A rapid one-tube detection method and kit for RPA-CRISPR / Cas12a of the fungus causing black spot root rot in melons.

Abstract

This invention relates to the field of molecular detection technology for plant pathogens, and particularly to a rapid one-tube RPA-CRISPR / Cas12a detection method and kit for *Trichoderma harzianum*, the causal agent of black spot root rot in melon. The method involves extracting DNA from the sample; constructing a one-tube reaction system containing recombinase polymerase amplification reagent, CRISPR / Cas12a detection reagent, and the sample DNA within the same tube; wherein the recombinase polymerase amplification reagent includes a specific RPA primer pair designed for the *Trichoderma harzianum* TUB gene; and the CRISPR / Cas12a detection reagent includes Cas12a protein, a specific crRNA designed for the *Trichoderma harzianum* TUB gene, and a single-stranded DNA reporter molecule; and conducting the reaction under isothermal conditions. This invention utilizes a fully enclosed reaction system to effectively avoid the risk of aerosol contamination from opening the tube and transferring the solution, ensuring safe and reliable operation, and making it suitable for rapid on-site diagnostic scenarios such as ports, fields, and grassroots laboratories.

Description

Technical Field

[0001] This invention relates to a rapid one-tube detection method and kit for RPA-CRISPR / Cas12a of the fungus causing black spot root rot in melons, belonging to the field of molecular detection technology for plant pathogens. Background Technology

[0002] The fungus *Monosporascus cannonballus*, which causes black spot root rot in melons, is a quarantine pest for imported plants. It can infect various cucurbitaceous crops such as melons and watermelons, causing economic losses of 10% to 25%, and in severe cases, it can lead to complete crop failure. The disease is locally distributed, and with the growth of the import trade of cucurbit seeds and products, the risk of its introduction and spread through infected materials has increased significantly.

[0003] Currently, there are no established detection standards for this pathogen. Conventional pathogen isolation and detection methods are time-consuming and cumbersome, making it difficult to meet the needs for rapid clearance and early field warning.

[0004] Existing nucleic acid detection technologies such as polymerase chain reaction (PCR) and real-time quantitative PCR (qPCR) have high sensitivity and specificity, but they rely on sophisticated thermal cycling instruments, making them unsuitable for resource-constrained or field environments. Isothermal amplification technologies such as loop-mediated isothermal amplification (LAMP) can be performed at constant temperature, but primer design is complex and prone to non-specific amplification. Recombinase polymerase amplification (RPA) technology can complete amplification within 20-30 minutes at a constant temperature of 37-42℃, and is simple to operate with low equipment dependence. In recent years, the CRISPR / Cas12a system has been developed as a high-sensitivity nucleic acid detection tool due to its characteristic of activating trans-cleavage activity after recognizing the target. Combining RPA with CRISPR / Cas12a can further improve the specificity and sensitivity of detection. However, existing combination methods are mostly two-step methods (amplification first, then opening the cap to transfer the product), which poses a risk of aerosol contamination and involves many steps. Therefore, there is an urgent need to improve the RPA-CRISPR / Cas12a one-tube rapid detection method and kit for a fungus that causes black spot root rot in melons to solve the above-mentioned problems. Summary of the Invention

[0005] The purpose of this invention is to provide a rapid one-tube detection method and kit for RPA-CRISPR / Cas12a of the fungus causing black spot root rot in melons, in order to solve the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] First aspect: Composition and preparation of the kit: This kit is a premixed one-tube reaction system. All detection components, except DNA template and magnesium acetate, are pre-placed in the same reaction tube.

[0009] 1. Reagent kit components

[0010] Each reaction system has a total volume of 50 μL and contains the following components:

[0011] RPA amplification: In a reaction tube containing lyophilized enzyme powder (including recombinase, single-stranded binding protein, and DNA polymerase), pre-add 29.4 μL of RPA reaction buffer A, 2.5 μL of 10 μmol / L RPA upstream primer, and 2.5 μL of 10 μmol / L RPA downstream primer. The upstream primer sequence is SEQ ID NO:1 (5'-TTGATGGGAATGCCACTAACCGCGTCTTTCC-3'), and the downstream primer sequence is SEQ ID NO:3 (5'-CTCGGAGGCACCACTGTAGCTGTTTGGCAGT-3').

