 mA, and perform electrophoresis for 1 h. After electrophoresis, remove the gel and place it in a container containing 0.01% 10000 The cells were stained with GelRed nucleic acid dye in ultrapure water for 30 minutes in the dark, and then placed in a gel imaging instrument for imaging.
[0063] Preparation of MNPs@(W1AL / H1) complex First, carboxyl magnetic nanoparticles (MNPs) were activated. 10 μL of thoroughly mixed MNPs (10 mg / mL) at room temperature was transferred to a centrifuge tube and washed three times with MEST buffer (20 mM MES buffer, pH 5.0, containing 0.05% Tween 20), removing the supernatant after each wash followed by magnetic separation. Next, the washed MNPs were resuspended in MEST buffer containing EDC and NHS at a molar ratio of MNPs:EDC:NHS = 1:5:5 and activated by shaking at 25 °C for 3 h. After activation, the MNPs were washed three times with Tris buffer and diluted to 2 mg / mL for immediate use in subsequent experiments.
[0064] Equal volumes and concentrations of W1, A, and L were added to centrifuge tubes and diluted to 5 μM with Tris buffer (20 mM Tris, 100 mM NaCl, 15 mM MgCl2). In another centrifuge tube, 100 μM H1 was added. The solutions in both tubes were vortexed and heated to 90 °C for 10 min in a PCR instrument, then allowed to cool naturally to room temperature. Annealed W1AL and H1 were added to the activated MNPs solution at a 1:20 ratio (0.2 μM W1AL, 4 μM H1), and incubated overnight at 4 °C to allow W1AL and H1 to bind to the MNPs surface via amide bonds. After incubation, the unbound DNA was removed by magnetic separation and washed three times with Tris buffer. The MNPs were then resuspended in Tris buffer and stored at 4 °C, named MNPs@(W1AL / H1).
[0065] Preparation of AuE / H3-Fc sensing interface The pretreatment method for the gold electrode is as follows: First, the gold electrode is polished approximately 100 times with a 0.05 μm alumina slurry until a mirror finish is achieved. The electrode is then rinsed sequentially with anhydrous ethanol and ultrapure water. Next, cyclic voltammetry (CV) is performed on the gold electrode in 0.5 M H₂SO₄ solution at a scan rate of 0.1 V / s, with a potential range of -0.2 V to +1.6 V, until a stable cyclic voltammogram is obtained. Finally, the electrode is rinsed with ultrapure water and stored at 4 °C for later use.
[0066] At room temperature, 2 μM H3 was reduced with 200 μM tris(2-chloroethyl) phosphate (TCEP) solution for 2 h to open the disulfide bonds of the thiol groups. Then, 5 μL of the reduced H3 solution was added dropwise to the surface of the activated gold electrode and incubated overnight at 4 °C to immobilize H3 on the gold electrode surface through Au-S bond interactions. After overnight treatment, the gold electrode was cleaned, and 10 μL of 1 mM blocking agent 6-mercapto-1-hexanol (MCH) was added dropwise for 1 h to occupy excess active sites on the gold electrode surface and prevent non-specific adsorption. The electrode was washed three times with Tris buffer solution to complete the construction of the sensing interface, named AuE / H3-Fc (Fc being ferrocene).
[0067] Quantitative analysis of target T First, an unknown concentration of Mycoplasma pneumoniae target T (the 23S rRNA fragment of MP) was mixed with 2 mg / mL MNPs@(W1AL / H1) and excess fuel chain H2, and reacted in a shaker at 37 °C for 80 min. After the reaction, the supernatant was removed by magnetic separation and resuspended in Tris buffer. 2 μM H4-MB (MB is methylene blue) was mixed with this solution and added dropwise to the AuE / H3-Fc surface. The mixture was incubated at room temperature for 2 h. Finally, alternating current voltammetry (ACV) was performed in deoxygenated Tris buffer with the following parameters: frequency 25 Hz, scan potential range -0.6 V to +0.6 V, and amplitude 25 mV.
[0068] Results and Discussion Sensor design principles The activation and signal transduction processes of the electrochemical biosensor constructed in this invention are as follows: Figure 1 As shown.
