Molecular markers related to starch gelatinization temperature and enthalpy of maize kernels and their applications

CN122564166APending Publication Date: 2026-08-14YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-08
Publication Date
2026-08-14

AI Technical Summary

Technical Problem

[0004]尽管当前针对玉米淀粉理化性质相关基因的研究已有部分报道,但已鉴定的基因数量仍较为匮乏

Benefits of technology

1、利用本发明提供的分子标记,可以快速、准确地鉴定不同基因型的玉米种质资源,可广泛用于玉米籽粒淀粉糊化温度和热焓值的分子标记辅助育种及全基因组选择育种,加快育种进程;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122564166A_ABST
    Figure CN122564166A_ABST
Patent Text Reader

Abstract

This invention discloses a molecular marker related to the gelatinization temperature and enthalpy of corn kernel starch and its application. This invention successfully developed two corn-based... waxy1 ( GRMZM2G024993 Molecular markers for the gene mutation sites SNP2972 and SNP3058, provided by the molecular markers. waxy1 -SNP2972 and waxy1 -SNP3058 can accurately, efficiently, and stably distinguish the alleles at this locus, and carries SNP2972. CC The starch gelatinization temperature of maize inbred lines carrying the allele 2972 ​​was significantly lower than that of lines carrying SNP 2972. TT The inbred line has a significantly higher enthalpy than SNP2972. TT Type inbred line, carrying SNP3058 CC The starch gelatinization temperature of maize inbred lines with alleles was significantly higher than that of SNP3058. TT The inbred line has a significantly lower enthalpy than SNP3058. TT Inbred lines of this type. The molecular markers of this invention enable rapid genotypic identification of starch quality in large-scale breeding populations, providing an efficient detection tool for marker-assisted breeding of high-quality maize.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to maize genetics and breeding, specifically to maize. waxy1 Two functional SNP sites within the gene that control the physicochemical properties of grain starch, a molecular marker developed using PARMS technology, and the application of this marker in improving the quality of maize starch. Background Technology

[0002] Corn is an important crop used globally as a food, feed, and industrial raw material. Waxy corn, due to its high amylopectin content, has processing advantages such as high viscosity, good freeze-thaw stability, and easy digestibility, and is widely used in food, papermaking, textiles, and biodegradable materials. waxy1 It is an important gene that regulates the synthesis of amylose and amylopectin in maize. Variations in its gene sequence directly determine core processing indicators such as starch gelatinization temperature (Ptemp) and enthalpy value (ΔHgel), making it a key gene for improving starch quality.

[0003] In recent years, with the rapid development of molecular biology and genomics technologies, marker-assisted selection (MAS) has gradually become a core technology in the field of crop genetic improvement. This technology relies on molecular markers closely linked to target traits to achieve indirect and precise selection of target genotypes. It not only effectively improves breeding efficiency but also significantly shortens the breeding cycle, demonstrating significant advantages in crop breeding practice. The penta-primer amplification refractory mutation system (PARMS) is a novel SNP PCR detection technology that integrates a pair of universal fluorescent primers, a pair of SNP allele-specific primers, and a reverse common primer. It features simple operation and rapid detection and is currently widely used in various research directions such as crop genotyping, marker-assisted selection, and gene mapping.

[0004] Although some studies have been reported on genes related to the physicochemical properties of maize starch, the number of identified genes remains relatively small. Therefore, developing molecular markers that are closely linked to the gelatinization temperature and enthalpy of maize kernel starch, and possess both stability and reliability, and rapidly applying them to maize breeding practices, has significant practical value for molecular breeding of waxy maize. Summary of the Invention

[0005] To address the limited correlation between existing molecular markers and traits related to corn starch quality, this invention provides a method based on corn... waxy1 ( GRMZM2G024993 PARMS molecular markers of two natural variations in the maize gene and their application in maize breeding. waxy1The physical location on the B73 reference genome (RefGen_V3) is Chr9:23267684-23271612.