[0012] CRISPR / Cas12a detection section: The premixed solution includes 1 μL of Cas12a protein (LbCas12a) at a concentration of 10 μmol / L, 1 μL of complete crRNA (SEQ ID NO:10, 5'-UAAUUUCUACUAAGUGUAGAUCCAUCGUGGCGCCUUGGUGAAUU-3') at a concentration of 10 μmol / L, 1 μL of single-stranded DNA reporter molecule, 0.5 μL of RNase inhibitor (20 U / μL), 2 μL of 10×Cas12a buffer, 6 μL of 15% glycerol (optional, for improving stability), and the remainder is made up with DEPC-treated water.

[0013] Single-stranded DNA reporter molecules are classified into two types according to the detection method: the fluorescence method reporter molecule is a sequence labeled with FAM at the 5' end and BHQ1 at the 3' end (SEQ ID NO:8, 5'-FAM-CCACCC-BHQ1-3'), with a working concentration of 500 nmol / L; the test strip method reporter molecule is a sequence labeled with FAM at the 5' end and Biotin at the 3' end (SEQ ID NO:13, 5'-FAM-TTTTTTTTTTT-Biotin-3'), with a working concentration of 125 nmol / L.

[0014] The reaction initiation reagent is magnesium acetate (B buffer), 2.5 μL is added to each tube just before use.

[0015] 2. Reagent Kit Packaging

[0016] Pre-pack all components except magnesium acetate and DNA template into 0.2 mL PCR tubes and store at -20°C. Magnesium acetate is provided separately, 2.5 μL per tube. The kit also includes a positive control (260 pg / μL of the TUB gene fragment of *Cyperus rotundus*) and a negative control (ddH2O).

[0017] Second aspect: Testing operation procedure

[0018] 1. Rapid DNA extraction from samples

[0019] This method is applicable to melon seed, root tissue, or mycelial samples. Place approximately 0.1 g of seed powder or 0.2 g of tissue into a 1.5 mL centrifuge tube, add 300 µL of lysis buffer, vortex to mix, heat at 100°C for 10 minutes, cool, and centrifuge at 12,000 rpm for 2 minutes. The supernatant is the crude DNA extract, which can be used directly for detection or stored at -20°C for later use.

[0020] 2. Construction of a one-tube reaction system

[0021] Add 5 μL of DNA template (if the template volume is less than 5 μL, make up the difference with DEPC-treated water) to a reaction tube pre-filled with all components except magnesium acetate and DNA template. Gently tap to mix and centrifuge briefly. Add 2.5 μL of magnesium acetate along the tube wall, tighten the cap, mix again, and centrifuge.

[0022] 3. Reaction conditions

[0023] Place the reaction tube at a constant temperature of 38°C for 60 minutes. A constant temperature metal bath, water bath, or portable thermostat can be used; no temperature control circulation is required.

[0024] 4. Result Interpretation

[0025] Fluorescence method: After the reaction is complete, place the reaction tube under a portable blue light exciter and observe it with the naked eye. If the reaction solution emits obvious green fluorescence, it is considered positive; no fluorescence is considered negative.

[0026] Test strip method: After the reaction is complete, take 5 μL of the reaction solution and dilute it to 50 μL with deionized water. Insert the Cas12 / 13 dedicated nucleic acid test strip and perform chromatography at room temperature for 5 minutes. If both the control line (C line) and the test line (T line) appear simultaneously, the result is positive; if only the C line appears, the result is negative.

