Molecular markers related to flavonoid content in Dendrobium huoshanense and their application in improving the quality of Dendrobium huoshanense

Abstract

This invention discloses a molecular marker related to the total flavonoid content of Dendrobium officinale and its application, relating to the field of biotechnology. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The molecular marker of this invention can be used for marker-assisted selection (MAS) and genomic selection (GS), which can accelerate the genetic improvement of Dendrobium officinale varieties.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers related to the flavonoid content of Dendrobium nobile and their applications. Background Technology

[0002] Dendrobium is a traditional and precious Chinese medicinal herb with unique effects such as nourishing the stomach and promoting the production of body fluids, nourishing yin and clearing heat, enhancing immunity, and anti-tumor activity. Flavonoids are one of the main medicinal active ingredients of Dendrobium, possessing significant biological activities such as anti-inflammatory, antioxidant, and anti-diabetic effects. Their content directly affects the quality and medicinal value of Dendrobium. Therefore, how to efficiently breed superior Dendrobium varieties with high flavonoid content, and how to accurately and quickly evaluate the flavonoid content in Dendrobium germplasm resources, have always been key issues that urgently need to be addressed in the field of Dendrobium breeding and quality evaluation.

[0003] In the breeding of Dendrobium officinale for flavonoid content, traditional hybridization breeding methods are currently the primary approach. However, Dendrobium officinale has a complex genetic background and a long growth cycle, and traditional hybridization breeding suffers from significant drawbacks such as long cycle time, low efficiency, and high cost. More importantly, traditional breeding methods rely on the observation of mature plant phenotypes and the determination of chemical composition, making it impossible to screen for quality traits such as flavonoid content at the seedling stage, which severely restricts breeding efficiency. For flavonoid content detection, high-performance liquid chromatography (HPLC) or ultraviolet spectrophotometry are currently used. These methods involve numerous steps, are time-consuming, and costly, and are easily affected by environmental conditions and plant parts, making it difficult to accurately reflect the genetic potential of germplasm materials and limiting their application in early screening during breeding.

[0004] In recent years, with the development of molecular biology techniques, molecular marker technology has been applied to the study of Dendrobium species. Currently available molecular markers mainly involve species identification, genetic diversity analysis, and phylogenetic studies of Dendrobium species. However, functional molecular markers directly associated with quality traits such as Dendrobium flavonoid content are rarely reported.

[0005] Therefore, developing molecular markers closely related to the flavonoid content of Dendrobium officinale, constructing supporting efficient detection methods and reagent kits, and applying them to the precise screening of Dendrobium officinale seedlings and molecular marker-assisted breeding are of great significance for shortening the breeding cycle, reducing breeding costs, accelerating the cultivation of high-quality Dendrobium officinale varieties with high flavonoid content, and promoting the high-quality development of the Dendrobium officinale industry. Summary of the Invention

[0006] To address the problems of post-harvest quality assessment, long breeding cycles, and low efficiency in existing technologies for Dendrobium officinale, this invention develops a set of molecular markers for evaluating Dendrobium officinale quality. Specifically, SNP molecular markers for evaluating Dendrobium officinale quality are developed using high-throughput sequencing technology and validated in a population. These markers can be used for commercial identification of Dendrobium officinale (seedlings) sold in the market. Furthermore, applying them to marker-assisted selection (MAS) and genomic selection (GS) can accelerate the genetic improvement of Dendrobium officinale varieties.

[0007] The primary objective of this invention is to identify molecular markers for the total flavonoid content in Dendrobium stems. These molecular markers are SNP markers located on the Dendrobium genome (CNGBdb Project (CNP0000830), https: / / db.cngb.org / data_resources / project / CNP0000830). Specific SNP information is as follows: Table 1 SNP locus information The molecular marker SNP1 G>T is located at position 301 of the following SEQ ID NO.1 sequence, where G / T represents a genotype with high total flavonoid content: SEQ ID NO.1 CTACACTTTGTCCCATAGGTCTTTCCACAAGTTCTCAAACATCATTCCTAACAAATTGATTCAATTCTTCTTGTATTGCTAAATCCAAAACTCATCAGAAAGGGCTTGGTTAATGGTGGTGGGTTCAGTCATAGAGATAAAGGCAGAGTG GTTCACCTCCTTCCTAAGTCCATGTCTAGTCTTAAATCCATTAGAAGAGTCTCCTAAGATCAAATCCTTGGGGTGACTTGTAGAGTATCTCCAATCTCTAGGTAAAGTGTGTGAAGTTTCTCCCCTTTCATCAAAATTTTCTACTCCTT[G / T]GGTGACTTCTTCTACTCCTTCATTACTTAGGTGCTCACTCTCCTTCCCCAAATTTTCTACTCCACTTGTAATCTCTCCAACATCATCATCTTCTACTCCATGTTTCTTAGGATCAGACTCATCAAAAACTATATGGGTTTATCTCTTCCAC CATCAAAGTTCTTTTGTTAAACACCCTAAAAGACTTCCCAACACTAGAATATCCCAAAAATACTCCTTCATCAGATTTAGGATCAAATTTTCCCAATTGAGACTTCCCATTGTTGTGAATGAAAACCTTATAACCAAAGACATGAAGGTGG.

