A specific transposon insertion marker for identifying temperate japonica rice and its application

Abstract

This disclosure provides a specific transposon insertion marker for identifying temperate japonica rice and its application. First, the specific transposon insertion marker for identifying temperate japonica rice is located in the nucleotide region from position 14,055,731 to 14,055,944 of chromosome 9 in the IRGSP-1.0 rice Nipponbare reference genome, and is a 214 bp transposon. Temperate japonica rice varieties contain this transposon insertion, while varieties from other rice groups do not. The application of the above marker in identifying temperate japonica rice is further provided. This specific transposon insertion marker for identifying temperate japonica rice has significant application value in the accurate identification of rice groups, germplasm resource classification and breeding material screening, and hybrid rice germplasm purity detection. It can significantly improve the efficiency of molecular marker-assisted selection and shorten the breeding cycle.

Description

Technical Field

[0001] This disclosure relates to the field of biotype identification technology, and in particular to a specific transposon insertion marker for identifying temperate japonica rice and its application. Background Technology

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, with more than half of the global population relying on it as a staple food. Cultivated rice is mainly divided into two major subspecies: indica and japonica, and two minor subspecies: aus and aromatic (3K RGP: The 3,000 rice genomes project). GigaScience 2014, 3:7; WS Wang, R. Mauleon, ZQ Hu , et al. : Genomic variation in 3,010 diverse accessions of Asian cultivated rice. Nature 2018, 557:43; D. Guo, Y. Li, H. Lu , et al. : A pangenome reference of wild and cultivated rice. Nature 2025, 642:662-671). Among them, the japonica rice subspecies can be further divided into three ecotypes: temperate japonica, subtropical japonica, and tropical japonica (3K RGP: The 3,000 rice genomes project). GigaScience 2014,3:7; WS Wang, R. Mauleon, ZQ Hu , et al. : Genomic variation in 3,010diverse accessions of Asian cultivated rice. Nature 2018, 557:43; D. Guo, Y.Li, H. Lu , et al. : A pangenome reference of wild and cultivated rice. Nature 2025, 642:662-671).

[0003] Different ecotypes of japonica rice exhibit significant differences in geographical distribution, agronomic traits, and environmental adaptability. Temperate japonica rice is mainly distributed in high-latitude temperate regions such as northern China, Japan, and Korea, characterized by strong cold resistance, short and round grains, and a short growing season. Subtropical japonica rice is mainly distributed in subtropical regions such as the Yangtze River basin in China, southern Korea, and Kyushu in Japan, with a wider range of temperature and humidity adaptability, better heat resistance than temperate japonica rice, and relatively strong resistance to subtropical diseases such as rice blast. Tropical japonica rice is distributed in low-latitude tropical regions such as Indonesia, the Philippines, and Vietnam, with taller plants, strong tillering ability, and outstanding heat resistance, waterlogging resistance, and salt tolerance. Accurate taxonomic identification is the foundation for rice germplasm resource conservation, classification and utilization, and breeding material screening.

[0004] Traditional identification methods mainly rely on morphological observation and statistical analysis of agronomic traits, such as lemma length, grain shape, leaf hair density, and heading date. However, these methods are greatly affected by the environment, have long cycles, and limited accuracy. With the development of molecular biology techniques, molecular marker technologies based on DNA polymorphism (such as SSR, SNP, and InDel) have been widely used in rice genetic diversity analysis, variety identification, and phylogenetic studies. However, existing molecular markers are mostly focused on the identification between indica and japonica subspecies, and precise identification markers for different ecotypes within japonica rice remain very scarce.

[0005] Transposable element (TE) insertion polymorphism is an important type of genetic variation in plant genomes. Miniature inverted-repeat transposable elements (MITEs) are a class of non-autonomous transposables, typically 100-800 bp in length, with terminal inverted repeat (TIR) ​​sequences. They are widely distributed in plant genomes and have high copy numbers. The presence / deletion of MITE insertion sites is characterized by high stability, ease of detection, and rich polymorphic information, making it an ideal source for developing molecular markers.

[0006] Therefore, developing molecular markers based on transposon insertion polymorphism that can specifically identify temperate japonica rice has important theoretical value and practical significance for the accurate identification of rice germplasm resources, the detection of variety authenticity, the analysis of genetic background, and molecular-assisted breeding. Summary of the Invention

[0007] This disclosure provides a specific transposon insertion marker for identifying temperate japonica rice and its application, in order to at least solve the above-mentioned technical problems existing in the prior art.

