Fluorescent PCR composition, kit, and detection method for detecting SQLE gene mutation sites in dermatophytes.

CN122564148APending Publication Date: 2026-08-14HOSPITAL OF DERMATOLOGY CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-20
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

[0004]目前,SQLE耐药突变的检测主要依赖体外药敏试验和基因测序,但这些方法检测周期长、成本高,难以满足临床快速筛查需求

Benefits of technology

1、检测速度快,无需进行基因测序即可完成突变识别;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122564148A_ABST
    Figure CN122564148A_ABST
Patent Text Reader

Abstract

This invention discloses a fluorescent PCR composition, kit, and detection method for detecting SQLE gene mutation sites in dermatophytes. The fluorescent PCR composition includes specific primers and fluorescent probes for detecting SQLE gene mutation sites; the fluorescent PCR kit includes the specific primer and probe composition, 2×HotStart PCR reaction premix, nuclease-free water, positive control, and negative control; the detection method includes: (1) extracting DNA from the dermatophyte sample to be tested; (2) mixing the DNA with the mutation-specific primer and probe composition; (3) performing fluorescent PCR amplification; and (4) determining the SQLE mutation site based on the fluorescence signal. The method offers fast detection speed, comprehensive detection site coverage, high detection specificity, and simple operation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to fluorescent PCR compositions, kits, and detection methods for detecting dermatophytes, specifically to fluorescent PCR compositions, kits, and detection methods for detecting SQLE gene mutation sites in dermatophytes, belonging to the field of molecular detection technology for pathogenic microorganisms. Background Technology

[0002] Dermatophytes: Dermatophytes are keratinophilic filamentous fungi, mainly including the genera *Trichophyton*, *Microsporum*, and *Epidermophyton*. Animal-friendly dermatophytes include *Microsporum canis*, *Trichophyton mentagrophytes*, and *Microsporum gypseum*. Dermatophytes primarily disrupt the skin's ecosystem by invading the stratum corneum, causing various lesions such as hair loss, itching, and erythema, thus impacting the health of both humans and animals.

[0003] Some antifungal drugs work by inhibiting squalene epoxidase (SQLE), thereby blocking ergosterol synthesis and causing damage to the fungal cell membrane structure. However, recent studies have shown a significant upward trend in drug resistance rates among dermatophytes. Molecular biological research indicates that this resistance is mainly related to single nucleotide mutations in the SQLE gene. These mutations can lead to key amino acid substitutions and alter the enzyme protein structure, thereby reducing the binding affinity of antifungal drugs to their targets. Multiple mutation sites in the SQLE gene are closely associated with drug resistance.

[0004] Currently, the detection of SQLE drug resistance mutations mainly relies on in vitro drug susceptibility testing and gene sequencing. However, these methods are time-consuming and costly, making them unsuitable for rapid clinical screening. Therefore, establishing a molecular detection method capable of rapidly and accurately detecting multiple drug resistance mutation sites in SQLE is of great significance. Summary of the Invention

[0005] To address the aforementioned technical problems, the objective of this invention is to propose a fluorescent PCR composition, kit, and detection method for detecting SQLE gene mutation sites in dermatophytes, characterized by high detection efficiency and a short detection cycle.

