A transposon molecular marker for identifying oryza officinalis subsp of rice and application thereof
Patent Information
- Application Number
- CN202611062326.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-17
- Publication Date
- 2026-09-18
- Estimated Expiration
- 2046-07-17
AI Technical Summary
[0004]尽管如此,但目前缺乏单一、特异性的分子标记用于准确鉴别奥斯稻亚种
1、特异性强:本公开鉴别水稻奥斯稻亚种的转座子分子标记在奥斯稻亚种的品种中均存在F770转座子插入,而在非奥斯稻亚种的品种中均缺失,具有极高鉴别准确率。
Smart Images

Figure CN122564173B_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to the fields of molecular biology and crop genetics and breeding technology, and in particular to a transposon molecular marker for identifying the subspecies of rice, Ossetia, and its application. Background Technology
[0002] Rice (Oryza sativa L.) is a staple crop for more than half of the world's population and a model organism for plant genetics and genomics research. The classification, identification, and trait discovery of its germplasm resources are crucial for ensuring global food security. Based on ecological, genetic, and genomic characteristics, cultivated rice in Asia can be divided into two major subspecies: indica and japonica, and two minor subspecies: aus and aromatic (3K RGP: The 3,000 Rice Genomes Project). GigaScience 2014, 3:7; WS Wang, R. Mauleon, ZQHu , et al. : Genomic variation in 3,010 diverse accessions of Asian cultivated rice. Nature 2018, 557:43; D. Guo, Y. Li, H. Lu , et al. : A pangenome reference of wild and cultivated rice. Nature 2025, 642:662-671). Indica rice and Aus rice are closely related, while Japonica rice and fragrant rice are closely related. Aus rice originated in central India or Bangladesh and includes two seasonal ecotypes: aus and boro. "Aus" refers to the planting season from April to August, while "boro" refers to the planting season from December to May. In addition, Aus rice also includes deep-water rice (ashina) from Assam, India, and Bangladesh, as well as Rayada rice from a small geographical area along the Madhumati River in Bangladesh.
[0003] Compared with other rice subspecies, *Ossio* exhibits outstanding tolerance to abiotic stresses such as high temperature and drought, making it an important and superior germplasm resource for rice stress resistance breeding. Several important rice stress resistance genes have been reported for the first time in *Ossio*, such as... Drol , OsPSTOL1 , SNORKELs , OsSublFurthermore, these alleles are not present in the reference genome of Nipponbare japonica rice. This fully demonstrates that the Oss rice genome contains a large number of undiscovered novel superior alleles, which are of great value for breaking through existing bottlenecks in rice breeding and cultivating superior rice varieties adapted to extreme climates.
[0004] Nevertheless, a single, specific molecular marker is currently lacking for the accurate identification of *Ossioides* subspecies. Existing identification methods often rely on multi-site analysis or whole-genome sequencing, which are costly and cumbersome. Therefore, the development of an efficient and low-cost *Ossioides*-specific molecular marker is particularly urgent. Summary of the Invention
[0005] This disclosure provides a transposon molecular marker for rapid and accurate identification of the rice subspecies Ossetia and its application, in order to at least solve the above-mentioned technical problems existing in the prior art.
[0006] According to a first aspect of this disclosure, a transposon molecular marker for identifying the rice subspecies *Ossetia* is provided. The transposon molecular marker is a *Ossetia* subspecies-specific transposon insertion marker, with the insertion site located between nucleotides 33,472,562 and 33,472,563 on chromosome 3 of the *Nipponbare* rice reference genome version IRGSP-1.0, and is a transposon of 286 bp in length. Varieties of the *Ossetia* subspecies contain the transposon insertion at the insertion site, while varieties of other rice subspecies do not contain the transposon insertion at the insertion site.
[0007] In one possible implementation, the transposer is F770 Transposable.
[0008] In a preferred embodiment, the nucleotide sequence of the transposon is shown in SEQ ID NO:1.
[0009] In one embodiment, the other rice subspecies include indica rice, japonica rice, and / or fragrant rice.
[0010] According to a second aspect of this disclosure, this disclosure provides a PCR primer set for amplifying the above-mentioned transposon molecular marker, the PCR primer set being designed based on the flanking sequences on both sides of the insertion site of the above-mentioned transposon molecular marker, and capable of specifically amplifying the above-mentioned transposon molecular marker.
[0011] In one embodiment, the upstream 200 bp flanking sequence and the downstream 200 bp flanking sequence of the flanking sequence are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.
[0012] In a preferred embodiment, the nucleotide sequences of the PCR primer combination are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0013] According to a third aspect of this disclosure, this disclosure provides a kit for identifying the subspecies of rice, Ossetia, the kit comprising the above-described PCR primer combination.