[0008] To achieve efficient and accurate detection of the above molecular markers, this invention provides a set of specific primers, which contains one primer pair for detecting SNP1, and whose nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0009] SEQ ID NO.2 AAGGCAGAGTGGTTCACCTC SEQ ID NO.3 TTTGGGGAAGGAGAGTGAGC.

[0010] The present invention also provides a kit for detecting the above-mentioned molecular markers, the core component of which is the above-mentioned specific primer set, and also includes a special mix (containing Taq enzyme, dNTP, and reaction buffer), sterile water, and standard controls (one tube each of standard genotype templates, each with a concentration of 50 ng / μL).

[0011] The present invention also provides for any of the following applications of the molecular marker, the primer set, or the kit: (1) Application in predicting or evaluating the quality of Dendrobium, wherein the quality is the total flavonoid content of the stem; (2) Application in breeding related to quality traits of Dendrobium, wherein the quality refers to the total flavonoid content of the stem.

[0012] This invention also provides a method for evaluating the quality traits of Dendrobium using molecular markers. This method can quickly predict the quality and is especially suitable for commercial identification of seedlings in the market. The method includes the following steps: using any method to detect the genotype of the aforementioned SNP molecular markers, and evaluating the quality of Dendrobium based on the detected genotype results.

[0013] Specifically, a method for evaluating the quality traits of Dendrobium using SNP molecular markers, wherein the quality is the total flavonoid content of the stem, the method comprising the following steps: (1) Extract genomic DNA from the Dendrobium samples to be tested; (2) The genotype of the Dendrobium to be tested was detected using the primer set or the kit described above; (3) Based on the test results, determine the genotype of the molecular marker in the Dendrobium to be tested.

[0014] (4) Evaluate the quality of Dendrobium based on the genotype results obtained from the test.

[0015] In the preferred scheme, in step 4, the quality of Dendrobium is evaluated based on the genotype results obtained from the test. The judgment criteria are: the genotypes corresponding to the total flavonoid content from high to low are G / T, T / T, and G / G, respectively.

[0016] The method for evaluating the quality traits of Dendrobium using SNP molecular markers in this invention has a high accuracy rate in predicting results after population validation, and can provide a reliable basis for seedling transactions.

[0017] This invention also provides a genetic breeding method for screening quality traits of Dendrobium. This method can accurately achieve quality-oriented selection and significantly improve breeding efficiency. The method includes the following core steps: using any method to detect the genotype of the aforementioned SNP molecular markers, and selecting individuals with different genotypes as parents according to the breeding objectives.

[0018] Specifically, a method for genetically improving the quality traits of Dendrobium, wherein the quality refers to the total flavonoid content of the stem, the method comprising the following steps: (1) Extract genomic DNA from the Dendrobium officinale resource population to be tested; (2) The genotype of the Dendrobium to be tested was detected using the primer set or the kit described above; (3) Based on the test results, determine the genotype of the molecular marker of the Dendrobium to be tested.

[0019] (4) Based on the test results, select to retain or eliminate the corresponding individuals in order to increase the proportion of individuals with high total flavonoid content in the population.

[0020] In a preferred embodiment, the selection in step 4 includes: Individuals with the G / G genotype at SNP1 locus were eliminated, while individuals with the G / T or T / T genotype at SNP1 locus were retained.

[0021] In a preferred embodiment, the selection in step 4 includes: Individuals with the SNP1 locus genotype G / T are retained.

[0022] In the preferred scheme, when the genotype of the selected individual at the SNP1 locus is G / T, asexual reproduction is preferred to propagate the individual in order to maintain its dominant phenotype.