[0069] Regarding the sensor activation process: The multi-legged DNA walker designed in this invention comprises two amino-modified walking chains, tethered type W1AL and hairpin type H1. Both walking chains are linked to the surface of carboxyl-modified MNPs via amide bonds. The stem of hairpin H1 blocks the binding site, and W1 (DNAzyme) in W1AL can cleave the head of H1, thereby opening H1 and exposing the binding site of its stem, thus activating the walker. In the absence of target substance T, the binding site of W1 is blocked by A and L, effectively preventing "leakage". When target substance T is present, T first replaces A from W1AL through a chain substitution reaction, exposing a new foothold on W1; simultaneously, H2 undergoes base pairing with the new foothold, performing a chain substitution reaction to replace the L chain, resulting in the LH2 hybrid chain, and releasing A, T, and W1. Then the binding site of W1 and H1 is exposed, and base pairing occurs, achieving cleavage of the H1 chain. Because W1 has a long, flexible end, the W1 walking chain can walk freely on the surface of MNPs, thereby activating the sensor.
[0070] For the signal transduction process of the sensor, the hairpin H3-Fc is first fixed to the surface of the bare gold electrode via Au-S bonds. Then, unoccupied active sites are blocked using 1 mM MCH to suppress non-specific adsorption. Finally, the activated multi-legged DNA walker and the fuel chain H4-MB are mixed and introduced into the sensing interface. The DNA walker opens the hairpin structure of H3-Fc, exposing a new foothold, which H4-MB then binds to, driving the DNA walker's movement. During the walker's movement, H3-Fc and H4-MB exhibit decreasing and increasing electrochemical response signals, respectively, with inverse changes, further amplifying the output signal and thus achieving ratiometric electrochemical detection of the target analyte T.
[0071] This sensing strategy not only enables sensing and detection using DNAzymes under isothermal conditions without proteases, offering advantages such as ease of operation and low cost, but also leverages the ratiometric signals generated by Fc and MB molecules to reduce background interference and improve detection sensitivity. Therefore, this electrochemical biosensing strategy holds promise for achieving ultrasensitive detection of target molecule T and demonstrates significant application potential.
[0072] Nucleic acid sequence design and optimization First, the activation process of the sensor was verified using 12% polyacrylamide gel electrophoresis. Figure 2 As shown, lanes 1-5 are W1 (DNAzyme), A, L, W1AL and H1, respectively; lane 7 is H2; lane 9 is W2; lane 10 is T; lane 6 is a mixed solution of W1 and H1. The results show that in addition to the bands corresponding to W1 and H1, there is an extra band with a faster migration rate (denoted as W3), indicating that W1 can cleave H1, resulting in the W3 fragment with a smaller molecular weight and fewer bases.
[0073] Lane 8 is a mixed solution of L and excess H2. Compared with lanes 3 and 7 (Lane 3 and Lane 7) containing only L, the L band disappears and the H2 band becomes less bright, proving that L and H2 form an LH2 hybrid chain through complementary base pairing.
[0074] Lane 11 is a mixed solution of W1AL, H1 and excess H2. It can be seen from this lane that in addition to the bands of W1AL, H1 and H2, there are also bands of LH2, W1, A and W3. This indicates that the system has undergone a non-specific cleavage reaction and "leakage" has occurred even without the addition of the target substance T.
[0075] Lane 12 is a mixed solution of W1AL, excess H2, and target T. Compared with lane 11, the W1AL band disappeared in this lane, and LH2, W1, A, and W3 also appeared, indicating that target T can better drive the activation process of the dual DNA walker. However, this result also indicates the existence of a "leakage" phenomenon. Therefore, the H2 chain needs to be optimized to avoid the occurrence of "leakage".
[0076] The initially designed H2-0 chain (AAGAGCCGTCAAAGGAGTAAGTGTGAGTCC, SEQ ID No. 10) was a straight chain, and electrophoresis results showed a "leakage" phenomenon. To investigate whether the leakage was affected by the length of the fuel chain or by the free energy, two strategies were designed for the H2 chain.
[0077] Strategy 1: Modify the straight chain H2-0 into a hairpin structure. Three structures were designed and named H2-1 (hairpin, GGACTCTAAGAGCCGTCAAAGGAGTAAGTGTGAGTCC, SEQ ID No.11), H2-2 (hairpin, GGACTCAAGAGCCGTCAAAGGAGTAAGTGTGAGTCC, SEQ ID No.6), and H2-3 (hairpin, GGACTCACAAGCCGTCAAAGGAGTAAGTGTGAGTCC, SEQ ID No.12), with the free energy of the hairpin structures increasing sequentially.