[0006] The technical solution of this invention is achieved as follows: a fluorescent PCR composition for detecting SQLE gene mutation sites in dermatophytes, the composition comprising specific primers and fluorescent probes for detecting SQLE gene mutation sites: SNP1: Leu393Ser, corresponding to the nucleotide mutation g.1178T>C; SNP2: Phe397Leu, corresponding to the nucleotide mutation g.1191C>A; SNP3: Phe397Leu, corresponding to the nucleotide mutation g.1189T>C; SNP4: Phe415Cys, corresponding to the nucleotide mutation g.1244T>G; SNP5: His440Tyr, corresponding to the nucleotide mutation g.1318C>T; SNP6: Ala448Thr, corresponding to the nucleotide mutation g.1342G>A; The nucleotide sequences of the specific primers for the Leu393Ser mutation are as follows: Forward primer: 5'-GTCATTGATCTCTGTCATC-3'; Reverse primer: 5'-GCCATCTATAAGTCCAAGT-3'; The nucleotide sequences of the specific primers for the Phe397Leu (1191C>A) mutation are as follows: Forward primer: 5'- GATCTCTGTCATCAATATTCTTG -3'; Reverse primer: 5'-AATGTCGTAATAGAACCAAGG-3'; The nucleotide sequences of the specific primers for the Phe397Leu (1189T>C) mutation are as follows: Forward primer: 5'-CATCAATATTCTTGCCCAGTC-3'; Reverse primer: 5'-GTAAGGTGTAGCCAGATAGC-3'; The nucleotide sequences of the specific primers for the Phe415Cys mutation are as follows: Forward primer: 5'- GAAAGTCCTGCAACGAG -3'; Reverse primer: 5'-TAGTAAGGTGTAGCCAGATA -3'; The nucleotide sequence of the primer specific to the His440Tyr mutation is as follows: Forward primer: 5'-AGGCATCATTCGATCAC-3'; Reverse primer: 5'-CTGCAGGCAGTAAGAAA-3'; The nucleotide sequences of the specific primers for the Ala448Thr mutation are as follows: Forward primer: 5'-CTTGGTTCTATTACGACATT-3'; Reverse primer: 5'-CGGCAAATACGAAAGGA-3'.

[0007] Preferably, the fluorescent probe is a TaqMan fluorescent probe; Preferably, the fluorescent probe includes a wild-type probe and a mutant probe, used to identify wild-type sequences and mutant sequences, respectively; Preferably, the wild-type probe is labeled with the fluorescent dye FAM, and the mutant probe is labeled with the fluorescent dye ROX.

[0008] The preferred probe nucleotide sequence for the specific primers used to detect the Leu393Ser mutation is as follows: Wild-type probe (FAM): TTGCCCAGTCCTTATACTCTATATT; Mutant probe (ROX): TTGCCCAGTCCTCATACTCTATATT; The probe nucleotide sequences of the specific primers used to detect the Phe397Leu (1191C>A) mutation are as follows: Wild-type probe (FAM): ATACTCTATATTCGCCGCTGGTGAC; Mutant probe (ROX): ATACTCTATATTAGCCGCTGGTGAC; The probe nucleotide sequences of the specific primers used to detect the Phe397Leu (1189T>C) mutation are as follows: Wild-type probe (FAM): TTATACTCTATATTCGCCGCTGGTG; Mutant probe (ROX): TTATACTCTATACTCGCCGCTGGTG; The probe nucleotide sequences of the specific primers used to detect the Phe415Cys mutation are as follows: Wild-type probe (FAM): CTTCAGGTATTTCCAACTTGGAC; Mutant probe (ROX): CTTCAGGTATTGCCAACTTGGAC; The probe nucleotide sequences for the specific primers used to detect the His440Tyr mutation are as follows: Wild-type probe (FAM): TTCTATTACGACATTTTTACTCCGT; Mutant probe (ROX): TTCTATTACGACGTTTTTACTCCGT; The probe nucleotide sequences of the specific primers used to detect the Ala448Thr mutation are as follows: Wild-type probe (FAM): AGCCTTCCTCGCTATCTGGC; Mutant probe (ROX): AGCCTTCCTCACTATCTGGC.

[0009] A fluorescent PCR kit for detecting SQLE gene mutation sites in dermatophytes includes: the specific primer and probe composition, 2×HotStart PCR reaction premix, nuclease-free water, a positive control, and a negative control; the positive control is a DNA template containing the SQLE mutation site sequence; the negative control is a template-free reaction system.

[0010] The method for detecting SQLE gene mutation sites in dermatophytes includes: (1) extracting DNA from the dermatophyte sample to be tested; (2) mixing the DNA with a combination of mutation-specific primers and probes; (3) performing fluorescent PCR amplification; and (4) determining the SQLE mutation site based on the fluorescence signal. Preferably, when the fluorescence signal of the wild-type probe is positive and the fluorescence signal of the mutant probe is negative, it is determined to be a wild-type sequence; when the fluorescence signal of the mutant probe is positive and the fluorescence signal of the wild-type probe is negative, it is determined to be a mutant sequence; when both fluorescence signals are positive, it is determined to be a mixed mutation or the presence of different genotype templates; when both fluorescence signals are negative, it is determined to be that the target sequence was not detected or the reaction failed.