[0023] Preferably, the Dendrobium mentioned in any of the foregoing schemes is Dendrobium huoshanense (…). Dendrobium huoshanense ).

[0024] The beneficial effects of this invention are: The SNP molecular markers identified in this invention are significantly correlated with the total flavonoid content of Dendrobium stems, demonstrating significant application value in Dendrobium quality trait-related breeding or quality prediction. Applying them to MAS breeding enables precise seed selection at the seedling stage, eliminating individuals with non-target genotypes and reducing breeding costs. Integrating them into the GS model can improve the predictive accuracy of multi-trait aggregation breeding and accelerate the process of variety genetic improvement. Simultaneously, the primer sets or kits provided by this invention also possess significant advantages in Dendrobium quality trait-related breeding or quality prediction, exhibiting high specificity and stable detection results. They can be widely applied to early screening in breeding units, quality identification in seedling enterprises, and resource evaluation in research institutions, providing the Dendrobium industry with full-chain technical support from variety cultivation to commercial circulation. Attached Figure Description

[0025] The method of the present invention and its beneficial effects will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0026] Figure 1 This is a Manhattan plot from GWAS analysis.

[0027] Figure 2 This is a statistical result of the flavonoid content of different genotypes at the SNP1 locus. Detailed Implementation

[0028] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0029] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0030] Example Example 1: Development of SNPs and QTL Localization 1. Experimental materials Ninety-five Dendrobium huoshanense specimens with the same growth cycle (3-year growth period) were collected. Dendrobium huoshanense Germplasm resource samples were collected, and the growth environment of all samples was designed to mimic natural growth conditions.

[0031] 2. Sample DNA extraction, library construction, and sequencing 1) Use a kit to extract genomic DNA.

[0032] 2) Perform whole-genome resequencing on the samples.

[0033] 3. Data quality control Use the software fastp (version: 0.20.0) with default parameters to filter low-quality sequences in the original data and obtain CleanData data.

[0034] 4. Population variation detection In this invention, we use the *Dendrobium* genome as the reference genome (CNGBdb Project (CNP0000830)). The obtained sequencing reads need to be repositioned onto the reference genome before subsequent variant analysis can be performed. The reference genome was aligned using bwa (software version: 0.7.17-r1188). The generated SAM file was converted to BAM format using samtools (version: 1.9). Then, PCR duplications were marked using picard MarkDuplicates (version: 2.21.2). Only high-quality reads were then retained for subsequent analysis.

[0035] 5. SNP Filtering Sequencing depth and quality value filtering: average sequencing depth greater than or equal to 10X, minimum quality value greater than or equal to 30, site detection rate ≥90%, only biallelic SNP sites are retained, minimum allele frequency (maf) ≥0.05.

[0036] 6. Determination of total flavonoid content in samples Preparation of standard curve: Accurately weigh 10 mg of rutin reference standard and place it in a 100 mL volumetric flask. Dilute to the mark with 70% ethanol to obtain a reference standard with a concentration of 0.1 mg / mL. Measure 0, 1, 2, 3, 4, and 5 mL of the reference standard into 10 mL volumetric flasks, add 70% ethanol to 5 mL, add 0.3 mL of 0.05 g / mL sodium nitrite solution, shake well, and let stand for 6 min. Then add 0.3 mL of 0.1 g / mL aluminum nitrate, shake well, and let stand for 6 min. Then add 4 mL of 0.04 g / mL sodium hydroxide, shake well, and dilute to the mark. After standing for 15 min, immediately measure the absorbance at 510 nm.

[0037] Determination: 0.5 g of *Dendrobium huoshanense* powder was placed in a 50 mL centrifuge tube, and 15 mL of 70% ethanol was added. Extraction was performed at 60℃ and 50 Hz with ultrasonic assistance for 50 min. The entire extract was collected, filtered, and diluted to a 25 mL volumetric flask with 70% ethanol. 1 mL of the extract was accurately measured and placed in a 10 mL volumetric flask, along with 4 mL of 70% ethanol and 0.3 mL of 0.05 g / mL sodium nitrite solution. The mixture was shaken well and allowed to stand for 6 min. Then, 0.3 mL of 0.1 g / mL aluminum nitrate was added, shaken well, and allowed to stand for another 6 min. Then, 4 mL of 0.04 g / mL sodium hydroxide solution was added, shaken well, and diluted to volume. The absorbance was immediately measured at 510 nm after standing for 15 min. The total flavonoid content in the sample was obtained according to the standard curve.