[0006] Specifically, PARMS molecular markers include waxy1 -SNP2972 and waxy1 -SNP3058, the markers are respectively located at... waxy1 The gene (located on the reverse strand) is located at bases 2972 ​​and 3058 (ATG is numbered starting from 0). waxy1 The nucleotide sequence of -SNP2972 is shown in SEQ ID NO.7 (antisense strand), where R represents A or G (T or C in the sense strand). waxy1 The physical location corresponding to SNP2972 is Chr9:23268178; waxy1 The nucleotide sequence of -SNP3058 is shown in SEQ ID NO.8 (antisense strand), where R represents G or A (C or T in the sense strand). waxy1 The physical location corresponding to -SNP3058 is Chr9:23268092.

[0007] SEQ ID NO.7: CAGGCCGAACTCTTCAGGGCGCGGCCACGTTCTCCTTGGCGAGCGGCGCGATCTCCTCGCCTTCGACCCCTGGCTCGCCGCCGGCGACCCCGAGGCTGAGCAGCACGTTCTCCCAGTTCTTGGCAGGGCCCTGCGCATTTCGCAAATTAAR CCACGGTCAGCGACAGGAGCGAGGCGCGTACGTGTGGTCGGTCGGTCGATCGATCTTGGCGCTCTGCTCTGGCGGGGCGGGCGTACGTACCTTCCAGGAGATCCTGGATCATGCAGTTCCTCACCATCTCCTCGTACGCCGGCGTGCC.

[0008] SEQ ID NO.8: ATACTTGTCCATATCACATAAACGAAACAGCATATATAAGAAGATGTCCCAACATGTTTGCACCACGCGCGAGATCAGGGGGCCTGCAGGCCGAACTCTTCAGGGCGCGGCCACGTTCTCCTTGGCGAGCGGCGCGATCTCCTCGCCTTCR ACCCCTGGCTCGCCGCCGGCGACCCGAGGCTGAGCAGCACGTTCTCCCAGTTCTTGGCAGGGCCCTGCGCATTTCGCAAATTAAACCACGGTCAGCGACAGGAGCGAGGCGCGTACGTGTGGTCGGTCGGTCGATCGATCTTGGCGCTC.

[0009] Based on this, the first aspect of the present invention provides a reagent for detecting bases at positions 23268178 and 23268092 on maize chromosome 9, which is used in selective breeding for starch gelatinization temperature and enthalpy value of maize kernels. If base 23268178 on maize chromosome 9 is detected as the CC genotype, it indicates that the starch gelatinization temperature of maize kernels is low and the enthalpy value is high; if base 23268092 on maize chromosome 9 is detected as the CC genotype, it indicates that the starch gelatinization temperature of maize kernels is high and the enthalpy value is low.

[0010] The second aspect of this invention provides a reagent for detecting bases at positions 23268178 and 23268092 on maize chromosome 9, used in the preparation of a screening kit for the gelatinization temperature and enthalpy of maize kernel starch. If base 23268178 on maize chromosome 9 is detected as having the CC genotype, it indicates that the maize kernel starch has a low gelatinization temperature and a high enthalpy; if base 23268092 on maize chromosome 9 is detected as having the CC genotype, it indicates that the maize kernel starch has a high gelatinization temperature and a low enthalpy.

[0011] Preferably, the reagent is a primer.

[0012] Preferably, the primers are the PARMS detection primer set.

[0013] Specifically, the primer set includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.1. waxy1 -SNP2972Fg, forward primer with nucleotide sequence as shown in SEQ ID NO.2 waxy1 -SNP2972Fa; reverse primer with nucleotide sequence as shown in SEQ ID NO.3 waxy1 -SNP2972R; reverse primer with nucleotide sequence as shown in SEQ ID NO.4 waxy1-SNP3058Rc, reverse primer with nucleotide sequence as shown in SEQ ID NO.5 waxy1 -SNP3058Rt; forward primer with nucleotide sequence as shown in SEQ ID NO.6 waxy1 -SNP3058F.