[0078] Strategy 2: Considering the possibility of leakage due to a large number of bases paired with H2 and L, the number of two complementary bases of H2 and L was reduced. Figure 4 Based on the red bases in A, H2-4 (straight chain, AAGAGCCCGTCAAAGGAGTAAGTGTGAGT, SEQ ID No. 13) was designed. Furthermore, based on H2-4, two hairpin strands, H2-5 (hairpin, ACTCACGAGCCGTCAAAGGAGTAAGTGTGAGT, SEQ ID No. 14) and H2-6 (hairpin, ACTCACAAGAGCCGTCAAAGGAGTAAGTGTGAGT, SEQ ID No. 15), were designed, with their free energies increasing sequentially. The original and optimized strands were verified by gel electrophoresis (e.g., ...). Figure 3 ).
[0079] For a more intuitive comparison, the target band region in the electrophoresis results was cropped and magnified. For example... Figure 9 As shown, in strategy one, the original H2-0 ( Figure 4 A, 0 kcal / mol) and H2-1 ( Figure 4Leakage was observed in B (-1.89 kcal / mol), but H2-2 ( Figure 4 C (-3.26 kcal / mol) and H2-3 ( Figure 4 No leakage occurred in the H2 (-6.30 kcal / mol) chain. This indicates that as the absolute value of the free energy of H2 and its optimized chain increases, the hairpin itself becomes more stable and less likely to undergo chain substitution with the W1AL hybrid chain whose foothold has not yet been exposed.
[0080] It is worth noting that the LH2-3 hybrid band exhibits a significant tailing, indicating that the LH2-3 hybrid chain binding is unstable. This suggests that the H2-3 hairpin structure is highly stable and difficult to bind stably to the L chain. However, H2-2 can both avoid "leakage" and bind stably to the L chain. Therefore, in Strategy 1, the H2-2 chain is superior.
[0081] In strategy two, based on the electrophoresis results, H2-4 ( Figure 4 E, 0 kcal / mol), H2-5 ( Figure 4 F, -2.29 kcal / mol), H2-6 ( Figure 4 Leakage will occur in G (-3.16 kcal / mol).
[0082] Combining the two strategies, the structural free energy has a greater impact on the leakage result than the number of paired bases. Therefore, H2-2 is selected as the optimal reaction chain, which can both avoid the "leakage" phenomenon and drive the sensor activation process.
[0083] Using H2-2 as the optimal reaction chain, the sensor activation process was verified again by 12% polyacrylamide gel electrophoresis. Figure 5Lanes 1-5 are W1, A, L, W1AL, and H1, respectively; lane 7 is W2; lane 8 is the optimized H2-2; and lane 10 is the target T. Lane 6 is a mixed solution of W1 and H1. The results show that in addition to the corresponding bands of W1 and H1, there is an additional band with a faster migration rate, W3, indicating that W1 (DNAzyme) can cleave H1 to obtain a W3 fragment with fewer bases. Lane 9 is a mixed solution of L and excess H2-2. In this lane, a band with a slower migration rate can be seen, the L band disappears, and the brightness of the H2-2 band decreases. The results showed that L and H2-2 formed a stable hybridization chain of LH2-2; Lane 11 was a mixed solution of W1AL, H1 and excess H2-2, and the results showed 3 main bands, corresponding to lane 4 (W1AL), lane 5 (H1) and lane 8 (H2-2), respectively, and no additional bands appeared, indicating that no leakage occurred; Lane 12 was a mixed solution of W1AL, H1, excess H2-2 and T. In this lane, the bands of W1AL and H1 disappeared, but LH2-2, W1, W2, W3 and A appeared, indicating that the sensor was activated in the presence of target T and there was no "leakage".
[0084] Next, the sensor's signal output process was verified using 12% polyacrylamide gel electrophoresis. For example... Figure 6 Lanes 1-3 are W2, H3, and H4, respectively; lane 4 is a mixed solution of H3 and H4, and the result shows only H3 and H4 bands, proving that the hairpin structures of H3 and H4 will not hybridize under the condition of no catalytic chain W2, and there is no "leakage" phenomenon; lane 5 is a mixed solution of W2, H3, and H4, and compared with lane 4, this lane shows a band with a slower migration rate and a brighter band, proving that H3 and H4 form a hybrid double strand under the catalysis of W2.
[0085] The above electrophoresis results demonstrate that the DNA / RNA chain reaction designed by this strategy can proceed smoothly, providing strong evidence for the feasibility of the scheme.