[0027] Third aspect: Basis for key parameter optimization

[0028] Key parameters of this method were determined through systematic optimization: RPA primers were screened by agarose gel electrophoresis, with RPA-F and RPA-2R showing the brightest amplification bands without non-specificity; crRNA was selected based on fluorescence comparison, with crRNA2 (SEQ ID NO:10) showing the strongest signal; the optimal molar ratio of Cas12a to crRNA was 1:1; the optimal concentration of the reporter molecule for fluorescence method was 500 nmol / L, and for the test strip method it was 125 nmol / L; the optimal RPA amplification time was 20 min (determined separately in the two-step method, and integrated into the total reaction within 60 min in the one-step method); the optimal incubation time for the test strip was 10 min (data from the two-step method; in the one-step method, the strip was diluted and directly chromatographically analyzed for 5 min after the reaction). All optimization experiments used ddH2O as a blank control, and the results verified the reliability of this system.

[0029] Fourthly, the sequence lists involved in the technical solution are summarized as follows:

[0030] SEQ ID NO:1 is the upstream primer RPA-F, DNA type, 31 nucleotides in length, with the sequence: TTGATGGGAATGCCACTAACCGCGTCTTTCC, unmodified.

[0031] SEQ ID NO:3 is the downstream primer RPA-2R, DNA type, 30 nucleotides in length, with the sequence: CTCGGAGGCACCACTGTAGCTGTTTGGCAGT, unmodified.

[0032] SEQ ID NO:8 is a crRNA stem-loop sequence, RNA type, 21 nucleotides in length, sequence: UAAUUUCUACUAAGUGUAGAU, unmodified, this sequence is a conserved stem-loop structure recognized by Cas12a.

[0033] SEQ ID NO:10 is the crRNA target recognition sequence crRNA2, an RNA type, 23 nucleotides in length, with the sequence: CCAUCGUGGCGCCUUGGUGAAUU, unmodified, and is the preferred crRNA.

[0034] SEQ ID NO:13 is a fluorescent single-stranded DNA reporter molecule, DNA type, 5 nucleotides in length, with the sequence CCACCC, a FAM fluorescent group attached to its 5′ end, and a BHQ1 quencher group attached to its 3′ end.

[0035] Compared with the prior art, the beneficial effects of the present invention are:

[0036] This invention utilizes specific RPA primers and crRNA designed targeting the TUB gene of the fungus causing black spot root rot in melons to achieve highly specific detection with no cross-reactivity with multiple control strains. It exhibits high sensitivity, with a detection limit of 26 pg / μL using fluorescence and 2.6 pg / μL using test strips. It can stably detect bacterial suspensions as low as 16 μL in simulated infected seed samples. The detection is rapid and convenient, completing a single-tube reaction within 60 minutes at a constant temperature of 38℃, eliminating the need for complex equipment such as thermal cyclers. Results can be observed visually under blue light excitation or interpreted via test strip chromatography. The fully enclosed reaction effectively avoids the risk of aerosol contamination from opening the cap and transferring the solution, ensuring safe and reliable operation. It is suitable for rapid on-site diagnostic scenarios such as ports, fields, and grassroots laboratories. Attached Figure Description

[0037] Figure 1 This is a flowchart of a one-tube rapid detection method for RPA-CRISPR / Cas12a, a pathogen causing black spot root rot in melons, according to the present invention.

[0038] Figure 2 This is an agarose gel electrophoresis image of the three pairs of RPA primers of this invention;

[0039] Figure 3 This is a comparison diagram of the reaction effects of different crRNAs in the CRISPR system according to the present invention;

[0040] Figure 4 This is a diagram verifying the Cas12a protein cleavage activity of the present invention;

[0041] Figure 5 This is a diagram showing the concentration ratio of Cas12a to crRNA protein in this invention;

[0042] Figure 6 This is a diagram showing the optimized RPA reaction time of the present invention;

[0043] Figure 7 This is a graph showing the optimized concentration of the RPA / CRISPR-Cas12a fluorescence-based reporter molecule in this invention.

[0044] Figure 8 This is a diagram showing the optimized probe concentration for the RPA / CRISPR-Cas12a test strip method of this invention;

[0045] Figure 9 This is a graph showing the optimized incubation time results for the test strips of this invention;

[0046] Figure 10 This is a diagram illustrating the specificity verification of the RPA-CRISPR / Cas12a fluorescence method of this invention.

[0047] Figure 11 This is a diagram illustrating the specificity verification of the RPA-CRISPR / Cas12a test strip method of this invention.