[0014] waxy1- SNP2972Fg(FAM) (SEQ ID NO.1): 5'-GAAGGTGACCAAGTTCATGCTGTACGTGTGGTCGGTCGG-3'; waxy1- SNP2972Fa(HEX) (SEQ ID NO.2): 5'-GAAGGTCGGAGTCAACGGATTCGTACGTGTGGTCGGTCGA-3'; waxy1- SNP2972R (SEQ ID NO.3): 5'-TCTCTCCTGGAAGGTACGTACG-3'; waxy1- SNP3058Rc(FAM) (SEQ ID NO.4): 5'-GAAGGTGACCAAGTTCATGCTAGCCTCGGGGTCGCC-3'; waxy1- SNP3058Rt(HEX)(SEQ ID NO.5): 5'-GAAGGTCGGAGTCAACGGATTCAGCCTCGGGGTCGCT-3'; waxy1- SNP3058F (SEQ ID NO.6): 5'-GCGGCGCGATCTCCTC-3'; A third aspect of the present invention provides a method for detecting the gelatinization temperature and enthalpy value of corn kernel starch, comprising the following steps: (1) In the above waxy1 -SNP2972Fg waxy1 The 5' end of the SNP3058Rc is connected to a FAM fluorescent probe. waxy1 -SNP2972Fa、 waxy1 The 5' end of the SNP3058Rt is linked to a HEX fluorescent probe, and the genomic DNA of the maize inbred line to be tested is used as a template for quantitative real-time PCR amplification using the primer set described above. (2) Perform fluorescence signal scanning and genotype cluster analysis on the amplification products to determine the genotype of the test material at bases 23268178 and 23268092 on chromosome 9 of maize; (3) Determine the gelatinization temperature and enthalpy of corn kernel starch based on the genotype test results.

[0015] Specifically, in step (1), The quantitative real-time PCR reaction system is as follows: 10-100 ng DNA template, 0.15 μL waxy1 -SNP2972Fa / Fg, 0.15 μL waxy1 -SNP2972R, 5 μL 2× PARMS master mix, ddH2O to a final volume of 10 μL; 10-100 ng DNA template, 0.15 μL waxy1 -SNP3058F, 0.15 μL waxy1 -SNP3058Rc / Rt, 5 μL 2× PARMS mastermix, ddH2O to bring to 10 μL; The quantitative PCR amplification program was set as follows: 1) Pre-denaturation at 94 ℃ for 20 min; 2) Denaturation at 94 ℃ for 20 s, annealing temperature range of 57-65 ℃, temperature decrease of 0.8 ℃ for each cycle, annealing time of 1 min per cycle; 3) Denaturation at 94 ℃ for 20 s, annealing at 57 ℃ for 1 min, 32 cycles.

[0016] Specifically, in step (2), the method for determining the genotype is as follows: if the competing primers appear in the maize inbred line to be tested... waxy1 -SNP2972Fg waxy1 The fluorescence signal of -SNP3058Rc was observed, but the competing primer was not present. waxy1 -SNP2972Fa、 waxy1 If the inbred line shows a fluorescence signal of -SNP3058Rt, it is classified as CC genotype; if the inbred line tested shows the presence of the aforementioned competing primers... waxy1 -SNP2972Fa、 waxy1 The fluorescence signal of -SNP3058Rt was observed, but the competing primer was not present. waxy1 -SNP2972Fg waxy1 If the fluorescence signal of -SNP3058Rc is detected, the inbred line is recorded as the TT genotype.

[0017] Specifically, in step (3), the method for determining the gelatinization temperature and enthalpy value of corn kernel starch is as follows: carrying SNP2972 CC The starch gelatinization temperature of maize inbred lines carrying the allele 2972 ​​was significantly lower than that of lines carrying SNP 2972.TT The inbred line has a significantly higher enthalpy than SNP2972. TT Type inbred line; carrying SNP3058 CC The starch gelatinization temperature of maize inbred lines with alleles was significantly higher than that of SNP3058. TT The inbred line has a significantly lower enthalpy than SNP3058. TT Type self-inbred line.