[0086] Characterization of the MNP@(W1AL / H1) complex Transmission electron microscopy (TEM) was used to characterize the MNPs before and after modification, and elemental composition of the MNP@(W1AL / H1) surface was analyzed by energy dispersive spectroscopy. Figure 7 As shown in Figures A and B, both MNPs and MNP@(W1AL / H1) exhibit uniform spherical shapes with no significant morphological differences. This is because DNA modification only occurs at the surface molecular layer of the magnetic beads and does not alter the overall morphology of the beads.
[0087] Figure 7C is a scan distribution map of the five elements (C, N, O, P, and Fe) on the MNP@(W1AL / H1) complex. The results show that a carbon film adheres to the copper mesh used in the test, resulting in a relatively dense overall C signal distribution. However, in the areas loaded with the MNP@(W1AL / H1) complex, the C signal is relatively weak, indicating that MNP@(W1AL / H1) covers the copper mesh surface, obscuring the C signal of the copper mesh itself. Furthermore, the signal distribution of O and Fe elements confirms the presence of MNPs. N and P are characteristic elements on amino-modified DNA strands. As can be seen from the figure, the N and P content is relatively dense in the areas where the MNP@(W1AL / H1) complex is distributed. This preliminarily indicates that the DNA strand was successfully modified onto the MNP surface, but further verification using other characterization methods is still needed.
[0088] In addition, the surface charge changes of MNPs, MNP@(H1), and MNP@(W1AL / H1) were characterized using Zeta potential (e.g. Figure 8 Since the carboxyl group (-COOH) is a weak acidic group, it will ionize in aqueous solution, losing a hydrogen ion (H+). + It is then converted into a negatively charged carboxylate ion (-COO). - This process, by forming amide bonds, makes the entire surface of the magnetic beads negatively charged. Experimental results show that the Zeta potential of MNPs is -7.58 mV. After DNA modification, although the formation of amide bonds reduces the number of negatively charged carboxyl groups, DNA itself is a long-chain molecule carrying a large amount of negative charge. The introduced negative charge far exceeds the consumed carboxyl groups, so the net effect is a significant increase in the surface negative charge density, thus making the Zeta potential more negative. The above theoretical prediction is consistent with the experimental results. The Zeta potential of MNP@(H1) is -10.77 mV, and the Zeta potential of MNP@(W1AL / H1) is further reduced to -11.8 mV. This is because the surface of MNP@(W1AL / H1) contains more DNA and has a higher charge density than that of MNP@(H1), hence the more negative Zeta potential of MNP@(W1AL / H1). This result indicates that amino-modified DNA was successfully modified onto the surface of carboxyl-modified MNPs via amide bonds.
[0089] Finally, as a supplementary characterization method, UV-Vis absorption spectroscopy was used to characterize MNP@(W1AL / H1). Figure 9As shown, both curves exhibit a distinct characteristic peak near 260 nm, which, according to literature, can be identified as the characteristic absorption peak of DNA. Comparing the curves of the W1AL / H1 solution without magnetic beads and the W1AL / H1 supernatant with magnetic beads, it can be seen that the intensity of the DNA characteristic peak is significantly reduced after the addition of magnetic beads. This indicates that the residual DNA in the supernatant is significantly reduced after magnetic bead modification, proving that most of the DNA has been successfully attached to the surface of the magnetic beads via amide bonds, demonstrating the successful preparation of MNP@(W1AL / H1).
[0090] Electrochemical characterization The stepwise modification of the electrode surface was verified using electrochemical impedance spectroscopy (EIS). The tests were conducted at 5.0 mM [Fe(CN)6]. 3- / 4- It is carried out in 0.1 M KCl. For example... Figure 10 The illustration shows the equivalent fitting circuit. The symbols in the figure represent: Rs is the electrolyte solution resistance, CPE1 is the double layer capacitance, Rct is the surface charge transfer resistance, and Wo is the Warburg impedance generated by the diffusion of the redox probe.