[0048] Figure 12 This is a sensitivity evaluation diagram of the RPA-CRISPR / Cas12a detection system of the present invention;

[0049] Figure 13 This is a sensitivity evaluation diagram of the RPA-CRISPR / Cas12a test strip method system of the present invention;

[0050] Figure 14 This is a diagram showing the simulated bacterial sample detection results of the present invention;

[0051] Figure 15 This is a diagram showing the actual sample test results of this invention;

[0052] Figure 16 This is a graph showing the sensitivity detection results of the RPA-CRISPR / Cas12a one-step fluorescence method of this invention;

[0053] Figure 17 This is a graph showing the sensitivity detection results of the RPA-CRISPR / Cas12a one-step test strip method of the present invention;

[0054] Figure 18 This is a graph showing the specificity detection results of the one-step fluorescence method using RPA-CRISPR / Cas12a according to the present invention;

[0055] Figure 19 This is a diagram showing the specificity detection results of the RPA-CRISPR / Cas12a one-step test strip method of the present invention;

[0056] Figure 20 This is a diagram showing the results of simulating bacterial sample detection using the RPA-CRISPR / Cas12a one-step method of this invention.

[0057] Figure 21 This is a technical roadmap for the present invention.

[0058] Figure 2 In the diagram, M stands for Marker, 1 for RPA-F / R, 2 for RPA-F / 2R, 3 for RPA-3F / 3R, and 4 for RPA-4F / 4R.

[0059] Figure 4 In the table, samples 1-4 are treated with missing components, sample 5 is treated with all components, and C is the missing component table;

[0060] Figure 5 In this study, the Cas12a / crRNA ratios for treatments 1-4 were 1:0.1, 1:0.5, 1:1, and 1:2, respectively, with CK serving as the blank control.

[0061] Figure 7In the study, the probe concentrations for treatments 1-5 were 1000 nmol / L, 500 nmol / L, 250 nmol / L, 125 nmol / L, and 62.5 nmol / L, respectively, while treatment 6 served as a blank control.

[0062] Figure 8 In the study, the probe concentrations for treatments 1-5 were 1000 nmol / L, 500 nmol / L, 250 nmol / L, 125 nmol / L, and 62.5 nmol / L, respectively. Treatment 6 served as a blank control. T was the positive detection line, C was the negative detection line, P was the positive result, and N was the negative result.

[0063] Figure 9 In the above, treatments 1-6 represent reaction times of 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min, respectively. T is the positive detection line, C is the negative detection line, P is the positive result, and N is the negative result.

[0064] Figure 10 In the figure, treatments 1-2 are the causal agent of melon black spot root rot, treatments 3-10 are control strains, and CK is the blank control. In the figure, 10-A shows that under blue light irradiation, only 2 strains of melon black spot root rot (Monosporascus cannonballus) showed obvious green fluorescence signals, while the other 8 control strains did not produce visible fluorescence. 10-B shows that quantitative analysis by fluorescence PCR also showed strong fluorescence signals only in the above 2 target pathogens, while other strains did not show significant signals.

[0065] Figure 11 In the diagram, treatments 1-2 were for the fungus causing black spot root rot in melons, treatments 3-10 were for the control strains, CK was the blank control, T was the positive detection line, C was the negative detection line, P was the positive result, and N was the negative result.

[0066] Figure 12 In the study, the nucleic acid concentrations for treatments 1-7 were 2.6 ng / μL, 260 pg / μL, 26 pg / μL, 2.6 pg / μL, 260 fg / μL, 26 fg / μL, and 2.6 fg / μL, respectively, while treatment 8 served as a blank control.

[0067] Figure 13 In the study, the nucleic acid concentrations for treatments 1-7 were 2.6 ng / μL, 260 pg / μL, 26 pg / μL, 2.6 pg / μL, 260 fg / μL, 26 fg / μL, and 2.6 fg / μL, respectively. Treatment 8 served as a blank control. T was the positive detection line, C was the negative detection line, P was a positive result, and N was a negative result.