[0011] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art: 1. Fast detection speed; mutation identification can be completed without gene sequencing. 2. Comprehensive detection site coverage, capable of simultaneously detecting six SQLE mutation sites; 3. High detection specificity, accurately distinguishing between wild-type and mutant sequences; 4. It is easy to operate and suitable for rapid screening of clinically isolated strains. Attached Figure Description

[0012] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the content of the embodiments of the present invention and these drawings without creative effort.

[0013] Appendix Figure 1 This is a schematic diagram of the six mutation sites of the SQLE gene in dermatophytes, as described in this invention. Appendix Figure 2 This is a schematic diagram illustrating the principle of TaqMan probe fluorescent PCR detection in this invention; Appendix Figure 3 Agarose gel electrophoresis image of the conventional PCR amplification products of the six mutation sites of the SQLE gene of dermatophytes in this invention; Appendix Figure 4 This is a temperature optimization curve for dual-probe fluorescent PCR of the SQLE gene mutation sites in dermatophytes, as presented in this invention. Appendix Figure 5 This is a schematic diagram illustrating the interpretation of fluorescence PCR detection results according to the present invention. Detailed Implementation

[0014] To make the technical problems solved by the present invention, the technical solutions adopted, and the technical effects achieved clearer, the technical solutions of the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0015] In the description of this invention, it should be noted that the terms "center," "upper," "lower," "left," "right," "vertical," "straight," "horizontal," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing the invention and for simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on the invention. Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance. The terms "first position" and "second position" refer to two different positions.

[0016] In the description of this invention, it should be noted that, unless otherwise explicitly specified and limited, the terms "installation," "connection," and "linking" should be interpreted broadly. For example, they can refer to fixed connections or detachable connections; mechanical connections or electrical connections; direct connections or indirect connections through an intermediate medium; and internal connections between two components. Those skilled in the art can understand the specific meaning of these terms in this invention based on the specific circumstances. Example 1

[0017] Determination of SQLE gene mutation sites in dermatophytes (as shown in the attached document) Figure 1 (as shown) First, dermatophyte strains were resuscitated and cultured. The minimum inhibitory concentration (MIC) of antifungal drugs for each strain was determined using the in vitro microbroth dilution method, and drug resistance was assessed using the provisional epidemiological cutoff value (0.125 mg / L) published by EUCAST, thus distinguishing between wild-type and drug-resistant strains. Subsequently, the genetic DNA of these strains was extracted and its concentration was measured. PCR amplification was performed using universal primers for the SQLE gene, followed by Sanger sequencing. The obtained SQLE gene sequence was compared with the dermatophyte SQLE reference sequence downloaded from the NCBI database to screen for relevant base mutation sites. Analysis identified the following six relevant mutation sites in the SQLE gene: SNP1: Leu393Ser, corresponding to the nucleotide mutation g.1178T>C; SNP2: Phe397Leu, corresponding to the nucleotide mutation g.1191C>A; SNP3: Phe397Leu, corresponding to the nucleotide mutation g.1189T>C; SNP4: Phe415Cys, corresponding to the nucleotide mutation g.1244T>G; SNP5: His440Tyr, corresponding to the nucleotide mutation g.1318C>T; SNP6: Ala448Thr, corresponding to the nucleotide mutation g.1342G>A; For the above mutation sites, specific forward primers, reverse primers, and dual fluorescent probes were designed, wherein: the wild-type probe was labeled with FAM fluorescent dye; and the mutant probe was labeled with ROX fluorescent dye. The nucleotide sequences of the specific primers and probes corresponding to each mutation site are shown in the table below:

[0018] The dual-probe system can identify wild-type and mutant sequences separately, enabling rapid typing and detection of SQLE-related mutation sites. The principle is detailed in the attached figure. Figure 2 As shown. Example 2

[0019] Standard PCR amplification verification: First, comparison of the primer-amplified DNA sequences in the NCBI database showed that the specific primer and probe combination of the present invention achieved 100% specificity, meaning it only targeted the target mutation sites and no non-specific amplification was detected. Second, to verify the amplification specificity of the above-mentioned specific primers, conventional PCR was used to amplify the corresponding fragments at each mutation site. The total volume of the conventional PCB reaction system was 30 μL, including: 2 μL Primer Mix, 15 μL 2×HotStart PCR reaction premix, 11 μL nuclease-free water, and 2 μL DNA template. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min; followed by 40 cycles: 94℃ for 15 s, annealing for 20 s, and 72℃ for 20 s. The annealing temperature was determined by gradient optimization based on each primer pair.