[0091] The EIS spectrum of the bare gold electrode is almost a straight line, indicating good conductivity. Fitting with Zview software yielded an Rct of 233.7 Ω. The AuE / H3 curve is the EIS spectrum of the H3-modified gold electrode. This is due to the negatively charged DNA phosphate backbone on the electrode surface interacting with [Fe(CN)6]. 3- / 4- Anions generate electrostatic repulsion, resulting in a distinct semicircular region on the AC impedance curve, with Rct increasing to 2679 Ω. AuE / H3 / MNP@(W1AL / H1) is the EIS spectrum of MNP@(W1AL / H1) rolling on the AuE / H3 electrode surface. Due to the non-conductive nature of the magnetic beads, the charge transfer capability on the electrode surface decreases, further increasing the resistance, expanding the semicircular region, and further increasing Rct to 4812 Ω. AuE / H3 / MNP@(W1AL / H1) / H4 is the EIS spectrum after adding H4. The results show that the resistance decreases, the semicircular region shrinks, and the surface charge transfer capability is enhanced, with Rct reaching 2773 Ω. This indicates that the chain substitution reaction involving H4 can drive the rolling of MNP@(W1AL / H1) on the electrode surface, thereby achieving I... MB and I Fc The signal undergoes a reverse change, thereby amplifying the detection signal.
[0092] The results above show that the impedance of AuE / H3 / MNP@(W1AL / H1) / H4 is similar to that of AuE / H3. This is likely because the compact H3 hairpin on the electrode surface has a high negative charge density and thin steric hindrance, while the extended H3 / H4 double chain, although having more total negative charge and greater steric hindrance, is relatively transparent. Overall, the two have similar hindering effects on electron transfer, hence their similar impedance values.
[0093] Two control experiments were then conducted (e.g.) Figure 11 Control 1: A control experiment was conducted using a monopod DNA walker (H1) instead of MNP@(W1AL / H1), with the target substance T concentration uniformly set at 50 fM. Results showed that the monopod DNA walker's I... MB / I Fc The ratio ( Figure 11 The d column in Figure B is significantly lower than that of the multi-legged DNA walker ( Figure 11 (Column C in Figure B) This is mainly because the activation process of the monopod DNA walker is highly dependent on random collisions between the targets T, W1AL and H1. However, the probability of random collisions is extremely low, and the monopod walker is prone to derailment, resulting in discontinuous walking and low reaction efficiency.
[0094] Control 2: The non-tethered multipod DNA walker MNP@(H1) was used instead of MNP@(W1AL / H1). Results showed that the non-tethered multipod DNA walker's I... MB / I Fc The ratio ( Figure 11 The column f in Figure B is lower than the multi-legged DNA walker designed in this invention. Figure 11 (Column c in Figure B), but higher than the monopod DNA walker ( Figure 11 (Column d in Figure B). This phenomenon indicates that enriching the H1 chain on the surface of MNPs can increase the local concentration of the walking chain and enhance walking efficiency. However, W1AL not tethered to MNPs may still derail during the activation of the walking device, leading to incomplete activation and a decrease in electrochemical signal.
[0095] This experiment also indirectly proves that the flexible chain design of attaching W1AL to the surface of MNPs does not affect the cleavage efficiency of W1. In summary, the control experiment demonstrates that the dual DNA walker system designed in this paper has better activation effect under the same conditions, and also verifies the feasibility of this sensing strategy.
[0096] Optimization of experimental conditions To find the optimal electrochemical testing conditions, key steps were optimized under the condition of 1 nM target T.
[0097] First, the C on the surface of MNPs was investigated.W1AL :C H1 The impact on the detection of target T in the range of 1:1 to 1:25, such as Figure 12 As shown, when C W1AL :C H1 When I decreases, MB / I Fc The ratio gradually increases, but after reaching its maximum value at a concentration ratio of 1:20, further increases in the concentration ratio result in... MB / I Fc The ratio began to decrease again.
[0098] The reason for this phenomenon is as follows: when the proportion of W1AL is high, adjacent W1ALs interfere with each other during oscillation, preventing them from moving freely, reducing reaction efficiency, and thus hindering the activation of the DNA walker. Even if W1ALs are designed as flexible structures, a large number of them will still create steric hindrance on the electrode surface. Conversely, when the proportion of W1ALs is low, the cleavage efficiency decreases, resulting in fewer W2 chains generated from cleaving H1, making it difficult to fully open the hairpin H3, thus directly affecting signal amplification. Therefore, as the proportion of W1ALs continues to decrease, I... MB / I Fc It also began to decrease accordingly. Based on the results, 1:20 was selected as the optimal concentration ratio of W1AL to H1.