[0068] Figure 14 In the above, treatments 1-6 represent the detection results for bacterial loads of 64 μL (64 mg / μL), 32 μL (32 mg / μL), 16 μL (16 mg / μL), 8 μL (8 mg / μL), 4 μL (4 mg / μL), and 2 μL (2 mg / μL), respectively. T represents the positive detection line, C represents the negative detection line, P represents a positive result, and N represents a negative result.

[0069] Figure 16 In this study, treatments 1-7 had concentrations of 2.6 ng / μL - 2.6 fg / μL, with the control (CK) serving as a blank control.

[0070] Figure 17 In this study, treatments 1-7 were administered at concentrations of 2.6 ng / μL - 2.6 fg / μL. CK was the blank control, T was the positive detection line, C was the negative detection line, P was the positive result, and N was the negative result.

[0071] Figure 18 In the study, treatments 1 and 2 were infected with the fungus *Fusarium wilt*, treatments 3-10 were control strains, and CK was the blank control.

[0072] Figure 19 In the diagram, treatments 1 and 2 were for *Trichoderma solani*, treatments 3-10 were for control strains, CK was the blank control, T was the positive detection line, C was the negative detection line, P was the positive result, and N was the negative result.

[0073] Figure 20 In the above, treatments 1-5 represent the detection results for bacterial loads of 64 μL, 32 μL, 16 μL, 8 μL, and 4 μL, respectively. CK is the blank control, T is the positive detection line, C is the negative detection line, P is the positive result, and N is the negative result. Detailed Implementation

[0074] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0075] like Figures 1-21 As shown in the example, an RPA-CRISPR / Cas12a one-tube rapid detection method and kit for melon black spot root rot fungus are provided. The technical effects of the present invention are verified through specific embodiments below. Unless otherwise specified, the reagents, instruments and operations used in the embodiments follow the specific implementation methods described above. The information on the test strains involved in the embodiments is shown in Table 2-1 below;

[0076] Table 2-1 Pathogen information of the tested strains

[0077] Table 2-1 Pathogen information of the strain being tested

[0078] 1 MC26931 Melon black spot root rot fungus Monosporascus cannonballus melon ATCC 2 MC76452 Melon black spot root rot fungus Monosporascus cannonballus melon ATCC 3 CBS71076 Cucumber black root rot fungus Phomopsis sclerotioides cucumber This laboratory 4 6032-1 Cucurbit blight fungus Stagonosporopsis cucurbitacearum Plain sunflower seeds Shanghai Customs 5 201923 Cucurbit blight fungus Stagonosporopsis cucurbitacearum cantaloupe ATCC 6 G-1 Cucurbit blight fungus Stagonosporopsis cucurbitacearum melon Shihezi University 7 NKY-4 Anthracnose fungus Colletorichum lagenerium melon Xinjiang Academy of Agricultural Sciences 8 YM-1 Flax wilt fungus Fusarium lini flax Tekes 9 GF-1 Melon Fusarium Fruit Rot Fusarium incarnatum melon Ili 10 36382 Verticillium dahliae Verticillium dahliae cotton ACCC

[0079] Example 1: One-tube, one-step specificity detection

[0080] Objective: To verify the specificity of the RPA-CRISPR / Cas12a one-tube one-step detection system established in this invention against Monosporascus cannonballus, the pathogen causing black spot root rot in melons.

[0081] Materials: A total of 10 bacterial strains were tested, information of which is shown in Table 2-1. These included two strains of *Phomopsis sclerotioides* (MC26931 and MC76452, purchased from ATCC) and eight control strains: *Phomopsis sclerotioides* (CBS71076), *Stagonosporopsis cucurbitacearum* (6032-1, 201923, G-1), *Colletorichum lagenerium* (NKY-4), *Fusarium lini* (YM-1), *Fusarium incarnatum* (GF-1), and *Verticillium dahliae* (36382). Instruments used included a QuantStudio™ 7Flex real-time PCR instrument, a NanoDrop ND-1000 spectrophotometer, and a water bath shaker. The reagents were prepared according to the technical solution of the present invention, wherein the reported molecule concentration by fluorescence method was 500 nmol / L (SEQ ID NO:8) and the reported molecule concentration by test strip method was 125 nmol / L (SEQ ID NO:13).