[0008] According to a first aspect of this disclosure, a specific transposon insertion marker for identifying temperate japonica rice is provided, which is a 214 bp transposon located in the nucleotide region from position 14,055,731 to position 14,055,944 of chromosome 9 of the rice Nipponbare reference genome of version IRGSP-1.0; temperate japonica rice varieties contain the transposon insertion, while varieties of other rice groups do not contain the transposon insertion.

[0009] In one possible implementation, the transposer is Tess The transposon belongs to the MITE type, and its nucleotide sequence is shown in SEQ ID NO:1.

[0010] In one embodiment, the other rice groups include indica subspecies, Osage subspecies, fragrant rice subspecies, and / or other non-temperate japonica rice subspecies (tropical japonica rice or subtropical japonica rice).

[0011] According to a second aspect of this disclosure, this disclosure provides a PCR primer set for amplifying the above-mentioned specific transposon insertion marker, the PCR primer set being designed based on the flanking sequences on both sides of the above-mentioned specific transposon insertion marker, and capable of specifically amplifying the above-mentioned specific transposon insertion marker.

[0012] In one embodiment, the upstream 200bp flanking sequence and the downstream 200bp flanking sequence of the flanking sequence are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0013] In a preferred embodiment, the nucleotide sequences of the PCR primer combination are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0014] According to a third aspect of this disclosure, this disclosure provides a kit for identifying temperate japonica rice, the kit comprising the above-described PCR primer combination.

[0015] In one embodiment, the kit further includes: PCR reaction buffer, DNA polymerase, dNTPs and / or standard control samples (including a positive control of rice genomic DNA known to be from temperate japonica rice and a negative control of rice genomic DNA known to be from non-temperate japonica rice).

[0016] According to the fourth aspect of this disclosure, this disclosure provides the use of the above-described specific transposon insertion marker, the above-described PCR primer combination, or the above-described kit in any of the following: A1. Application in identifying or assisting in the identification of temperate japonica rice; A2. Application in the preparation of products for identification or auxiliary identification of temperate japonica rice.

[0017] According to the fifth aspect of this disclosure, this disclosure provides a method for identifying whether a rice variety to be tested belongs to temperate japonica rice, comprising the following steps: S1. DNA Extraction: Extract genomic DNA from the rice sample to be tested (such as leaves, seeds, etc.); S2. PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using the above-mentioned PCR primer combination to obtain PCR amplification products; S3. Result Interpretation: The PCR amplification products were detected by agarose gel electrophoresis. If the PCR amplification product contains the above-mentioned specific transposon insertion marker, the rice to be tested is determined to be temperate japonica rice. If the PCR amplification product does not contain the above-mentioned specific transposon insertion marker (i.e., only contains flanking sequences), then the rice to be tested is determined to belong to other rice groups (such as indica subspecies, fragrant rice subspecies, Osmodium subspecies and / or other non-temperate japonica rice subspecies).

[0018] According to one possible implementation of this disclosure, at least the following beneficial effects are achieved: 1. High specificity: The specific transposon insertion markers of temperate japonica rice disclosed in this invention are stably present in temperate japonica rice varieties, but are completely absent in other rice groups. This enables accurate identification of temperate japonica rice by a single marker, avoiding the cumbersome use of multiple markers.

[0019] 2. Simple and rapid operation: The PCR detection method developed based on the specific transposon insertion marker of temperate japonica rice disclosed in this paper can determine the results with only one PCR reaction and conventional agarose gel electrophoresis. It is simple to operate, low in cost, and high in throughput, which greatly improves the efficiency of molecular marker-assisted selection.

[0020] 3. High application value: The specific transposon insertion markers of temperate japonica rice disclosed in this paper have broad practical prospects in the precise identification of rice groups, classification of germplasm resources and screening of breeding materials, and detection of hybrid rice germplasm purity.

[0021] It should be understood that the description in this section is not intended to identify key or essential features of the embodiments of this disclosure, nor is it intended to limit the scope of this disclosure. Other features of this disclosure will become readily apparent from the following description. Attached Figure Description

[0022] The above and other objects, features, and advantages of this disclosure will become readily apparent from the following detailed description of exemplary embodiments, taken in conjunction with the accompanying drawings. Several embodiments of this disclosure are illustrated in the drawings by way of example and not limitation, in which: In the accompanying drawings, the same or corresponding reference numerals indicate the same or corresponding parts.