[0038] 7. Genome-wide association analysis The SNPs obtained in step 5 above were used to perform GWAS correlation analysis with the total flavonoid content in the stems of each sample. The GWAS analysis used in this invention is a general linear model for correlation analysis.

[0039] Ultimately, a locus on chromosome 16 was found to have a significant impact on total flavonoid content, such as... Figure 1 As shown in Table 2: Table 2. Associated SNP sites Note: P The value indicates the degree of association between the SNP site and the total flavonoid content trait. The molecular marker SNP1 G>T is located at position 301 of the following SEQ ID NO.1 sequence.

[0040] SEQ ID NO.1 CTACACTTTGTCCCATAGGTCTTTCCACAAGTTCTCAAACATCATTCCTAACAAATTGATTCAATTCTTCTTGTATTGCTAAATCCAAAACTCATCAGAAAGGGCTTGGTTAATGGTGGTGGGTTCAGTCATAGAGATAAAGGCAGAGTG GTTCACCTCCTTCCTAAGTCCATGTCTAGTCTTAAATCCATTAGAAGAGTCTCCTAAGATCAAATCCTTGGGGTGACTTGTAGAGTATCTCCAATCTCTAGGTAAAGTGTGTGAAGTTTCTCCCCTTTCATCAAAATTTTCTACTCCTT[G / T]GGTGACTTCTTCTACTCCTTCATTACTTAGGTGCTCACTCTCCTTCCCCAAATTTTCTACTCCACTTGTAATCTCTCCAACATCATCATCTTCTACTCCATGTTTCTTAGGATCAGACTCATCAAAAACTATATGGGTTTATCTCTTCCAC CATCAAAGTTCTTTTGTTAAACACCCTAAAAGACTTCCCAACACTAGAATATCCCAAAAATACTCCTTCATCAGATTTAGGATCAAATTTTCCCAATTGAGACTTCCCATTGTTGTGAATGAAAACCTTATAACCAAAGACATGAAGGTGG.

[0041] Example 2: Correlation analysis between phenotype and genotype One pair of primers was designed (as shown in SEQ ID NO.2~SEQ ID NO.3). Sixty-six Dendrobium huoshanense samples were randomly collected from the planting base, and the above-mentioned loci were detected in the samples. The total flavonoid content in the stems of individuals with different genotypes was statistically analyzed and subjected to t-tests. The results are shown in Table 3 and... Figure 2 As shown: Table 3. Mutation sites and total flavonoid content Note: Different capital letters indicate highly significant differences between groups (P≤0.01).

[0042] As shown in Table 3, there are highly significant differences among the three genotypes at the SNP1 locus, with the total flavonoid content from high to low being GT, TT, and GG genotypes, respectively.

[0043] The primer sequences are shown below: SEQ ID NO.2 AAGGCAGAGTGGTTCACCTC SEQ ID NO.3 TTTGGGGAAGGAGAGTGAGC.

[0044] Example 3: Quality assessment method for total flavonoid content in Dendrobium huoshanense stems The quality assessment method for Dendrobium huoshanense provided in this embodiment uses the total flavonoid content of Dendrobium huoshanense stems as the core quality indicator. Quality is determined by detecting the SNP molecular marker genotype associated with total flavonoid content on chromosome 16 of the Dendrobium huoshanense reference genome. The SNP molecular marker is the SNP1 locus. The method specifically includes the following steps: Step S1: Extraction and genotyping of genomic DNA from Dendrobium huoshanense. Tissue samples of Dendrobium huoshanense were collected, and genomic DNA was extracted using conventional plant genomic DNA extraction methods. Genotyping was performed on the extracted genomic DNA, and the specific genotype of Dendrobium huoshanense at the SNP1 locus on chromosome 16 of the reference genome was determined based on the test results.

[0045] Step S2: Quality assessment of Dendrobium huoshanense based on SNP genotype Based on the SNP locus genotype results obtained in step S1, and combined with the correlation between the genotype and total flavonoid content of the Dendrobium huoshanense resource population in Example 2, the total flavonoid content level of the stems of the Dendrobium huoshanense samples to be tested was determined. The specific determination method is as follows: when the genotype of the Dendrobium huoshanense sample at the SNP1 locus is G / T, it is a sample with high total flavonoid content.