[0082] Methods: 1. Each tested strain was inoculated onto a PDA plate and cultured in the dark at 25°C for 3-5 days. Genomic DNA was extracted from each strain using a plant genomic DNA extraction kit, and the concentration was determined by spectrophotometer and uniformly diluted to approximately 2.6 ng / μL.

[0083] 2. According to the one-tube reaction system construction method of the present invention, 5 μL of each of the above DNA samples were used as templates to set up a positive control (MC26931 DNA) and a negative control (ddH2O), with three replicates for each group.

[0084] 3. Place the reaction tube at 38℃ for 60 minutes and simultaneously turn on real-time fluorescence acquisition (once every 30 seconds, for a total of 120 cycles).

[0085] 4. After the reaction is complete, observe the green fluorescence under a blue light excitation instrument and record the real-time fluorescence curve; for the test strip method, take 5 μL of reaction solution, dilute it with deionized water to 50 μL, insert the Cas12 / 13 special nucleic acid detection test strip, and interpret the result after 5 minutes of chromatography at room temperature.

[0086] Results: The results of the fluorescence detection method are as follows: Figure 18 As shown: Only the reaction tubes of two melon black spot root rot pathogens, MC26931 and MC76452, emitted obvious green fluorescence under blue light, and the real-time fluorescence curve signal increased significantly; the other 8 control strains and negative controls showed no visible fluorescence, and the fluorescence curves were flat.

[0087] Test strip method test results are as follows Figure 19 As shown: The test strip for the sample of melon black spot root rot fungus showed both the control line (C line) and the test line (T line), and was judged as positive; the control strain and the negative control showed only the C line, and were judged as negative.

[0088] Conclusion: The one-tube, one-step detection system established in this invention has high specificity for the black spot root rot pathogen of melon and shows no cross-reaction with the eight other common cucurbit pathogens and closely related fungi tested.

[0089] Example 2: One-tube one-step sensitivity detection

[0090] Objective: To determine the limit of detection (LOD) of the DNA of the fungus causing black spot root rot in melon using the detection system of this invention.

[0091] Materials: Genomic DNA of the melon black spot root rot pathogen MC26931, initial concentration 2.6 ng / μL. Kit used was the same as in Example 1.

[0092] Methods: 1. The 2.6 ng / μL DNA template was serially diluted 10-fold with ddH2O to obtain 7 concentrations: 2.6 ng / μL, 260 pg / μL, 26 pg / μL, 2.6 pg / μL, 260 fg / μL, 26 fg / μL, and 2.6 fg / μL.

[0093] 2. Using 5 μL of each dilution as a template, the test was performed using a one-tube method, with three replicates for each concentration, and a negative control (ddH2O) was also included. The reaction conditions were the same as in Example 1.

[0094] 3. After the reaction is complete, the results are interpreted using both fluorescence and test strip methods, and the highest dilution at which a positive signal is observed is recorded.

[0095] Results: The results of the fluorescence detection method are as follows: Figure 16 As shown: Under blue light, samples with concentrations of 2.6 ng / μL, 260 pg / μL, and 26 pg / μL emitted green fluorescence, and the real-time fluorescence curves showed a typical rising trend; concentrations of 2.6 pg / μL and lower showed no visible fluorescence, and the curves overlapped with the negative control. Therefore, the detection limit of the fluorescence method is 26 pg / μL.

[0096] Test strip method test results are as follows Figure 17 As shown: samples with concentrations of 2.6 ng / μL, 260 pg / μL, 26 pg / μL, and 2.6 pg / μL all showed a positive T line (the T line at 2.6 pg / μL was slightly lighter in color but still clearly identifiable); no T line was observed at concentrations of 260 pg / μL and lower. Therefore, the detection limit of the test strip method is 2.6 pg / μL.

[0097] Conclusion: The sensitivity of the one-tube, one-step detection system of this invention can reach the pg level. The sensitivity of the test strip method (2.6 pg / μL) is higher than that of the fluorescence method (26 pg / μL). The reporter molecule type can be selected according to actual needs.