[0099] Next, the effect of MNP@(W1AL / H1) concentration in the range of 0.5 mg / mL to 4 mg / mL on detection performance was further investigated. Figure 13 As shown, when the concentration of MNP@(W1AL / H1) increases, I MB / I Fc The ratio also increases, but after reaching its maximum at a concentration of 2 mg / mL, further increases in the MNP@(W1AL / H1) concentration cause the ratio to decrease. This indicates that when the MNP@(W1AL / H1) concentration is low, the amount of MNP@(W1AL / H1) added to the electrode surface is insufficient, leading to incomplete reaction on the electrode surface and preventing the H3 hairpin from fully opening, thus adversely affecting signal amplification. Conversely, when the MNP@(W1AL / H1) concentration is high, an excess of MNP@(W1AL / H1) rolls along the electrode walking track. On the one hand, intermolecular steric hindrance disrupts the continuity of the rolling; on the other hand, high concentrations of MNPs are more susceptible to magnetic interference. Therefore, as the MNP@(W1AL / H1) concentration continues to increase, I... MB / I Fc The ratio began to decrease. Based on the experimental results, 2 mg / mL was selected as the optimal concentration of MNP@(W1AL / H1).
[0100] During sensor activation, the driving force is provided by the DNAzyme. The incubation time of MNP@(W1AL / H1), target T, and DNAzyme has a significant impact on the activation process; therefore, the incubation time of the DNAzyme was optimized. Figure 14 As shown, the electrochemical sensing signal gradually increased with the extension of incubation time, reaching a plateau after 80 minutes. Further extending the incubation time resulted in a slight decrease in the electrochemical sensing signal, presumably due to DNA detachment from the magnetic beads caused by prolonged oscillation. The experimental results indicate that 80 minutes is sufficient for complete sensor activation. Therefore, 80 minutes was chosen as the optimal incubation time for DNAzyme.
[0101] Similarly, the travel time of MNP@(W1AL / H1) also affects the signal transmission process of the sensor. Therefore, the travel time of MNP@(W1AL / H1) on the electrode surface was optimized. Figure 15 As shown, with the extension of walking time, the multi-legged DNA walker walks on the electrode surface, causing H3-Fc and H4-MB to form a hybrid double strand through base complementary pairing, thus I MB / I Fc The ratio gradually increased, reaching a plateau at 120 min, and then slightly decreased. It is speculated that the excessively long walk time might have caused the originally vertical H3 chains to bend, thus hindering electron transport on the electrode surface. Since the reaction on the electrode surface was sufficiently completed within 120 min, 120 min was chosen as the optimal walk time for MNP@(W1AL / H1).
[0102] Establishment of standard curve Under optimal conditions, the constructed chemical biosensor was used to detect target T at different concentrations, and the electrochemical response signal was recorded by alternating current voltammetry (ACV).
[0103] like Figure 16 Figure A shows the ACV response curves of the sensor in the presence of target T at concentrations of 0 aM, 5 aM, 10 aM, 50 aM, 100 aM, 500 aM, 1 fM, 5 fM, 10 fM, 50 fM, 100 fM, and 1 pM. As can be seen from this figure, with the increase of target T concentration, I... MB Gradually rising and I Fc The ratio gradually increases as the concentration decreases, but when the concentration exceeds 50 fM, I... MB and I Fc The ratio remains almost unchanged and tends to stabilize, indicating that the sensor's detection has reached its upper limit.
[0104] log(C) T (M) as the x-axis and IMB / I Fc Use the ordinate to construct a standard curve. Figure 16 (B), the linear regression equation is I MB / I Fc = 1.6081 + 0.0860 log(C T (M)), the linear range of the sensor is between 5 aM and 50 fM, and the linear correlation coefficient R 2 The linear range was 0.9964, indicating good linearity. However, when the concentration exceeded 50 fM, I... MB / I Fc The detection limit (LOD) for target T, calculated according to the 3σ rule, is 2.80 aM. Compared with other sensing methods using multi-legged DNA walkers, this method exhibits a lower LOD, demonstrating its advantage in ultrasensitive detection of trace substances. Furthermore, compared with published MP detection methods, this sensor has an even lower LOD, thus showcasing the potential of this sensing strategy for detecting low-concentration targets.