[0023] Figure 1 The location of the specific transposon insertion marker of temperate japonica rice disclosed in this paper in the rice genome is shown (A), and the structural diagram in different groups is shown (B); in A, TIR (Terminal Inverted Repeats) represents terminal inverted repeat sequences; TSD (Target Site Duplication) represents target site repeat sequences.

[0024] Figure 2 The results of the identification of 57 different rice materials from temperate japonica rice based on genome sequence using specific transposon insertion markers of this disclosure are shown; among them, the rice varieties represented by Acc_1 to Acc_57 are shown in Table 1.

[0025] Figure 3 The results of PCR detection of 30 different groups of rice materials using the specific transposon insertion marker of temperate japonica rice disclosed in this paper are shown; where M is a DNA molecular weight marker; the rice varieties represented by 1 to 30 are shown in Table 2. Detailed Implementation

[0026] To make the objectives, features, and advantages of this disclosure more apparent and understandable, the technical solutions in the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this disclosure, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this disclosure without creative effort are within the scope of protection of this disclosure.

[0027] The specific transposon insertion marker for temperate japonica rice disclosed in this study is located in the nucleotide region from position 14,055,731 to position 14,055,944 on chromosome 9 of the Nipponbare rice reference genome (IRGSP-1.0 version). Figure 1 ), which is a MITE type with a length of 214 bp. Tess Transposons and temperate japonica rice varieties all contain this MITE type. Tess Transposon insertion, while varieties from other rice groups do not contain this MITE type. Tess Insert the rotary connector.

[0028] The Tess The nucleotide sequence of the transposon is shown in SEQ ID NO:1 (the underlined part represents TIR), specifically: CAGGGTTTCATTTACCGCCGGGGCCGCGGTTACCGCGCCCCGGCGGTAAGCACGGTTACCGCACGGTAACCGCGGTAACCGTGACAAACCGCGACAAACCGTACAAAATTTATCAAAAATTCAAATTATTTTTTAAAATTTATTTGAATTTGACGCGGTTACCGCGGTTTTACCCCTTACCGTACCCCCGCGGTAAGC GCGGTAAATGCAACCCTG The Tess The upstream 200bp flanking sequence of the transposon is shown in SEQ ID NO:2, specifically: ACGAATTTCGGACTCGGCAACAATTTGAGGGACCTAAAGTGAACTTATTCCTCAAGAAGTTGCCGAGTTGCAGAATGCAGACTGCCAACTTCTCTCAAAGAAAAACTGGGGAAAAAAGACATTATCTTACCTGAGAGTTTGTTTGCAATTAGTGTTAAGTAAAGGCACTTGATCAACCTCTTATATAATCGAGTAAGAAG The Tess The downstream 200bp flanking sequence of the transposon is shown in SEQ ID NO:3, specifically: TACCCAATCACTACATATCCAGAGAGTATGGTCATCTCTAATGAAATGAAGACAAATGAGGATTCCATGTGATATGTTTACCATAGAAAAAAGATGATCATCTTGCAAGCACAAACATGCTCAGTGATGTAAAAAAAGAACATGAACAAAGTAGTAGTATGCAGCATCTGTTCTTGCATTCTGCAGCTTGTAAGT Example 1 This embodiment describes a method for identifying temperate japonica rice based on genome sequence using specific transposon insertion markers of temperate japonica rice disclosed in this invention. The specific process is as follows: I. Materials Fifty-seven rice accessions with known affiliations and genome assembly were selected, as shown in Table 1. These included 11 temperate japonica rice accessions, 9 subtropical japonica rice accessions, 8 tropical japonica rice accessions, 11 indica rice accessions, 11 Australopithecus accessioni accessions, and 7 aromatic rice accessions.

[0029] Table 1 Information on 57 rice samples

[0030] II. Methods 1. Extract the transposon insertion marker shown in SEQ ID NO:1 based on the specific transposon insertion marker of temperate japonica rice disclosed in this invention. Tess Transposons, as shown in SEQ ID NO:2 Tess The upstream 200bp flanking sequence of the transposon, shown in SEQ ID NO:3 Tess Downstream 200bp flanking sequence of the transposon.