[0098] Example 3: Detection of simulated bacteria-carrying seed samples (one-tube, one-step method)

[0099] Objective: To evaluate the detection capability of the detection system of the present invention for actual infected seeds, simulating the scenario of imported seeds at the port carrying the melon black spot root rot pathogen.

[0100] Materials: Mycelium of MC26931, the pathogen causing black spot root rot in melons (freshly cultured on PDA plates); sterile melon seed powder (0.1 g per portion, obtained by grinding healthy melon seeds after high-pressure sterilization); lysis buffer.

[0101] Method: 1. Take 0.1 g of mycelium, grind it with liquid nitrogen, add 200 μL of sterile ddH2O, shake and mix well to prepare a bacterial suspension with a concentration of about 64 mg / μL (wet weight / volume).

[0102] 2. Take 64 μL, 32 μL, 16 μL, 8 μL, and 4 μL of bacterial suspension, respectively, and mix them thoroughly with 0.1 g of sterile melon seed powder to obtain simulated bacterial-bearing samples with different pathogen loads. Sterile seed powder without bacterial suspension was used as a negative control.

[0103] 3. Extract DNA from each sample using the boiling lysis method: Add 300 µL of lysis buffer to the sample, vortex to mix, heat at 100℃ for 10 minutes, cool, centrifuge at 12,000 rpm for 2 minutes, and use the supernatant as a template.

[0104] 4. The test was performed using the one-tube system of this invention. After reacting at 38°C for 60 minutes, the results were interpreted using both fluorescence and test strip methods. Each sample was tested in triplicate.

[0105] Results: The test results are as follows Figure 20 As shown (left is the fluorescence curve, right is a photo of the test strip):

[0106] Samples with 64 μL, 32 μL, and 16 μL of bacterial suspension added: green fluorescence was visible under blue light using the fluorescence method, and the real-time fluorescence curve showed a significant increase; the test strip method showed both C and T lines, indicating a positive result.

[0107] Add 8 μL and 4 μL of sample: no green fluorescence was observed in the fluorescence method, and the curve coincided with the negative control; only the C line appeared on the test strip, indicating a negative result.

[0108] Negative control: No fluorescence, only C line.

[0109] Conclusion: The one-tube, one-step detection system of this invention can reliably detect simulated infected seed samples with a bacterial suspension addition of ≥16 μL (approximately 16 mg of wet mycelium / 0.1 g of seed), which can meet the rapid quarantine requirements of actual imported seeds.

[0110] Example 4: Detection of actual seed samples

[0111] Objective: To verify the applicability of the detection system of the present invention to real samples and to detect whether there is melon black spot root rot fungus in imported melon seeds collected in the laboratory.

[0112] Materials: 30 melon seed samples collected in the laboratory (sources included imported melon seeds, watermelon seeds, etc.); positive control was MC26931 genomic DNA (2.6 ng / μL); negative control was ddH2O.

[0113] method:

[0114] 1. Take 0.1 g of seeds for each sample, grind them into powder, and then extract DNA using the boiling lysis method (same as Example 3).

[0115] 2. Using the DNA from each sample as a template, perform the detection according to the one-tube, one-step method of this invention, with two replicates for each sample. Positive and negative controls are also included.

[0116] 3. After the reaction, the results are interpreted using the test strip method (because the test strip method is simpler to operate and suitable for batch sample screening).

[0117] Results: The test results are as follows Figure 15As shown in the figure (this image is from the two-step method, but the one-step method yields consistent results for the same samples): All 30 seed sample test strips showed only the control line (C line), with no test line (T line), indicating a negative result. The positive control test strip showed both the C and T lines clearly, while the negative control only showed the C line.

[0118] Conclusion: No *Malus thunbergii*, the pathogen causing black spot root rot in melons, was detected in any of the 30 melon seed samples collected in our laboratory. The detection system of this invention has good applicability to actual samples, and the results are accurate and reliable.