[0105] Selectivity, reproducibility and stability To evaluate the selectivity of the sensor, respiratory syncytial virus (RSV), influenza A (H1N1) virus, remaining fragments of MP (MP), single-base mismatch (Sm-T), three-base mismatch (Tm-T), and a mixture of all the above non-target substances and target substance T were detected under the same experimental conditions. Figure 17 China A and Figure 17 As shown in Figure B, the sensor only exhibits a significant signal response in the presence of target material T, while the signal response is very weak when RSV, H1N1, MP, Sm-T, and Tm-T are present individually. Furthermore, the signal strength of the Mix group is not significantly different from that of the T group alone, indicating that coexistence with interfering substances does not significantly affect the sensor's recognition of the target material. Therefore, the sensor designed in this invention has good selectivity for target material T.
[0106] To evaluate the reproducibility of the sensors, five sensors were fabricated under identical conditions and each detected a target T at a depth of 50 fM. Figure 18 As shown, analysis and comparison of the ACV electrochemical response curves revealed that the relative standard deviation among the five sensors was only 1.42%, indicating that the sensor has good reproducibility.
[0107] To further evaluate the stability of the sensor, it was prepared on days 0, 1, 3, 5, 7, 14, 21, and 28 and stored at 4 °C. Figure 19 As shown, the response signals of each sensor are all more than 80% greater than the initial response signals, which indicates that the sensor has good stability.
[0108] Actual sample analysis To verify the sensor's detection and analysis performance on real samples, this invention used human pharyngeal swabs as the actual sample and employed a commercial nucleic acid extraction kit for extraction and purification. For example... Figure 20 As shown in B, with log(C) T (M) as the x-axis and I MB / I Fc Using the ordinate as the standard curve, the regression equation is obtained through linear fitting as I. MB / I Fc =2.1550 + 0.1197 log(C T (M)), the linear range of the sensor is between 5 aM and 10 fM, and the linear correlation coefficient R 2 The value was 0.9933, indicating a good linear range. When the concentration exceeded 10 fM, I... MB / I Fc The signal deviates from a linear relationship. Based on the 3σ rule, the detection limit of this sensor in actual samples is calculated to be 8.64 aM, demonstrating high sensitivity.
[0109] To further verify the application value of the sensor in actual clinical samples, four groups of Mycoplasma pneumoniae infection-positive samples and three groups of Mycoplasma pneumoniae infection-negative samples provided by Qilu Hospital of Shandong University were used for testing. The test results showed (e.g.) Figure 20 (C), the sensor's negative and positive results for all clinical samples are consistent with those of traditional PCR, and the sample's I... MB / I Fc The response signal is inversely proportional to the Ct value of PCR detection; the lower the Ct value, the higher the target concentration in the sample, and the higher the corresponding I value of the sensor. MB / I Fc The stronger the signal value, the better. The above results demonstrate that this sensor performs excellently in the detection of actual samples and has the potential for clinical application.
[0110] in conclusion This study designed a novel sensing strategy that combines a dual DNA walker with ratiometric electrochemical detection, using a specific and conserved sequence on the 23S rRNA of Mycoplasma pneumoniae (MP) as the target T.
[0111] TEM, zeta potential, and UV-Vis absorption spectroscopy confirmed the successful fabrication of the tethered DNA walker. Optimization of the H2 strand resolved the leakage issue associated with the original H2 strand. To achieve optimal detection performance, the W1AL / H1 ratio (optimal 1:20), the concentration of MNP@(W1AL / H1) (optimal 2 mg / mL), the rolling time of MNP@(W1AL / H1) (optimal 120 min), and the incubation time of the DNAzyme (optimal 80 min) were optimized. Under optimal conditions, the sensor exhibited a linear detection range of 5 aM to 50 fM for the target T, with a detection limit as low as 2.80 aM. Furthermore, the sensor demonstrated good selectivity, reproducibility, and stability, and showed excellent detection performance in the analysis of actual samples.
[0112] Therefore, this invention successfully constructs an enzyme-free, isothermal, ratiometric electrochemical sensing strategy based on a dual DNA walker, achieving ultrasensitive and highly specific detection of MP. This sensing strategy has the advantages of simple operation, low cost, and high sensitivity, laying a theoretical foundation for the development of POCT devices and providing a new technical approach for the early diagnosis of MP infection.
[0113] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A dual-DNA walker, characterized in that: The invention includes carboxyl magnetic nanoparticles (MNPs), tethered W1AL, and hairpin H1. Both tethered W1AL and hairpin H1 are connected to the surface of carboxyl-modified MNPs via amide bonds. W1 has binding sites for H1 to cut the head of H1 and expose the binding sites for H1; and the binding sites for H1 on W1 are closed by A and L through pairing.