[0018] Through the above technical solution, the present invention achieves the following beneficial effects: 1. The molecular markers provided by this invention can be used to quickly and accurately identify maize germplasm resources of different genotypes. They can be widely used in molecular marker-assisted breeding and whole-genome selection breeding of maize kernel starch gelatinization temperature and enthalpy value, thereby accelerating the breeding process. 2. The molecular markers provided by this invention can be used for tracking waxy1 The distribution and transmission patterns of SNP variations in intron and exon regions of maize in the maize genetic population provide a powerful tool for in-depth research on their genetic mechanisms in maize kernel starch gelatinization temperature and enthalpy. 3. The molecular markers provided by this invention can be combined with molecular markers of other related genes to construct a molecular breeding technology system for corn starch quality, thereby achieving precise improvement of corn starch quality. Attached Figure Description

[0019] Figure 1 yes waxy1 Association analysis diagram of candidate genes with starch gelatinization temperature and enthalpy value of maize kernels, with circles and triangles representing SNPs and InDel, respectively; Figure 2 It carries SNP2972 CC SNP2972 TT Maize inbred lines with alleles and those carrying SNP3058 CC SNP3058 TT Phenotypic comparison of starch gelatinization temperature (A) and enthalpy (B) of maize inbred lines with alleles; Figure 3 It is based on molecular markers of 144 maize inbred lines. waxy1- SNP2972, waxy1- SNP3058 scatter plot. Detailed Implementation

[0020] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0021] Example 1: Discovery of the correlation between starch gelatinization temperature and enthalpy in maize kernels at SNP2972 and SNP3058 sites. In order to investigate waxy1 Functional sites affecting starch gelatinization temperature and enthalpy of maize kernels were targeted and captured in 335 maize inbred lines. waxy1 The full-length sequence was re-sequencing, and combined with the starch gelatinization temperature and enthalpy of maize inbred lines, analysis was performed. waxy1 Association analysis of candidate genes with variant sites and grain starch gelatinization temperature and enthalpy. Four Indel and two SNP sites were identified in their intron and exon regions that were significantly associated with grain starch gelatinization temperature and enthalpy. Figure 1 Of these maize inbred lines, 100 were CC genotyped at SNP2972, while 233 were TT genotyped; 300 were CC genotyped at SNP3058, while 33 were TT genotyped. To further clarify the effects of the two SNP loci on maize kernel starch gelatinization temperature and enthalpy, starch quality traits of inbred lines with different genotypes were compared. Analysis of variance showed that inbred lines carrying SNP2972... CC The starch gelatinization temperature of maize inbred lines carrying the allele 2972 ​​was significantly lower than that of lines carrying SNP 2972. TT Inbred lines ( p = 3.5 × 10 -11 The enthalpy value is significantly higher than that of SNP2972. TT Type inbred lines ( p = 1.9 × 10 -11 ); Carrying SNP3058 CC The starch gelatinization temperature of the maize inbred lines with the allele was significantly higher than that of SNP3058. TT Inbred lines ( p = 2.0 × 10 -16 The enthalpy value is significantly lower than that of SNP3058. TT Type inbred lines ( p =9.2 × 10 -11 This indicates that the two variant sites may affect the starch gelatinization temperature and enthalpy of maize kernels. Figure 2 ).

[0022] Example 2: Development and application of PARMS molecular markers 1. Development of PARMS molecular markers based on waxy1SNP2972 and SNP3058 variants in the intron and exon regions of the gene were used to design PARMS genotyping systems: each system contained two allele-specific primers (connected to FAM and HEX fluorescent tags respectively) and one universal reverse primer; ROX fluorescent dye was added to the PCR reaction system as a fluorescence correction internal control to eliminate the difference in fluorescence background between wells.

[0023] 2. Identification of SNP2972 and SNP3058 genotypes A natural population of 144 maize inbred lines was selected, and genotyping was performed using the molecular markers developed above. The specific steps included: (1) PARMS real-time PCR (i) Using the genomic DNA of the maize inbred line to be tested as a template, and using the designed primers ( waxy1- SNP2972Fg, waxy1- SNP2972Fa, waxy1 -SNP2972R, waxy1- SNP3058Rc waxy1- SNP3058Rt and waxy1 Quantitative real-time PCR was performed using SNP3058F. The reaction volume was 10 μL, specifically: 10-100 ng DNA template, 0.15 μL... waxy1 -SNP2972Fa / Fg, 0.15 μL waxy1 -SNP2972R, 5 μL 2× PARMS master mix, ddH2O to a final volume of 10 μL; 10-100 ng DNA template, 0.15 μL waxy1 -SNP3058F, 0.15 μL waxy1 -SNP3058Rc / Rt, 5μL 2× PARMS master mix, ddH2O to bring the total to 10 μL; (ii) The PARMS real-time PCR amplification program was set as follows: 1) Pre-denaturation at 94 ℃ for 20 min; 2) Denaturation at 94 ℃ for 20 s, annealing temperature range of 57-65 ℃, temperature decrease of 0.8 ℃ for each cycle, annealing time of 1 min per cycle; 3) Denaturation at 94 ℃ for 20 s, annealing at 57 ℃ for 1 min, 32 cycles.