[0119] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A rapid one-tube RPA-CRISPR / Cas12a detection method for the fungus causing black spot root rot in melons, comprising the following steps: Extract DNA from the sample to be tested; Construct a single-tube reaction system, wherein the reaction system simultaneously contains recombinase polymerase amplification reaction reagent, CRISPR / Cas12a detection reagent, and DNA of the sample to be tested in the same reaction tube; The recombinase polymerase amplification reaction reagent includes a specific RPA primer pair designed for the TUB gene of the melon black spot root rot fungus; The CRISPR / Cas12a detection reagent includes Cas12a protein, specific crRNA designed for the TUB gene of melon black spot root rot fungus, and single-stranded DNA reporter molecule. The one-tube reaction system was subjected to a reaction under isothermal conditions, simultaneously completing RPA amplification and CRISPR / Cas12a cleavage reaction. The signal generated by the detection reaction is used to determine whether the sample contains melon black spot root rot fungus.

2. The rapid RPA-CRISPR / Cas12a detection method for melon black spot root rot fungus according to claim 1, characterized in that: The constant temperature conditions are 37℃-42℃; the reaction time is 50-70 minutes.

3. The rapid RPA-CRISPR / Cas12a detection method for melon black spot root rot fungus according to claim 1, characterized in that: The molar ratio of Cas12a protein to crRNA is 1:0.5-1:

2.

4. The rapid RPA-CRISPR / Cas12a detection method for melon black spot root rot fungus according to claim 1, characterized in that: The single-stranded DNA reporter molecule is a fluorescent reporter molecule or a lateral flow test strip reporter molecule; the signal is a fluorescent signal or a colorimetric signal from the test strip.

5. The rapid RPA-CRISPR / Cas12a detection method for melon black spot root rot fungus according to claim 1, characterized in that: The upstream primer sequence of the specific RPA primer pair is shown in SEQ ID NO:1, and the downstream primer sequence is shown in SEQ ID NO:

3.

6. The rapid RPA-CRISPR / Cas12a detection method for melon black spot root rot fungus according to claim 1, characterized in that: The complete sequence of the specific crRNA consists of a stem-loop sequence and a target recognition sequence, as shown in SEQ ID NO:

10.

7. The rapid RPA-CRISPR / Cas12a detection method for melon black spot root rot fungus according to claim 1, characterized in that: The sequence of the fluorescent reporter molecule is shown in SEQ ID NO:8, with the 5′ end labeled with the FAM fluorescent group and the 3′ end labeled with the BHQ1 quencher group.

8. The rapid RPA-CRISPR / Cas12a detection method for melon black spot root rot fungus according to claim 1, characterized in that: The sequence of the lateral flow test strip reporting molecule is shown in SEQ ID NO:13, with a FAM group labeled at its 5′ end and a Biotin group labeled at its 3′ end.

9. A rapid RPA-CRISPR / Cas12a single-tube detection kit for the pathogen causing black spot root rot in melons, characterized in that: The kit includes: Recombinase polymerase amplification reaction reagent, wherein the reagent contains a specific RPA primer pair designed for the TUB gene of the fungus causing black spot root rot in melon; CRISPR / Cas12a detection reagent, the reagent contains Cas12a protein, specific crRNA designed for the TUB gene of melon black spot root rot fungus, and single-stranded DNA reporter molecule. Reaction buffer and / or reaction initiation reagent.

10. The reagent kit according to claim 9, characterized in that, The upstream primer sequence of the specific RPA primer pair is shown in SEQ ID NO:1, and the downstream primer sequence is shown in SEQ ID NO:3; the complete sequence of the specific crRNA is shown in SEQ ID NO:10; the single-stranded DNA reporter molecule is a fluorescent reporter molecule with the sequence shown in SEQ ID NO:8 or a lateral flow test strip reporter molecule with the sequence shown in SEQ ID NO:

13. In the kit, Cas12a protein and crRNA are pre-mixed or packaged separately at a molar ratio of 1:0.5-1:2; The kit also includes a positive control and a negative control; the positive control is a standard containing the TUB gene fragment of the fungus *Trichophyton spp.*, the causal agent of melon black spot root rot. The concentration of the positive control was 260 pg / μL.

Images