[0031] 2. Download the genome assembly sequences of each rice variety from the following website. Acc_1:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH005.te_GWHDRAP00000000 / GWHDRAP00000000.genome.fasta.gz; Acc_2:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH013.te_GWHDRAX00000000 / GWHDRAX00000000.genome.fasta.gz; Acc_3:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH040.te_GWHDRBS00000000 / GWHDRBS00000000.genome.fasta.gz; Acc_4:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH135.te_GWHDRET00000000 / GWHDRET00000000.genome.fasta.gz; Acc_5:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH137.te_GWHDREV00000000 / GWHDREV00000000.genome.fasta.gz; Acc_6:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH142.te_GWHDRFA00000000 / GWHDRFA00000000.genome.fasta.gz ; Acc_7:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH145.te_GWHDRFD00000000 / GWHDRFD00000000.genome.fasta.gz ; Acc_8:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH146.te_GWHDRFE00000000 / GWHDRFE00000000.genome.fasta.gz ; Acc_9:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH191.te_GWHDRGN00000000 / GWHDRGN00000000.genome.fasta.gz ; Acc_10:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH204.te_GWHDRGY00000000 / GWHDRGY00000000.genome.fasta.gz ; Acc_11:https: / / www.ncbi.nlm.nih.gov / assembly / GCF_001433935.1 ; Acc_12:https: / / www.ncbi.nlm.nih.gov / assembly / GCA_052625515.1 / ; Acc_13:https: / / www.ncbi.nlm.nih.gov / assembly / GCA_965117795.1 / ; Acc_14:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH117.te_GWHDREF00000000 / GWHDREF00000000.genome.fasta.gz ; Acc_15:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH193.te_GWHDRGP00000000 / GWHDRGP00000000.genome.fasta.gz ; Acc_16:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH205.te_GWHDRGZ00000000 / GWHDRGZ00000000.genome.fasta.gz ; Acc_17:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_18:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_19:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_20:https: / / www.ncbi.nlm.nih.gov / nuccore / VYIH00000000 ; Acc_21:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH022.te_GWHDRBE00000000 / GWHDRBE00000000.genome.fasta.gz ; Acc_22:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH047.te_GWHDRBY00000000 / GWHDRBY00000000.genome.fasta.gz ; Acc_23:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH168.te_GWHDRFV00000000 / GWHDRFV00000000.genome.fasta.gz ; Acc_24:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH212.te_GWHDRHF00000000 / GWHDRHF00000000.genome.fasta.gz ; Acc_25:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_26:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_27:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_28:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_29:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH051.te_GWHDRCA00000000 / GWHDRCA00000000.genome.fasta.gz ; Acc_30:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH133.te_GWHDRER00000000 / GWHDRER00000000.genome.fasta.gz ; Acc_31:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH178.te_GWHDRGD00000000 / GWHDRGD00000000.genome.fasta.gz ; Acc_32:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH222.te_GWHDRHO00000000 / GWHDRHO00000000.genome.fasta.gz ; Acc_33:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH166.te_GWHDRFT00000000 / GWHDRFT00000000.genome.fasta.gz; Acc_34:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH184.te_GWHDRGI00000000 / GWHDRGI00000000.genome.fasta.gz; Acc_35:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH011.te_GWHDRAV00000000 / GWHDRAV00000000.genome.fasta.gz; Acc_36:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_37:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_38:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_39:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_40: https: / / zenodo.org / doi / 10.5281 / zenodo.12770803; Acc_41: https: / / www.ncbi.nlm.nih.gov / assembly / GCA_040181785.1 / ; (The "Oryza sativa Indica Group" listed on the webpage is incorrect. Further research revealed that the relevant literature includes "K. Sedeek, N. Mohammed, Y. Zhou...") , et al. : Multitrait engineering of Hassawi red rice forsustainable cultivation. Plant Sci 2024, 341:112018.” This confirms that the corresponding variety is indeed Osmocote. Acc_42:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH144.te_GWHDRFC00000000 / GWHDRFC00000000.genome.fasta.gz ; Acc_43:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH227.te_GWHDRHS00000000 / GWHDRHS00000000.genome.fasta.gz ; Acc_44:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH241.te_GWHDRIB00000000 / GWHDRIB00000000.genome.fasta.gz ; Acc_45:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_AUS449_GWHESQL00000000 / GWHESQL00000000.genome.fasta.gz ; Acc_46:https: / / zenodo.org / doi / 10.5281 / zenodo.12770803 ; Acc_47:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_48:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_49:https: / / cgm.sjtu.edu.cn / TGSrice / index.html ; Acc_50:https: / / www.ncbi.nlm.nih.gov / nuccore / VYIG00000000 ; Acc_51:http: / / ricerc.sicau.edu.cn / ; Acc_52:https: / / zenodo.org / record / 3355330#.X5KEU1MzbOQ ; Acc_53:https: / / zenodo.org / record / 3355330#.X5KEU1MzbOQ; Acc_54:https: / / figshare.com / s / e8bd43ec6e29f56d9edd; Acc_55:https: / / cgm.sjtu.edu.cn / TGSrice / index.html; Acc_56:https: / / www.ncbi.nlm.nih.gov / nuccore / VYID00000000; Acc_57: https: / / cgm.sjtu.edu.cn / TGSrice / index.html.