[0046] Example 4: Genetic Improvement Method for Total Flavonoid Content in Dendrobium huoshanense Stems The genetic improvement method for Dendrobium huoshanense quality provided in this embodiment aims to increase the total flavonoid content in the stems of Dendrobium huoshanense as a breeding objective. It achieves genetic improvement of Dendrobium huoshanense quality by screening the genotype of SNP1 loci associated with total flavonoid content in the Dendrobium huoshanense resource population. The SNP loci are located on chromosome 16 of the Dendrobium huoshanense reference genome. The method specifically includes the following steps: Step T1: Genotyping of Dendrobium huoshanense resource population Individuals from the Dendrobium huoshanense resource population were randomly selected, and genomic DNA was extracted from the plants and genotyping was performed. The genotype of each individual at the SNP1 locus was determined based on the test results.

[0047] Step T2: Targeted selection breeding based on SNP genotypes Based on the genotype detection results of step T1, and in conjunction with the breeding objective of increasing the total flavonoid content of stems, the Dendrobium huoshanense resource population was targeted for screening. By eliminating individuals with unfavorable genotypes and retaining individuals with advantageous genotypes, the frequency of advantageous genotypes in the population was gradually increased through multiple generations of screening, thereby achieving a generation-by-generation increase in the total flavonoid content of Dendrobium huoshanense stems.

[0048] Specifically, individuals with the G / G genotype at the SNP1 locus were eliminated from the Dendrobium huoshanense resource population, while individuals with the G / T or T / T genotype at the SNP1 locus were retained to increase the frequency of the dominant genotype in the population. Preferably, only individuals with the G / T genotype at the SNP1 locus are retained, while individuals with other genotypes are removed. This screening method can further improve the average total flavonoid content in the stems of the offspring Dendrobium huoshanense population.

[0049] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. SNP molecular markers related to the quality of Dendrobium, characterized in that, The quality refers to the total flavonoid content of the stem, and the SNP molecular marker is SNP1. SNP1 corresponds to the G>T mutation at position 20219919 on chromosome 16 of the Dendrobium genome, and its nucleotide sequence is shown in SEQ ID NO.1, where G / T is the genotype with high total flavonoid content.

2. A primer set for detecting the SNP molecular marker of claim 1, characterized in that, The nucleotide sequences of the primer set are shown in SEQ ID NO.2 ~ SEQ ID NO.

3.

3. A kit for detecting the molecular marker of claim 1, characterized in that, The kit comprises the primer set as described in claim 2.

4. Any of the following applications of the molecular marker of claim 1, the primer set of claim 2, or the kit of claim 3: (1) Application in predicting or evaluating the quality of Dendrobium, wherein the quality is the total flavonoid content of the stem; (2) Application in breeding related to quality traits of Dendrobium, wherein the quality refers to the total flavonoid content of the stem.

5. A method for evaluating the quality traits of Dendrobium using SNP molecular markers, characterized in that, The quality refers to the total flavonoid content of the stem, and the method includes the following steps: (1) Extract genomic DNA from the Dendrobium samples to be tested; (2) The genotype of the Dendrobium to be tested is detected using the primer set described in claim 2 or the kit described in claim 3; (3) Based on the detection results, determine the genotype of the molecular marker described in claim 1 for the Dendrobium to be tested; (4) Evaluate the quality of Dendrobium based on the genotype results obtained from the test.

6. The method according to claim 5, characterized in that, The criteria for judgment in step 4 are: the genotypes corresponding to the total flavonoid content from high to low are G / T, T / T, and G / G, respectively.

7. A method for genetic improvement of the quality traits of Dendrobium, characterized in that, The quality refers to the total flavonoid content of the stem, and the method includes the following steps: (1) Extract genomic DNA from the Dendrobium officinale resource population to be tested; (2) The genotype of the Dendrobium to be tested is detected using the primer set described in claim 2 or the kit described in claim 3; (3) Based on the detection results, determine the genotype of the molecular marker described in claim 1 for the Dendrobium to be tested; (4) Based on the test results, select to retain or eliminate the corresponding individuals in order to increase the proportion of individuals with high total flavonoid content in the population.

8. The method according to claim 7, characterized in that, The selections mentioned in step 4 include: Individuals with the G / G genotype at SNP1 locus were eliminated, while individuals with the G / T or T / T genotype at SNP1 locus were retained.

9. The method according to claim 7, characterized in that, The selections mentioned in step 4 include: Individuals with the SNP1 locus genotype G / T are retained.

10. The method according to any one of claims 5-9, characterized in that, The Dendrobium mentioned is Dendrobium huoshanense ( Dendrobium huoshanense ).

Images