[0020] The PCR amplification products were detected by agarose gel electrophoresis. The results showed that the amplification bands at the corresponding sites were clear and consistent with the expected fragment length, indicating that the designed primers had good amplification specificity (amplification results are attached). Figure 3 (As shown) Example 3

[0021] Establishment and optimization of dual-probe fluorescent PCR detection system: The SQLE mutation sites were detected using a dual-probe fluorescent PCR system. The total volume of the fluorescent PCR reaction system is 30 μL, and the reaction system is shown in the table below:

[0022] Fluorescent PCR reaction conditions: pre-denaturation at 95℃ for 3 min; followed by 40 cycles: 94℃ for 15 s, annealing for 20 s, and 72℃ for 20 s; among which, the annealing temperature gradient was optimized for each mutation site to obtain the optimal detection conditions that can clearly distinguish between wild-type and mutant sequences.

[0023] Optimization results show that the optimal annealing temperatures for each mutation site are as follows:

[0024] The above results demonstrate that the dual-probe fluorescent PCR system of this invention can specifically detect SQLE-related mutation sites. (Fluorescence amplification curves are attached.) Figure 4 (As shown) Example 4

[0025] Interpretation of fluorescent PCR results: After detecting the sample using the dual-probe fluorescent PCR system of this invention, the results are interpreted based on the fluorescence signals of the FAM and ROX channels: when the FAM channel is positive and the ROX channel is negative, it is determined to be a wild-type sequence; when the ROX channel is positive and the FAM channel is negative, it is determined to be a mutant sequence; when both the FAM and ROX channels are positive, it is determined to be a mixed mutation or a template of different genotypes; when both the FAM and ROX channels are negative, it is determined to be that the target sequence was not detected or the reaction was invalid. A schematic diagram of the above interpretation rules is attached. Figure 5 As shown. Example 5

[0026] Components of the test kit: The present invention provides a fluorescent PCR kit for detecting SQLE gene mutation sites in dermatophytes, comprising: a combination of specific primers and fluorescent probes for six mutation sites, 2×HotStart PCR reaction premix, nuclease-free water, a positive control, and a negative control; wherein the positive control is a DNA template containing the SQLE mutation site sequence; and the negative control is a template-free reaction system.

[0027] As a preferred embodiment, the kit can be used to detect at least one or more relevant mutation sites in the SQLE gene of dermatophytes.

[0028] The above embodiments are only for illustrating the technical concept and features of the present invention. Their purpose is to enable those skilled in the art to understand the content of the present invention and implement it. They should not be used to limit the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A fluorescent PCR composition for detecting SQLE gene mutation sites in dermatophytes, characterized in that: The composition includes specific primers and fluorescent probes for detecting SQLE gene mutation sites: SNP1: Leu393Ser, corresponding to the nucleotide mutation g.1178T>C; SNP2: Phe397Leu, corresponding to the nucleotide mutation g.1191C>A; SNP3: Phe397Leu, corresponding to the nucleotide mutation g.1189T>C; SNP4: Phe415Cys, corresponding to the nucleotide mutation g.1244T>G; SNP5: His440Tyr, corresponding to the nucleotide mutation g.1318C>T; SNP6: Ala448Thr, corresponding to the nucleotide mutation g.1342G>A; The nucleotide sequences of the specific primers for the Leu393Ser mutation are as follows: Forward primer: 5'-GTCATTGATCTCTGTCATC-3'; Reverse primer: 5'-GCCATCTATAAGTCCAAGT-3'; The nucleotide sequences of the specific primers for the Phe397Leu (1191C>A) mutation are as follows: Forward primer: 5'- GATCTCTGTCATCAATATTCTTG -3'; Reverse primer: 5'-AATGTCGTAATAGAACCAAGG-3'; The nucleotide sequences of the specific primers for the Phe397Leu (1189T>C) mutation are as follows: Forward primer: 5'-CATCAATATTCTTGCCCAGTC-3'; Reverse primer: 5'-GTAAGGTGTAGCCAGATAGC-3'; The nucleotide sequences of the specific primers for the Phe415Cys mutation are as follows: Forward primer: 5'- GAAAGTCCTGCAACGAG -3'; Reverse primer: 5'-TAGTAAGGTGTAGCCAGATA -3'; The nucleotide sequence of the primer specific to the His440Tyr mutation is as follows: Forward primer: 5'-AGGCATCATTCGATCAC-3'; Reverse primer: 5'-CTGCAGGCAGTAAGAAA-3'; The nucleotide sequences of the specific primers for the Ala448Thr mutation are as follows: Forward primer: 5'-CTTGGTTCTATTACGACATT-3'; Reverse primer: 5'-CGGCAAATACGAAAGGA-3'.