[0032] 3. Use the following command line to create an index for the genome assembly sequences of each rice variety: makeblastdb -inRiceGenome.fasta -dbtype nuc, where RiceGenome.fasta refers to the filename where the genome assembly sequences of each rice variety are stored; 4. The 400 bp flanking sequences (upstream 200 bp flanking sequences + downstream 200 bp flanking sequences) marked with BLAST software were compared with the genome assembly sequences of various rice varieties. The command line used was as follows: blastn -task blastn -query FlankingSeq.fasta -db RiceGenome.fasta -out Results.txt -outfmt7 -evalue 10; 5. If the upstream and downstream flanking sequences are directly connected in the alignment results, it indicates that the sequence does not contain... Tess Insert the transposon; otherwise, contain Tess Insert the rotary connector.

[0033] III. Results Genomic sequence identification results as follows Figure 2 As shown, the results indicate that all 11 temperate japonica rice varieties contain the following at the corresponding positions in their genomes (positions 14,055,731 to 14,055,944 on chromosome 9 of the Nipponbare rice reference genome (IRGSP-1.0 version)). Tess The insertion frequency of transposons was 100% in the population; however, none of the nine subtropical japonica rice, eight tropical japonica rice, eleven indica rice, eleven Ausnutria rice, and seven aromatic rice varieties contained this transposon at the corresponding location in their genomes. TessThe transposon insertion had a population frequency of 0%. The results were entirely consistent with expectations, confirming that the marker can accurately distinguish temperate japonica rice from other rice groups.

[0034] Example 2 This embodiment describes a method for identifying temperate japonica rice using PCR based on the specific transposon insertion markers of temperate japonica rice disclosed in this invention. The specific process is as follows: I. Materials Thirty rice materials with known affiliations were selected, as shown in Table 2, including five varieties each of temperate japonica rice, subtropical japonica rice, tropical japonica rice, indica rice, Australopithecus rice, and fragrant rice.

[0035] Table 2 Information on 30 rice materials used for PCR amplification detection

[0036] II. Methods 1. Genomic DNA was extracted from each rice material using the standard CTAB method, as detailed below: 1) In a 2.0 mL centrifuge tube, add 500 μl of 2×CTAB and 20 μl of β-mercaptoethanol (2%), and preheat at 65 °C; 2) Take 1-2g of fresh tissue material, rinse it with distilled water, rinse it twice with sterile ddH2O, put it into a mortar pre-cooled with liquid nitrogen, add liquid nitrogen and grind it into powder, add a small amount of PVP (polyvinylpyrrolidone K30) in the middle, use a clean sterile stainless steel spoon to transfer the powder into a preheated centrifuge tube, the total volume reaches 1 ml, mix well and incubate in a 65℃ water bath for 45-60 minutes, and gently rotate the test tube from time to time. 3) Add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) and gently invert to mix. Let stand for 5 min to allow the reaction to proceed fully. Then centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to another new tube. 4) Add an equal volume of chloroform / isoamyl alcohol (24:1) and gently invert to mix. Let stand for 5 min to allow the reaction to proceed fully. Centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to another new tube. 5) Repeat step (4); 6) Add 2 volumes of ice-cold 100% ethanol or 0.7 volumes of isopropanol, incubate at -20°C for 30 min or at -80°C for 10 min, and centrifuge at 12000 rpm for 10 min after flocculent precipitate appears and recover the DNA precipitate. 7) Wash the precipitate with 70% ethanol, dry it, and then dissolve it in an appropriate amount of sterile TE buffer; 8) 0.8% agarose gel electrophoresis was used to detect the integrity of genomic DNA.