[0024] (iii) After PCR, the fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and then the fluorescence signal was analyzed and converted using the online software snpdecoder to obtain a clear and intuitive genotyping diagram. The genotype results were output according to the different colors. The results showed that the specific primer connected to the FAM fluorescent group appeared in blue in the detection result, indicating the CC genotype, and the specific primer connected to the HEX fluorescent group appeared in green in the detection result, indicating the TT genotype.

[0025] (3) Classification results The genotyping results for all samples from the 144 maize inbred lines are shown below. Figure 3 The genotype identification results, grain starch gelatinization temperature, and enthalpy values ​​of all samples are shown in Table 1.

[0026] Table 1. Genotypes and phenotypes of tested maize inbred lines

[0027] Based on SNP2972, 144 maize inbred lines were divided into two genotypes: 44 homozygous CC lines and 100 homozygous TT lines. Similarly, based on SNP3058, the population was divided into 115 homozygous CC lines and 29 homozygous TT lines. Further comparison of the two traits between the two genotypes was conducted using SPSS 19.0. The results showed that the two genotypes carrying SNP2972 and SNP3058 were compared in Table 1. CC The starch gelatinization temperature of maize inbred lines carrying the allele 2972 ​​was significantly lower than that of lines carrying SNP 2972. TT The inbred line has a significantly higher enthalpy than SNP2972. TT Type inbred line; carrying SNP3058 CC The starch gelatinization temperature of maize inbred lines with alleles was significantly higher than that of SNP3058. TT The inbred line has a significantly lower enthalpy than SNP3058. TT Type inbred lines (Table 2).

[0028] Table 2. Comparison of kernel starch gelatinization temperature and enthalpy at different genotypes of SNP2972 and SNP3058 loci in maize inbred line populations.

[0029] The above results indicate that PARMS molecular markers developed based on two SNP loci are of great significance for the targeted genetic improvement of maize starch quality. Furthermore, PARMS molecular markers are now widely used in marker-assisted selection breeding of various crops, significantly improving the efficiency of genotyping in large-scale breeding populations. This invention targets maize...waxy1 Two PARMS molecular markers were developed based on natural SNP variations at two sites in the intron and coding region of a maize gene. These two SNP sites were highly significantly associated with the gelatinization temperature and enthalpy of maize kernel starch. The two PARMS molecular markers, designed in conjunction with the gene, can accurately, efficiently, and stably distinguish between the CC and TT homozygous genotypes. This set of molecular markers can be widely applied to marker-assisted breeding of high-quality maize, providing key technical support and theoretical basis for cultivating new maize varieties with excellent starch processing characteristics. This invention not only provides a novel high-throughput molecular detection tool for the genetic improvement of maize starch quality but also provides a basis for systematic analysis... waxy1 The molecular mechanism by which genes regulate the physicochemical properties of starch provides a new research perspective.

[0030] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0031] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0032] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. The application of a reagent for detecting bases at positions 23268178 and 23268092 on maize chromosome 9 in selective breeding for starch gelatinization temperature and enthalpy value in maize kernels, characterized in that... If the genotype CC is detected at position 23268178 on chromosome 9 of maize, it indicates that the starch gelatinization temperature of maize kernels is low and the enthalpy value is high; if the genotype CC is detected at position 23268092 on chromosome 9 of maize, it indicates that the starch gelatinization temperature of maize kernels is high and the enthalpy value is low.

2. The application of a reagent for detecting bases at positions 23268178 and 23268092 on maize chromosome 9 in the preparation of a screening kit for maize kernel starch gelatinization temperature and enthalpy, characterized in that... If the genotype CC is detected at position 23268178 on chromosome 9 of maize, it indicates that the starch gelatinization temperature of maize kernels is low and the enthalpy value is high; if the genotype CC is detected at position 23268092 on chromosome 9 of maize, it indicates that the starch gelatinization temperature of maize kernels is high and the enthalpy value is low.