[0014] In one embodiment, the kit further includes: PCR reaction buffer, DNA polymerase, dNTPs and / or standard control samples (including a positive control of rice genomic DNA known to be of the Ossetia subspecies and a negative control of rice genomic DNA known to be of non-Ossetia subspecies).
[0015] According to the fourth aspect of this disclosure, this disclosure provides the use of the above-described transposon molecular markers, the above-described PCR primer combinations, or the above-described kits in any of the following: A1. Application in identifying or assisting in the identification of the Osperido subspecies of rice; A2. Application in the preparation of products for identification or auxiliary identification of rice subspecies Ossetia.
[0016] According to the fifth aspect of this disclosure, this disclosure provides a method for identifying whether a rice variety to be tested belongs to the Ossetia subspecies, comprising the following steps: S1. DNA Extraction: Extract genomic DNA from the rice sample to be tested (such as leaves, seeds, etc.); S2. PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using the above-mentioned PCR primer combination to obtain PCR amplification products; S3. Result Interpretation: The PCR amplification products were detected by agarose gel electrophoresis. If the PCR amplification product contains the above-mentioned transposon molecular marker insertion, the rice to be tested is determined to belong to the Osage subspecies. If the PCR amplification product does not contain the above-mentioned transposon molecular marker insertion (i.e., only contains flanking sequences), then the rice to be tested is determined to belong to other rice subspecies (such as indica rice, japonica rice, or fragrant rice).
[0017] According to one possible implementation of this disclosure, at least the following beneficial effects are achieved: 1. High specificity: The transposon molecular markers for identifying the rice subspecies *Ostilago* of this invention are present in all varieties of *Ostilago* subspecies. F770 The transposon insertion is present in varieties other than Osage subspecies, resulting in a very high accuracy rate for identification.
[0018] 2. Simple operation: The Oss subspecies of rice can be accurately identified by relying on a single transposon molecular marker for identifying the Oss subspecies of rice disclosed in this invention, avoiding the cumbersome use of multiple markers; only a pair of PCR primers and one PCR reaction are required, without the need for complex genotyping techniques or expensive instruments and equipment.
[0019] 3. Low cost: Compared with identification methods based on SNP chips or high-throughput sequencing, the method disclosed herein for identifying rice subspecies Ossetia has a significantly lower cost and is suitable for large-scale sample screening.
[0020] It should be understood that the description in this section is not intended to identify key or essential features of the embodiments of this disclosure, nor is it intended to limit the scope of this disclosure. Other features of this disclosure will become readily apparent from the following description. Attached Figure Description
[0021] The above and other objects, features, and advantages of this disclosure will become readily apparent from the following detailed description of exemplary embodiments, taken in conjunction with the accompanying drawings. Several embodiments of this disclosure are illustrated in the drawings by way of example and not limitation, in which: In the accompanying drawings, the same or corresponding reference numerals indicate the same or corresponding parts.
[0022] Figure 1 The locations of transposon molecular markers for identifying rice subspecies of Ossetia in this disclosure in the rice genome are shown (A) and structural diagrams in different subspecies (B); in A, TSD (Target Site Duplication) represents the target site repeat sequence.
[0023] Figure 2 The results of identifying 41 different rice subspecies based on genome sequence using transposon molecular markers for identifying the Ossiodinae subspecies are shown in Table 1. The rice subspecies represented by Acc_1 to Acc_41 are shown in Table 1.
[0024] Figure 3 The results of PCR amplification based on transposon molecular markers for identifying rice subspecies Ossetia are shown in Table 2. M is a DNA molecular weight marker, and the rice subspecies represented by 1 to 20 are shown in Table 2. Detailed Implementation
[0025] To make the objectives, features, and advantages of this disclosure more apparent and understandable, the technical solutions in the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this disclosure, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this disclosure without creative effort are within the scope of protection of this disclosure.
[0026] The transposon molecular marker disclosed in this paper for identifying the subspecies of *Australopithecus* is a subspecies-specific transposon insertion marker, with its insertion site located between nucleotides 33,472,562 and 33,472,563 on chromosome 3 of the *Nipponbare* rice reference genome (IRGSP-1.0 version). Figure 1 ), which is 286 bp in length F770 Transposons; varieties of the rice subspecies *Osmanthus* contain this genome locus. F770 Transposon insertion, while other rice subspecies (Indica, Japonica, and / or Fragrant Rice) do not contain this genomic locus. F770 Insert the rotary connector.