[0037] 2. Design specific PCR primer combinations based on the flanking sequences of transposon-specific transposon insertion markers, as follows; Forward primer (F): 5'-TGAGGGACCTAAAGTGAA-3' (SEQ ID NO:4) Reverse primer (R): 5'-GTAGTGATTGGGTACTTCTTA-3' (SEQ ID NO:5) Expected PCR amplification product length: Temperate japonica rice: 421 bp (including 199 bp flank + 214 bp) Tess (Transistor insertion +8 bp TSD) Other rice groups: 199 bp (flanking sequences only) 3. PCR reaction The PCR reaction system (25 μL) is shown in Table 3.

[0038] Table 3 PCR reaction system

[0039] The PCR amplification procedure is as follows: Pre-denaturation: 94°C, 5 min; Denaturation: 94°C, 30 s; Annealing: 53°C, 30 s; Extension: 72°C, 30 s; Number of cycles: 35 cycles; Final extension: 72°C, 5 min.

[0040] PCR products were detected by 2% agarose gel electrophoresis.

[0041] III. Results Agarose gel electrophoresis results are as follows Figure 3 As shown, the results indicate that all five temperate japonica rice varieties amplified a specific large band of 421 bp, indicating that the corresponding positions in their genomes (corresponding to positions 14,055,731 to 14,055,944 on chromosome 9 of the Nipponbare rice reference genome (IRGSP-1.0 version)) all contain [the specific band]. Tess Transposon insertion; and all five subtropical japonica rice, five tropical japonica rice, five indica rice, five Australopithecus rice, and five fragrant rice varieties amplified a specific 199bp band, indicating that the corresponding positions in their genomes do not contain transposon insertion. Tess Transposon insertion. The results were completely consistent with expectations, further confirming that the specific transposon insertion markers of temperate japonica rice disclosed in this paper can accurately distinguish temperate japonica rice from other rice groups.

[0042] It should be understood that the various forms of processes shown above can be used to rearrange, add, or delete steps. For example, the steps described in this disclosure can be executed in parallel, sequentially, or in different orders, as long as the desired result of the technical solution of this disclosure can be achieved, and this is not limited herein.

[0043] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature.

[0044] The above description is merely a specific embodiment of this disclosure, but the scope of protection of this disclosure is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this disclosure should be included within the scope of protection of this disclosure. Therefore, the scope of protection of this disclosure should be determined by the scope of the claims.

Claims

1. A specific transposon insertion marker for identifying temperate japonica rice, characterized in that, The specific transposon insertion marker is located in the nucleotide region from position 14,055,731 to position 14,055,944 of chromosome 9 of the rice Nipponbare reference genome of version IRGSP-1.0, and is a transposon with a nucleotide sequence of 214 bp as shown in SEQ ID NO:1; temperate japonica rice varieties contain the transposon insertion, while varieties of other rice groups do not contain the transposon insertion, the other rice groups including indica subspecies, Osmanthus subspecies, fragrant rice subspecies and / or other japonica subspecies of non-temperate japonica rice.

2. The use of the reagent for detecting the specific transposon insertion mark of claim 1 in any of the following: A1. Application in identifying or assisting in the identification of temperate japonica rice; A2. Application in the preparation of products for identification or auxiliary identification of temperate japonica rice.

3. A method for identifying whether a rice variety to be tested belongs to temperate japonica rice, characterized in that, Includes the following steps: S1. DNA Extraction: Extract genomic DNA from the rice sample to be tested; S2. PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using the PCR primer combination shown in SEQ ID NO:4 and SEQ ID NO:5 to obtain PCR amplification products; S3. Result Interpretation: The PCR amplification products were detected by agarose gel electrophoresis. If the PCR amplification product contains the specific transposon insertion marker as described in claim 1, then the rice to be tested is determined to be temperate japonica rice. If the PCR amplification product does not contain the specific transposon insertion marker, the rice to be tested is determined to belong to other rice groups, including Indica rice subspecies, Osmanthus rice subspecies, Aromatic rice subspecies and / or other non-temperate japonica rice subspecies.

Images