3. The application according to claim 1 or 2, characterized in that, The reagent mentioned is a primer.

4. The application according to claim 3, characterized in that, The primers are the PARMS detection primer set.

5. The application according to claim 4, characterized in that, The primer set includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.

1. waxy1 -SNP2972Fg, forward primer with nucleotide sequence as shown in SEQ ID NO.2 waxy1 -SNP2972Fa; reverse primer with nucleotide sequence as shown in SEQ ID NO.3 waxy1 -SNP2972R; reverse primer with nucleotide sequence as shown in SEQ ID NO.4 waxy1 -SNP3058Rc, reverse primer with nucleotide sequence as shown in SEQ ID NO.5 waxy1 -SNP3058Rt; forward primer with nucleotide sequence as shown in SEQ ID NO.6 waxy1 -SNP3058F.

6. A method for detecting the gelatinization temperature and enthalpy value of corn kernel starch, characterized in that, It includes the following steps: (1) As described in claim 5 waxy1 -SNP2972Fg waxy1 The 5' end of the SNP3058Rc is connected to a FAM fluorescent probe. waxy1 -SNP2972Fa、 waxy1 The 5' end of the SNP3058Rt is linked to a HEX fluorescent probe, and the genomic DNA of the maize inbred line to be tested is used as a template for quantitative real-time PCR amplification using a primer set. (2) Perform fluorescence signal scanning and genotype cluster analysis on the amplification products to determine the genotype of the test material at bases 23268178 and 23268092 on chromosome 9 of maize; (3) Determine the gelatinization temperature and enthalpy of corn kernel starch based on the genotype test results.

7. The method according to claim 6, characterized in that, In step (1), The quantitative real-time PCR reaction system is as follows: 10-100 ng DNA template, 0.15 μL waxy1 -SNP2972Fa / Fg, 0.15μL waxy1 -SNP2972R, 5 μL 2× PARMS master mix, ddH2O to a final volume of 10 μL; 10-100 ng DNA template, 0.15 μL waxy1 -SNP3058F, 0.15 μL waxy1 -SNP3058Rc / Rt, 5 μL 2× PARMS mastermix, ddH2O to bring to 10 μL; The quantitative PCR amplification program was set as follows: 1) Pre-denaturation at 94 ℃ for 20 min; 2) Denaturation at 94 ℃ for 20 s, annealing temperature range of 57-65 ℃, temperature decrease of 0.8 ℃ for each cycle, annealing time of 1 min per cycle; 3) Denaturation at 94 ℃ for 20 s, annealing at 57 ℃ for 1 min, 32 cycles.

8. The method according to claim 6, characterized in that, In step (2), the genotype is determined as follows: if the competing primers appear in the maize inbred line to be tested... waxy1 -SNP2972Fg waxy1 The fluorescence signal of -SNP3058Rc was observed, but the competing primer was not present. waxy1 -SNP2972Fa、 waxy1 If the fluorescence signal of -SNP3058Rt is detected, the inbred line is recorded as the CC genotype; If the competing primers appear in the inbred line to be tested waxy1 -SNP2972Fa、 waxy1 The fluorescence signal of -SNP3058Rt was observed, but the competing primer was not present. waxy1 -SNP2972Fg waxy1 If the fluorescence signal of -SNP3058Rc is detected, the inbred line is recorded as the TT genotype.

9. The method according to claim 6, characterized in that, In step (3), the method for determining the gelatinization temperature and enthalpy value of corn kernel starch is as follows: (The text abruptly ends here, likely due to an incomplete sentence or a missing section.) CC The starch gelatinization temperature of maize inbred lines carrying the allele 2972 ​​was significantly lower than that of lines carrying SNP 2972. TT The inbred line has a significantly higher enthalpy than SNP2972. TT Type inbred line; carrying SNP3058 CC The starch gelatinization temperature of maize inbred lines with alleles was significantly higher than that of SNP3058. TT The inbred line has a significantly lower enthalpy than SNP3058. TT Type self-inbred line.