[0027] The F770 The sequence of the transposon is shown in SEQ ID NO:1, specifically: GGGCCGTTTTTGGTTTGATACCAAAATGTTGCCATACCAATGTTTTGGTAGTTTAAATAGTAAATGTGATGATTTGGTTTAAAGCCAAATATTTGGTAATACCTATACTCAATTTGGCACAATTCTAGAATGTTCTTCACCAT AATTTGAAATTTGGCTCTCAATTGGCATCAATCCAAAGACACTTATTTACAATTCTACCCTACCAAAATATTGGTAGTGCCAAAACTTGCCTAGAGTTTGGCACTACCAATATATTGGTAGGGTACTAAACCCAAACAAGCCC The F770 The upstream 200bp flanking sequence of the transposon is shown in SEQ ID NO:2, specifically: ATTGAAATATTAGCAACTATTAAAGCATTTGTTTCTCATCTGTATTAATTAATCATATAATTGAGTGCACAAGAACAAGAAATCACTAGGCATCCGGACTAGTTTTTCTACGGCTGAGGTCAAGTGGTTAAAAGCATATGATTCGGGCAAGAAGTCTCTGATGCGTTGTGCTTTCTTACGCTTGCGTTGCGGCGGATTAA The F770 The downstream 200bp flanking sequence of the transposon is shown in SEQ ID NO:3, specifically: ATTAACAACGAATCAGAGGCCAAAGAAAAGAGAGCCCCTACGAGCTGCATAAAACTCTTCTTCTAGAAAGGGCGACACCGACACGTGCATTCTGGAGAAAAATGGGTGGCTCGACTCGACAAGCCACGGTAACCTTCTTTCGGTGCGTCATTGTCTAGCGACAGAGGGAGACGGTCTAGAACCGGAGGAAGTCCTGCTCA Example 1 This embodiment describes a method for identifying *Ossetia* subspecies based on genome sequence using transposon molecular markers. The specific process is as follows: I. Materials Forty-one rice accessions with known subspecies classifications and genome assembly were selected, as shown in Table 1. These included 12 japonica rice varieties, 11 indica rice varieties, 11 Australopithecus rice varieties, and 7 aromatic rice varieties.
[0028] Table 1 Information on 41 rice samples
[0029] II. Methods 1. Extract the transposon molecular markers shown in SEQ ID NO:1 according to the method for identifying the subspecies of Ossetia as described in this disclosure. F770 Transposons, as shown in SEQ ID NO:2 F770 The upstream 200bp flanking sequence of the transposon, shown in SEQ ID NO:3 F770 Downstream 200bp flanking sequence of the transposon.
[0030] 2. Download the genome assembly sequences of each rice variety listed in Table 1 from the following URL. Acc_1:https: / / zenodo.org / doi / 10.5281 / zenodo.12770803; Acc_2: https: / / www.ncbi.nlm.nih.gov / assembly / GCA_040181785.1 / ; (The "Oryza sativa Indica Group" listed on the webpage is incorrect. Consulting the relevant literature "K. Sedeek, N. Mohammed, Y. Zhou, et al.: Multitrait engineering of Hassawi red rice for sustainable cultivation. Plant Sci 2024, 341:112018." confirms that the corresponding variety is indeed Oryza sativa Indica.) Acc_3:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH144.te_GWHDRFC00000000 / GWHDRFC00000000.genome.fasta.gz; Acc_4:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH227.te_GWHDRHS00000000 / GWHDRHS00000000.genome.fasta.gz; Acc_5:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH241.te_GWHDRIB00000000 / GWHDRIB00000000.genome.fasta.gz; Acc_6:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_AUS449_GWHESQL00000000 / GWHESQL00000000.genome.fasta.gz; Acc_7: https: / / zenodo.org / doi / 10.5281 / zenodo.12770803; Acc_8:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG49.fixed.fa.gz ; Acc_9:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG6.fixed.fa.gz ; Acc_10:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG60.fixed.fa.gz ; Acc_11:https: / / www.ncbi.nlm.nih.gov / nuccore / VYIG00000000; Acc_12:https: / / www.ncbi.nlm.nih.gov / assembly / GCA_052625515.1 / ; Acc_13:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH193.te_GWHDRGP00000000 / GWHDRGP00000000.genome.fasta.gz ; Acc_14:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG17.fixed.fa.gz ; Acc_15:https: / / www.ncbi.nlm.nih.gov / nuccore / VYIH00000000; Acc_16:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH005.te_GWHDRAP00000000 / GWHDRAP00000000.genome.fasta.gz ; Acc_17:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH040.te_GWHDRBS00000000 / GWHDRBS00000000.genome.fasta.gz ; Acc_18:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH142.te_GWHDRFA00000000 / GWHDRFA00000000.genome.fasta.gz ; Acc_19:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH191.te_GWHDRGN00000000 / GWHDRGN00000000.genome.fasta.gz ; Acc_20:https: / / www.ncbi.nlm.nih.gov / assembly / GCF_001433935.1; Acc_21:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH022.te_GWHDRBE00000000 / GWHDRBE00000000.genome.fasta.gz ; Acc_22:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH168.te_GWHDRFV00000000 / GWHDRFV00000000.genome.fasta.gz ; Acc_23:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG14.fixed.fa.gz ; Acc_24:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH051.te_GWHDRCA00000000 / GWHDRCA00000000.genome.fasta.gz ; Acc_25:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH133.te_GWHDRER00000000 / GWHDRER00000000.genome.fasta.gz ; Acc_26:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH178.te_GWHDRGD00000000 / GWHDRGD00000000.genome.fasta.gz ; Acc_27:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH222.te_GWHDRHO00000000 / GWHDRHO00000000.genome.fasta.gz ; Acc_28:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH166.te_GWHDRFT00000000 / GWHDRFT00000000.genome.fasta.gz ; Acc_29:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH184.te_GWHDRGI00000000 / GWHDRGI00000000.genome.fasta.gz ; Acc_30:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH011.te_GWHDRAV00000000 / GWHDRAV00000000.genome.fasta.gz ; Acc_31:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG9.fixed.fa.gz ; Acc_32:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG33.fixed.fa.gz ; Acc_33:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG5.fixed.fa.gz ; Acc_34:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG61.fixed.fa.gz; Acc_35:http: / / ricerc.sicau.edu.cn / ; Acc_36:https: / / zenodo.org / record / 3355330#.X5KEU1MzbOQ; Acc_37:https: / / zenodo.org / record / 3355330#.X5KEU1MzbOQ; Acc_38:https: / / figshare.com / s / e8bd43ec6e29f56d9edd; Acc_39:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG81.fixed.fa.gz; Acc_40:https: / / www.ncbi.nlm.nih.gov / nuccore / VYID00000000; Acc_41: https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / WW8.fixed.fa.gz.
[0031] 3. Use the following command line to create an index for the genome assembly sequences of each rice variety: makeblastdb -inRiceGenome.fasta -dbtype nuc, where RiceGenome.fasta refers to the filename where the genome assembly sequences of each rice variety are stored.
[0032] 4. The 400 bp flanking sequences (upstream 200 bp flanking sequences + downstream 200 bp flanking sequences) marked by BLAST software were compared with the genome assembly sequences of each rice variety. The command line used was as follows: blastn -task blastn -query FlankingSeq.fasta -db RiceGenome.fasta -out Results.txt -outfmt7 -evalue 10.
[0033] 5. If the upstream and downstream 200 bp flanking sequences are directly connected in the alignment results, it indicates that the sequence does not contain [a specific type of sequence]. F770 Insert the transposon; otherwise, contain F770 Insert the rotary connector.
[0034] III. Results Genomic sequence identification results as follows Figure 2 As shown, the results indicate that all 11 Osmunda varieties contain [the following substance] at the insertion site. F770 The transposon insertion had a population frequency of 100%; however, none of the 11 indica rice varieties, 12 japonica rice varieties, and 7 aromatic rice varieties had the transposon insertion at the insertion site, with a population frequency of 0%. The results were completely consistent with expectations, confirming that the transposon molecular markers used in this disclosure to identify the Ossiodina subspecies can accurately distinguish the Ossiodina subspecies from other rice subspecies (Indica, Japonica, and aromatic rice).
[0035] Example 2 This embodiment describes a method for identifying *Ostilago tamariscina* subspecies using transposon molecular markers based on PCR. The specific process is as follows: I. Materials Twenty rice materials with known subspecies classifications were selected, as shown in Table 2, including 5 japonica rice varieties, 5 indica rice varieties, 5 Australis rice varieties, and 5 fragrant rice varieties.