2. The fluorescent PCR composition for detecting SQLE gene mutation sites in dermatophytes according to claim 1, characterized in that: The fluorescent probe is a TaqMan fluorescent probe.

3. The fluorescent PCR composition for detecting SQLE gene mutation sites in dermatophytes according to claim 2, characterized in that: The fluorescent probes include wild-type probes and mutant probes, which are used to identify wild-type sequences and mutant sequences, respectively.

4. The fluorescent PCR composition for detecting SQLE gene mutation sites in dermatophytes according to claim 3, characterized in that: The wild-type probe is labeled with the fluorescent dye FAM, and the mutant probe is labeled with the fluorescent dye ROX.

5. The fluorescent PCR composition for detecting SQLE gene mutation sites in dermatophytes according to claim 4, characterized in that: The probe nucleotide sequences of the specific primers used to detect the Leu393Ser mutation are as follows: Wild-type probe (FAM): TTGCCCAGTCCTTATACTCTATATT; Mutant probe (ROX): TTGCCCAGTCCTCATACTCTATATT; The probe nucleotide sequences of the specific primers used to detect the Phe397Leu (1191C>A) mutation are as follows: Wild-type probe (FAM): ATACTCTATATTCGCCGCTGGTGAC; Mutant probe (ROX): ATACTCTATATTAGCCGCTGGTGAC; The probe nucleotide sequences of the specific primers used to detect the Phe397Leu (1189T>C) mutation are as follows: Wild-type probe (FAM): TTATACTCTATATTCGCCGCTGGTG; Mutant probe (ROX): TTATACTCTATACTCGCCGCTGGTG; The probe nucleotide sequences of the specific primers used to detect the Phe415Cys mutation are as follows: Wild-type probe (FAM): CTTCAGGTATTTCCAACTTGGAC; Mutant probe (ROX): CTTCAGGTATTGCCAACTTGGAC; The probe nucleotide sequences for the specific primers used to detect the His440Tyr mutation are as follows: Wild-type probe (FAM): TTCTATTACGACATTTTTACTCCGT; Mutant probe (ROX): TTCTATTACGACGTTTTTACTCCGT; The probe nucleotide sequences of the specific primers used to detect the Ala448Thr mutation are as follows: Wild-type probe (FAM): AGCCTTCCTCGCTATCTGGC; Mutant probe (ROX): AGCCTTCCTCACTATCTGGC.

6. A fluorescent PCR kit for detecting SQLE gene mutation sites in dermatophytes, characterized in that: The reaction mixture includes the specific primer and probe composition, 2×HotStart PCR reaction premix, nuclease-free water, positive control, and negative control; the positive control is a DNA template containing the SQLE mutation site sequence; the negative control is a template-free reaction system.

7. A method for detecting SQLE gene mutation sites in dermatophytes, characterized in that: include: (1) Extract DNA from the dermatophyte sample to be tested; (2) Mix DNA with a combination of specific primers and probes for mutation; (3) Perform fluorescent PCR amplification; (4) Determine the SQLE mutation site based on the fluorescence signal.

8. The method for detecting SQLE gene mutation sites in dermatophytes according to claim 7, characterized in that: When the wild-type probe shows a positive fluorescence signal and the mutant probe shows a negative fluorescence signal, it is determined to be a wild-type sequence; when the mutant probe shows a positive fluorescence signal and the wild-type probe shows a negative fluorescence signal, it is determined to be a mutant sequence; when both fluorescence signals are positive, it is determined to be a mixed mutation or the presence of different genotype templates; when both fluorescence signals are negative, it is determined to be that the target sequence was not detected or the reaction failed.