2. The dual DNA walker according to claim 1, characterized in that: The nucleotide sequence of W1 is shown in SEQ ID No. 1; The nucleotide sequence of A is shown in SEQ ID No. 2; The nucleotide sequence of L is shown in SEQ ID No. 3; The nucleotide sequence of H1 is shown in SEQ ID No.
4.
3. The method for preparing the dual DNA walker according to claim 1 or 2, characterized in that: Includes the following steps: Mix and dilute W1, A and L in a certain proportion to obtain mixture one; Heat the mixture and H1 solution separately to the set temperature, maintain for the set time, and then cool. The cooled mixture and H1 solution were added to the activated carboxyl magnetic nanoparticle MNPs dispersion in proportion. The W1AL and hairpin H1 were then incubated to allow W1AL and hairpin H1 to be attached to the surface of the carboxyl magnetic nanoparticles MNPs via amide bonds. The product can be washed and resuspended.
4. The method for preparing a dual DNA walker according to claim 3, characterized in that: The molar ratio of W1, A, and L is 0.8-1.2:0.8-1.2:0.8-1.2; Preferably, the molar ratio of W1, A, and L is 0.9-1.1:0.9-1.1:0.9-1.1; More preferably, the molar ratio of W1, A, and L is 1:1:1; Alternatively, the heating temperature is 85-95℃, and the heating time is 5-15 minutes; Preferably, the heating temperature is 87-92℃ and the heating time is 7-12 minutes; Specifically, the heating temperature is 90°C and the heating time is 10 minutes.
5. The method for preparing a dual DNA walker according to claim 3, characterized in that: After adding the mixture and H1 solution to the activated carboxyl magnetic nanoparticles (MNPs) dispersion, the concentration ratio of W1AL to H1 is 1:15-25, preferably 1:19-21, and further preferably 1:
20. Alternatively, the incubation temperature is 3-5℃, and the incubation time is 8-24h.
6. An electrochemical nucleic acid detection system based on a dual-DNA walker, characterized in that: It includes the dual DNA walker as described in claim 1 or 2, the AuE / H3-Fc sensing interface, the fuel chain H2 and H4-MB; the fuel chain H2 is a hairpin structure.
7. The electrochemical nucleic acid detection system based on a dual DNA walker according to claim 6, characterized in that: The nucleotide sequence of H2 is shown in SEQ ID No. 6; The nucleotide sequence of H4 is shown in SEQ ID No.
9.
8. The electrochemical nucleic acid detection system based on a dual DNA walker according to claim 6, characterized in that: The method for preparing the AuE / H3-Fc sensing interface is as follows: The gold electrode is polished to a mirror finish using an alumina paste. The polished gold electrode was rinsed sequentially with anhydrous ethanol and ultrapure water. Cyclic voltammetry scans were performed on the gold electrode in sulfuric acid solution until a stable cyclic voltammetric curve was obtained. The electrode was then cleaned to obtain the activated gold electrode. H3 was reduced using a tri(2-chloroethyl) phosphate TCEP solution; The reduced H3 solution was added dropwise to the surface of the activated gold electrode and incubated for a set time to allow H3 to be fixed on the surface of the gold electrode through Au-S bonds. After overnight treatment, the gold electrode was cleaned and then the blocking agent MCH was added to block the excess active sites on the surface of the gold electrode. The electrode was cleaned with Tris buffer solution to obtain the AuE / H3-Fc sensing interface. Preferably, the potential range of the cyclic voltammetric scan is -0.2 V to +1.6 V.
9. An electrochemical nucleic acid detection method based on a dual-DNA walker, characterized in that: Includes the following steps: An unknown concentration of Mycoplasma pneumoniae target T was mixed with the dispersion of a dual DNA walker and fuel chain H2, and the mixture was reacted in a shaker at 35-38°C for a set time. After the reaction was complete, the supernatant was removed by magnetic separation and resuspended in Tris buffer solution to obtain a dispersion. After mixing the dispersion with the H4-MB solution, drop it onto the AuE / H3-Fc sensing interface, incubate for a set time, and then perform an AC voltammetry test.
10. The electrochemical nucleic acid detection method based on a dual-DNA walker according to claim 9, characterized in that: The target T is a 23S rRNA fragment of Mycoplasma pneumoniae, with the deoxynucleotide sequence CAAGAAAGUAAGAGCCGUCAAAG. Alternatively, the reaction time on the shaker is 60-100 minutes, preferably 70-90 minutes.