[0036] Table 2 Information on 20 rice materials used for PCR amplification detection
[0037] II. Methods 1. Genomic DNA was extracted from each rice material using the standard CTAB method, as detailed below: 1) In a 2.0 mL centrifuge tube, add 500 μl of 2×CTAB and 20 μl of β-mercaptoethanol (2%), and preheat at 65 °C; 2) Take 1-2g of fresh tissue material, rinse it with distilled water, rinse it twice with sterile ddH2O, put it into a mortar pre-cooled with liquid nitrogen, add liquid nitrogen and grind it into powder, add a small amount of PVP (polyvinylpyrrolidone K30) in the middle, use a clean sterile stainless steel spoon to transfer the powder into a preheated centrifuge tube, the total volume reaches 1 ml, mix well and incubate in a 65℃ water bath for 45-60 minutes, and gently rotate the test tube from time to time. 3) Add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) and gently invert to mix. Let stand for 5 min to allow the reaction to proceed fully. Then centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to another new tube. 4) Add an equal volume of chloroform / isoamyl alcohol (24:1) and gently invert to mix. Let stand for 5 min to allow the reaction to proceed fully. Centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to another new tube. 5) Repeat step 4). 6) Add 2 volumes of ice-cold 100% ethanol or 0.7 volumes of isopropanol, incubate at -20°C for 30 min or at -80°C for 10 min, and centrifuge at 12000 rpm for 10 min after flocculent precipitate appears and recover the DNA precipitate. 7) Wash the precipitate with 70% ethanol, dry it, and then dissolve it in an appropriate amount of sterile TE buffer; 8) 0.8% agarose gel electrophoresis was used to detect the integrity of genomic DNA.
[0038] 2. Design specific PCR primer combinations based on the flanking sequences on both sides of the insertion site of the transposon molecular marker, as follows: Forward primer (F): 5'-ACGCTGAGGTCAAGTGG-3' (SEQ ID NO:4) Reverse primer (R): 5'-CAATGACGCACCGAAAGA-3' (SEQ ID NO:5) Expected PCR amplification product length: Ossiodina subspecies: 533 bp (including 244 bp flanking sequence + 286 bp) F770 (Transistor insertion +3 bp TSD) Other rice subspecies: 244 bp (flanking sequence only) 3. PCR reaction The PCR reaction system (25 μL) is shown in Table 3.
[0039] Table 3 PCR reaction system
[0040] The PCR amplification procedure is as follows: Pre-denaturation: 94°C, 5 min; Denaturation: 94°C, 30 s; Annealing: 53°C, 30 s; Extension: 72°C, 30 s; Number of cycles: 35 cycles; Final extension: 72°C, 5 min.
[0041] PCR products were detected by 2% agarose gel electrophoresis.
[0042] III. Results Agarose gel electrophoresis results are as follows Figure 3As shown, the results indicate that all five Osmanthus varieties amplified a specific large band of 533 bp, indicating that the corresponding positions (insertion sites) in their genomes all contain [the specific band]. F770 The insertion of transposons; and all five indica rice varieties, five japonica rice varieties, and five fragrant rice varieties amplified specific small bands of 244 bp, indicating that the corresponding positions in their genomes did not contain transposons. F770 The insertion of transposons. The results were completely consistent with expectations, further confirming that the present disclosure can accurately distinguish Ossiodina from other rice subspecies (Indica, Japonica and Aromatic rice) by using transposon molecular markers for identifying the Ossiodina subspecies.
[0043] It should be understood that the various forms of processes shown above can be used to rearrange, add, or delete steps. For example, the steps described in this disclosure can be executed in parallel, sequentially, or in different orders, as long as the desired result of the technical solution of this disclosure can be achieved, and this is not limited herein.
[0044] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature.
[0045] The above description is merely a specific embodiment of this disclosure, but the scope of protection of this disclosure is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this disclosure should be included within the scope of protection of this disclosure. Therefore, the scope of protection of this disclosure should be determined by the scope of the claims.
Claims
1. A method for identifying whether a rice variety belongs to the Ossetia subspecies, characterized in that, The method includes the following steps: S1. DNA Extraction: Extract genomic DNA from the rice sample to be tested; S2. PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using the PCR primer combination shown in SEQ ID NO:4 and SEQ ID NO:5 to obtain PCR amplification products; S3. Result Interpretation: The PCR amplification products were detected by agarose gel electrophoresis. If the PCR amplification product contains a transposon molecular marker insertion, the rice being tested is determined to belong to the Osage subspecies. If the PCR amplification product does not contain transposon molecular marker insertion, the rice to be tested is determined to belong to other rice subspecies, including indica rice, japonica rice and / or fragrant rice. The transposon molecular marker is a transposon insertion marker specific to the rice subspecies of Ossiodina. Its insertion site is located between nucleotides 33,472,562 and 33,472,563 on chromosome 3 of the Nipponbare rice reference genome of version IRGSP-1.0, and is a transposon with a length of 286 bp as shown in SEQ ID NO:1.
Citation Information
Patent Citations
Method for identifying indica rice and japonica rice by inserting or deleting molecular marker in rice DNA
CN101323878A
Molecular marker for identifying hybrid weakness genes between varieties of indica type rice and application of molecular marker
CN105063189A